Haplogroup R1b (Y-DNA)
From Wikipedia, the free encyclopedia
| Haplogroup R1b | |
| Time of origin | less than 18,500 years BP[1] |
| Place of origin | Eurasia |
| Ancestor | R1 |
| Defining mutations | M343 |
| Highest frequencies | People of Atlantic Europe (Basque 92%, Irish 90%, Welsh 86%, Northern Portuguese 81%, Spanish 78%, Scottish 77%, English 75%, , Belgians 70%, Dutch 65%, Southern Portuguese 60%, Italian 55%, Bashkirs 48%, German 45%, etc.) |
|---|---|
In human genetics, Haplogroup R1b is the most frequently occurring Y-chromosome haplogroup in Western Europe.
More specifically, its frequency is highest in Atlantic Europe and, due to European emigration, in North America, South America, and Australia. In southern England, the frequency of R1b is about 70%, and in parts of north and western England, northern Spain, Portugal, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%. R1b is the most frequent haplogroup in Germany and it is also found among Italians, somewhat higher in northern Italy.
R1b is also present at lower frequencies throughout Eastern Europe, Anatolia and parts of North Africa and appears in an isolated pocket of Sub-Saharan Africa.
Haplogroup R1b is defined by the presence of single-nucleotide polymorphism (SNP) M343, which was discovered in 2004.[2] From 2002 to 2005, R1b was defined by the presence of SNP P25. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[3]
Contents |
[edit] Origins
In 2008 T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP.[4]
R1b* (that is R1b with no subsequent mutations) is extremely rare. Examples have been found in Europe and Western Asia, for example two in a sample from Turkey.[5] However it is possible that some or all examples represent a reversion of marker P25 from R1b1*.[6] Most examples of R1b fall into its much more recent subclades.
It is widely believed that R1b originated in western Europe where it reaches its highest frequencies. However research was thought to show that R1b's variance increases as one moves east, leading to the view that R1b originated further east.[7] Some geneticists now believe that R1b arose in Central Asia[8] or Southwest Asia.[9]
Similarly, within the clade, R1b1b2 (R-M269) by far the most common subclade of R1b in Western Europe, has been said to reach its highest diversity in Iberia and Anatolia, even though its highest frequencies are certainly in Western Europe [10]
On-going analysis of newly discovered clades within both R-M343 and R-M269 should significantly improve our understanding of the geographical paths followed by these lineages ancestrally.
[edit] Subclades
R1b is a descendant of Haplogroup R1. Systematic descent-based names of the subclades have been changing rapidly with the discovery of new SNPs clarifying and augmenting the descent tree. The identifiers below are those from the November 2008 revision of the ISOGG tree. In light of recent discoveries, the chart needs to be updated, since R-L44 (R1b1b2a1a4) should be R-L48, which in turn includes R-L47 (with its R-L44, R-L45, R-L46 branches).
| M343 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
[edit] R1b1
R1b1 is defined by the presence of SNP marker P25.
R1b1* is found in Northern Cameroon in west central Africa at a very high frequency, where it is considered to represent an early back-migration from Asia.[11] R1* (which seems likely also to be R1b1, though not tested for M343 and P25) was also reported in the Bantu of southern Cameroon, and in Oman, Egypt, and the Hutu of Rwanda. Again the authors of the study felt that their data suggested an ancient back migration from Asia to Africa.[12] Another example of R1b1* was discovered in Guinea-Bissau.[13] Further examples have been found among speakers of a variety of different languages in Sudan.[14]
[edit] R1b1a
R1b1a is defined by the presence of SNP marker M18. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[15] It has been found only at low frequencies in samples from Sardinia[16] and Lebanon.[17]
[edit] R1b1b
R1b1b is defined by the presence of SNP marker P297. In 2008 this polymorphism was recognised to combine M73 and M269 into one R1b1b cluster.[18]
[edit] R1b1b1
R1b1b1 is defined by the presence of SNP marker M73. It has been found in SE Europe and SW Asia[19] and at generally low frequencies throughout central Eurasia.
[edit] R1b1b2
| Long-hand: | R1b1b2 (formerly R1b1c[citation needed], R1b3) |
| Defining SNP: | M269 |
| Parent Clade: | R-P297 |
| Subclades: | R-P311 |
This subclade is defined by the presence of the M269 marker. It is the subclade most closely corresponding to Haplotype 15. From 2003 to 2005 what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c.[citation needed].
