Haplogroup I-M253

From Wikipedia, the free encyclopedia
  (Redirected from Haplogroup I1a (Y-DNA))
Jump to: navigation, search
Haplogroup I-M253

HG I1 europa.jpg

Possible time of origin 2,000-3,000 BC
Possible place of origin Europe
Ancestor I-M170
Defining mutations M253, M307, P30, P40

In human genetics, Haplogroup I-M253 is a Y chromosome haplogroup which occurs at greatest frequency in Fenno-Scandia. The mutations identified with Haplogroup I-M253 (Y-DNA) are M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs). It is a subclade of Haplogroup I. Before a reclassification in 2008,[1] the group was known as Haplogroup I1a.

The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland and more than 50 percent in the province of Satakunta,[2] and around 38 percent in Sweden as a whole, with a peak of 52 percent in Västra Götaland County in central Sweden.[3]


Haplogroup I-M253 arose from haplogroup I-M170, which appears ancient in Europe. The haplogroup was previously[year needed] thought to have originated 15,000 years ago in Iberia, but as of 2010 it was estimated to have originated between 4,000 - 5,000 years ago, in Chalcolithic Europe.[4] It is suggested that it initially dispersed from Denmark.[5]


Note: The systematic subclade names have changed several times in recent years,[year needed] and are likely to change again, as new markers which clarify the sequence of branchings of the tree are discovered.[6]

  • I-M253 (M253,[7] M307.2/P203.2,[8] L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187, L840, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111.[9]
    • I-DF29 (DF29/S438)
      • I-M227 (M227)
        • I-M72 (M72)
      • I-L22 (L22/S142)
        • I-P109 (P109)
        • I-L205 (L205)
        • I-L287 (L287)
          • I-L258 (L258/S335)
        • I-L300 (L300/S241)
        • I-L813 (L813)
      • I-Z58 (S244/Z58)
        • I-Z59 (S246/Z59)
          • I-Z60(S337/Z60, S439/Z61, Z62)
            • I-Z140 (Z140, Z141)
              • I-L338 (L338)
            • I-Z73 (Z73)
            • I-L573 (L573)
            • I-L803 (L803)
          • I-Z382 (Z382)
        • I-Z138 (S296/Z138, Z139)
      • I-Z63 (S243/Z63)
        • I-L1237 (L1237)
    • I-Z131 (Z131)

Distribution by population[edit]

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking period or modern times. It is found in all places invaded by the ancient Germanic peoples and the Vikings. In the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as United States, Australia and Canada.

