Haplogroup I (Y-DNA)

From Wikipedia, the free encyclopedia

Jump to: navigation, search
Haplogroup I

Time of origin 25,000-30,000 years BP
Place of origin Europe or Asia Minor
Ancestor IJ
Descendants I1, I2
Defining mutations M170, M258, P19, P38, P212, U179
Highest frequencies Bosnian Croats 73%, Croats 45-49%, Swedes 44%, Sardinians 42.3%, Bosniaks 42.0%, Norwegians 40.3%, Germany 38%[citation needed]

In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK.

Y-DNA Haplogroup I (the letter I, not the number 1) represents nearly one-fifth of the population of Europe. It can be found in most present-day European populations, with greatest density in Bosnia and Herzegovina, Croatia, Sweden, Norway, and Sardinia (Italy). The haplogroup is almost non-existent outside of Europe, suggesting that it arose in Europe. Estimates of the age of Haplogroup I suggest that it arose prior to the Last Glacial Maximum. It may have been confined to refugia around the Black Sea and in the Balkans during the last Ice Age, and then spread northward during the recolonization of northern Europe following the retreat of the glaciers.

Contents

[edit] Origins

European LGM refuges, 20 kya.
     Solutrean and Proto Solutrean Cultures     Epi Gravettian Culture

The TMRCA (time to most recent common ancestor) for the I clade, expressed in ky (confidence interval), is 22.2 (15.3-30.0)[1], placing the Haplogroup I founding event approximately contemporaneous with the onset of the last glacial maximum (LGM) approximately 21 thousand years ago. Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian culture[3].

Haplogroup I is closely related to Haplogroup J, which is today most common in Semitic and Northeast Caucasian peoples; both Haplogroup I and Haplogroup J have mutations in common making them descendants of Haplogroup IJ (S2, S22). The divergence of Haplogroup IJ into its descendant lineages, Haplogroups I and J, however, occurred many thousands of years prior to the first attestations of Semitic languages, peoples or cultures during the mid-third millennium B.C. Furthermore, the Semitic languages, and the larger Afro-Asiatic languages of which they form a part, are most strongly associated with the M35 lineage of haplogroup E originating far from the Levant in Africa.[2]

Note the TMRCA is an estimate of the time of subclade divergence. Rootsi et al. 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I, they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. With these estimates, they are consistent with Karafet et al. 2008. A recent outlier is Underhill et al. 2007, which calculates the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky. This will need to be explained further, since they further calculate the STR variation age of I1 at only 8.1±1.5 ky.

[edit] Distribution

Haplogroup I Distribution

Rootsi et al. 2004 suggest that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the ice age.

Haplogroup I Y-chromosomes have also been found among some populations of the Middle East, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among Germanic, Slavic, Uralic, and Turkic peoples, as well as among the Romance-speaking populations of France, Romania, Moldova, and Sardinia, the Albanian-speaking population of Albania, and the Greek-speaking population of Greece.It is also found among Iranian population of Tehran and Isfahan (with frequency of 34% and 10% respectively). [4]

Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of Italy and Switzerland from Germany and Sardinia, Iberia from southern France and Normandy, Greece, Albania and the Slavic peoples, and the Baltic Latvians from the Finnic Estonians. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).

[edit] Studies

Y-DNA haplogroup I has been researched in connection with HIV and AIDS progression. The research resulted in the finding that haplogroup I in general, and no specific subclade, had accelerated progression (in Y haplogroup I individuals) from HIV to AIDS. Suppression therapy also had a diminished effect on such individuals.[3]

[edit] Subgroups

The subclades of Haplogroup I with their defining mutations[4]:

  • I-M170 (M170, M258, P19, P38, P212, U179)
    • I1-M253 (M253, M307, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
      • I1a-M21 (M21)
      • I1b-M227 (M227) Appears to be limited to a marginally low frequency of approximately 1% among Slavic and Uralic peoples of Eastern Europe; also detected in a single Lebanese man
        • I1b1-M72 (M72)
      • I1c-P259 (P259/M507)
      • I1d-L22 (L22/S142)
        • I1d1-P109 (P109)
      • I1e-S79 (S79)
    • I2-M438 (M438/P215/S31, L68)
      • I2a-P37.2 (P37.2)
        • I2a2-M423 (M423)Typical of the Slavic speaking populations of the Balkans, especially the populations of Bosnia and Herzegovina and Croatia; also found with high frequency in Moldavia and Romania and high haplotype diversity values, but lower overall frequency, among the West Slavic populations of Slovakia and the Czech Republic
          • I2a2a-P41.2 (P41.2/M359.2)
        • I2a1-M26 (M26)Typical of the population of the so-called "archaic zone" of Sardinia; also found at low frequencies among populations of Southwest Europe, particularly in Castile, Béarn, and the Basque Country
          • I2a1a-M161 (M161)
      • I2b-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32)
        • I2b1-M223 (M223, P219/S24, P220/S119, P221/S120, P222/U250/S118, P223/S117) Occurs at a moderate frequency among populations of Northwest Europe, with a peak frequency in the region of Lower Saxony in central Germany; minor offshoots appear in Moldavia and Russia (especially around Vladimir, Ryazan, Nizhny Novgorod, and the Republic of Mordovia)
          • I2b1a-M284 (M284) Generally limited to a low frequency in Great Britain
            • I2b1a1-L126 (L126/S165, L137/S166)
          • I2b1b-M379 (M379)
          • I2b1c-P78 (P78)
          • I2b1d-P95 (P95)
        • I2b2-L38 (L38/S154, L39/S155, L40/S156, L65/S159)

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..

[edit] I-M170

The composite subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), and the Saami (1/35).[5]

[edit] I-M253

Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.

[edit] I-M438

Distribution of HG I2a2 (M423) by region.

[edit] I-M423

Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50-60%) and Bosnia-Herzegovina (up to 75%),especially in the Croat population of Bosnia and Herzegovina [5] A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in Fennoscandia, Western and Southwestern Europe.

[edit] I-M26

Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises more than 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them. It is found outside of Sardinia only at low frequencies in Southwest Europe.

Haplogroup I-M26 is practically absent east of France and Italy, while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[6]

[edit] I-M436

The distribution of Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia.

Haplogroup I-M436 also occurs among approximately 1% of Sardinians.

[edit] Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

[edit] Testing Strategy

For Haplogroup I, STR testing, with at least 25 and preferably 40 or more alleles tested, will allow accurate inference of all currently known Haplogroup I subclade single nucleotide polymorphisms (SNP). It will also provide necessary resolution to help with identifying close relatives in family history time frames. Once the STR testing results are available, one should ensure they are posted in a public database for genealogy search as well as research purposes. Then, if the lab indicates you are Haplogroup I, compare the returned STR values to an existing table of compiled Haplogroup I haplotypes to determine your specific haplotype (go to [6] and under Additional Resources, select the link to Modal Haplotypes for Y-Haplogroup I Varieties, then download FounderHaps.xls). Note that FTDNA values for your STR alleles should be used when comparing to this table. Note also that the previous version of subclade names are used. At this stage of Haplogroup I research, there is more resolution of sub-groups available through matching STR alleles with the listed haplotypes than is available via testing for known subclade SNPs. This has been the situation for a few years now, but hopefully may change when more people undergo SNP testing for some of the newer SNPs that are being discovered.

[edit] References

[edit] External links

[edit] Phylogenetic tree and distribution maps

[edit] Mailing Lists

[edit] Projects

[edit] Other


Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L M NOP S T
|
NO P
| |
N O Q R
Personal tools