Population Sample size I I-M253 (M253) I-M227 (M227) Source
Austria 43 9.3 2.3 0 Underhill et al 2007
Belarussians: Vitbsk 100 15 1 0 Underhill et al 2007
Belarussians: Brest 97 20.6 1 0 Underhill et al 2007
Bosnia 100 42 2 0 Rootsi et al 2004
Bulgaria 808 26.6 4.3 0 Karachanak et al 2013
Czech Republic 47 31.9 8.5 0 Underhill et al 2007
Czech 53 17.0 1.9 0 Rootsi et al 2004
Denmark 122 39.3 32.8 0 Underhill et al 2007
England 104 19.2 15.4 0 Underhill et al 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al 2004
Estonia 118 - 11.9 - Lappalainen et al 2008
Finland (west) 230 - 40 - Lappalainen et al 2008
Finland (east) 306 - 19 - Lappalainen et al 2008
France 58 17.2 8.6 1.7 Underhill et al 2007
France 12 16.7 16.7 0 Cann et al 2002
France (Low Normandy) 42 21.4 11.9 0 Rootsi et al 2004
Germany 125 24 15.2 0 Underhill et al 2007
Greece 171 15.8 2.3 0 Underhill et al 2007
Hungary 113 25.7 13.3 0 Rootsi et al 2004
Ireland 100 11 6 0 Underhill et al 2007
Latvia 113 - 3.5 - Lappalainen et al 2008
Lithuania 164 - 4.9 - Lappalainen et al 2008
Netherlands 93 20.4 14 0 Underhill et al 2007
Russians 16 25 12.5 0 Cann et al 2002
Russia: Pskov 130 16.9 5.4 0 Underhill et al 2007
Russia: Kostroma 53 26.4 11.3 0 Underhill et al 2007
Russia: Smolensk 103 12.6 1.9 0 Underhill et al 2007
Russia: Voronez 96 19.8 3.1 0 Underhill et al 2007
Russia: Arkhangelsk 145 15.8 7.6 0 Underhill et al 2007
Russia: Cossac 89 24.7 4.5 0 Underhill et al 2007
Russia: Karelians 140 10 8.6 0 Underhill et al 2007
Russia: Karelians 132 - 15.2 - Lappalainen et al 2008
Russia: Vepsa 39 5.1 2.6 0 Underhill et al 2007
Slovakia 70 14.3 4.3 0 Rootsi et al 2004
Slovenia 95 26.3 7.4 0 Underhill et al 2007
Sweden 160 - 35.6 - Lappalainen et al 2008
Swiss 144 7.6 5.6 0 Rootsi et al 2004
Turkey 523 5.4 1.1 0 Underhill et al 2007
Ukrainians: Lvov 101 23.8 4.9 0 Underhill et al 2007
Ukrainians: Ivanovo-Frankov 56 21.4 1.8 0 Underhill et al 2007
Ukrainians: Hmelnitz 176 26.2 6.1 0 Underhill et al 2007
Ukrainians: Cherkasso 114 28.1 4.3 0 Underhill et al 2007
Ukrainians: Belgorod 56 26.8 5.3 0 Underhill et al 2007

Publicly accessible databases[edit]

There are several public access databases where I-M253 populations can be found:

  1. 1. http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  2. 2. http://www.semargl.me/ru/dna/ydna
  3. 3. http://www.ysearch.org/
  4. 4. http://www.yhrd.org/


Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[10] The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[11] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Famous figures[edit]

Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[12]


DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[13]

Type: SNP
Source: M (Peter Underhill, Ph.D. of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Nucleotide alleles change (mutation): C to T

Name: M307[14]

Type: SNP
Source: M (Peter Underhill, Ph.D. of Stanford University)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
Nucleotide alleles change (mutation): G to A

Name: P30[15]

Type: SNP
Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40[16]

Type: SNP
Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
Nucleotide alleles change (mutation): C to T
Region: ARSDP


  1. ^ Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5). doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274. 
  2. ^ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). "Migration Waves to the Baltic Sea Region". Annals of Human Genetics 72 (3): 337–348. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. 
  3. ^ Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J.; Lahermo, P. (2009). "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. 
  4. ^ Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  5. ^ Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  6. ^ ISOGG tree for Y-DNA haplogroup I
  7. ^ Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; Lin, Alice A. et al.; Prince, Kristina; Oefner, Peter J.; Shen, Peidong; Semino, Ornella; Cavalli-Sforza, L. Luca; Underhill, Peter A. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  8. ^ P, Shen et al., Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation, Human Mutations, vol. 24, no. 3 (Sep 2004), pp.248-60.
  9. ^ ISOGG tree for Y-DNA haplogroup I
  10. ^ Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution 19 (7): 1008–1021. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121. 
  11. ^ Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H. et al.; Underhill, Peter A.; Bradshaw, Paul; Shaha, Alom; Thomas, Mark G.; Bradman, Neal; Goldstein, David B. (2003). "A Y Chromosome Census of the British Isles" (PDF). Current Biology 13 (11): 979–984. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. 
  12. ^ Founding Father DNA & Hamilton DNA Project Results Discussion
  13. ^ M253
  14. ^ M307
  15. ^ P30
  16. ^ P40

See also[edit]

Evolutionary tree of human Y-chromosome DNA (Y-DNA) haplogroups
MRC Y-ancestor
A00 A0'1'2'3'4
A0 A1'2'3'4
A1 A2'3'4
I J LT(K1) K (K2)
L T MPS (K2b) X (K2a)
  1. ^ van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809. 
Haplogroup I