This subgroup, may have existed before the last Ice Age [20], but can be seen as much younger. Another estimate for R1b1b2 arising is around 5,000 to 8,000 years ago.[21]
[edit] R1b1b2a1a1
| Long-hand: | R1b1b2a1a/R1b1b2g/R1b1c9 |
| Defining SNP: | U106/S21/M405 |
| Parent Clade: | P310/S129 |
| Subclades: | U198/S29/M405, S26/L1/DYS439(null), L48/S162 (comprising L44, L45, L46, L47), L5, L6, P89.2, P107 |
This subclade is defined by the presence of the marker U106, also known as S21 and M405. It appears to represent over 25% of R1b.
In Europe, the subclade (including its own subclades) has a distribution running north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in, Italy (3.5%), and Turkey (0.4%).[22] The frequency of this subclade remains unknown in certain parts of Europe such as Iberia and the Balkans.
The age of U106 is around 3,100-3,900 years old.
The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al. (2007) [6].
Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.
Downstream of U106 are U198/S29/M467, P107, P89.2, L1/S26/DYS439(null), L5, L6, L48/S162 (with L47 and its L44, L45, L46 subgroups).
[edit] R1b1b2a1a1a
This subclade is defined by the presence of the marker U198, also known as S29 and M467. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[22] The age of U198 is around 2-3,000 years.
[edit] R1b1b2a1a1c
This subclade is defined by the presence of the marker L1/S26/DYS439(null). It occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry, is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or null439.[23].
[edit] R1b1b2a1a1d
This subclade is defined by the presence of the marker L48/S162 and is also known as R1b1b2a1a4 (by Family Tree DNA - FTDNA). It is the largest subclade of R1b1b2a1a1. As of May 15, 2009, based on FTDNA tests of samples from 256 people, L48 was detected in 146, or 57.0% of those tested. From among those with L48+ results, 90% have DYS390 of 23 or less, while 10% a value of 24 or more. Among those tested L48-, 16% have DYS390 of 23 or less, while 84% a value of 24 or more. Therefore, there seems to be a correlation between values of 23 or lower for DYS390 and L48+, among those tested U106+.[24] The age of L48 is around 2,900-3,100 years old.
R1b1b2a1a1d has a subclade R1b1b2a1a1d1 (defined by the marker L47), which in turn, seems to be including subclades R1b1b2a1a1d1* (defined by the marker L47 and not by markers L44, L45, L46) and R1b1b2a1a1d1a defined by the marker L44. As of July 8, 2009, based on FTDNA tests of samples from 60 members of the R1b-U106 project who are U106+, 15 (or 25%) were found L47+, so far showing a possible "Anglo-Saxon" (or Anglo-Norman, Scottish-Norman, "Ashkenazim-Norman"[25]) cluster, strictly based on the surnames and ancestral origins (England, Scotland, Wales and Belarus Ashkenazim) of those tested positive. As well, due to the genetic distances among the members so far L47+, the age of this cluster is probably quite old, perhaps 2,700-2,900 years. It is possible that L47 emerged not too long after the L48 "parent" cluster. Preliminary data would strongly suggest that the L48 SNP occurred only a short period of time after the U106 SNP occurred, likely 200 years or less. With limited data for L46+ haplotypes at this point, it would appear that the L47 SNP occurred only a short period of time after the L48 SNP occurred, likely 200 years or less. However, more results and proper statistical analysis will be required. So far, these are only observations based on a few initial results. For the R1b1b2a1a1d1a defined by marker L44, as of May 15, 2009, based on FTDNA tests of samples from the R1b-U106 project, there were 37 test results for L44, with 6 positive (16.2%) and 31 negative. Downstream of L44, L46 has 37 test results, with 6 positive (16.2%) and 31 negative. As well, it is possible that L45 could be downstream of L44 and upstream of 46, but FTDNA has not started testing L45 yet. The age of L46 could be around 1,500 years before present (YBP).
[edit] R1b1b2a1a2
| Long-hand: | R1b1b2a1a2 |
| Defining SNP: | P312 (also called S116, rs34276300) |
| Parent Clade: | R-P310 |
| Subclades: | R-M153, R-M167, R-U152, R-L21 |
The P312 SNP appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of this SNP relative to the above list.
[edit] R1b1b2a1a2b
This subclade is defined by the presence of the marker R-M153. It has been found mostly in Basques and Gascons, among whom it represents a sizeable fraction of the Y-DNA pool[26][27][28], though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001[29]) it was described as H102 and included 7 Basques and one Andalusian.
[edit] R1b1b2a1a2c
This subclade is defined by the presence of the marker R-M167/SRY2627. The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[30]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.
In 2000 Rosser[31] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.
In 2001 Bosch described this marker as H103, in 5 Basques and 5 Catalans.[32] Further regional studies have located it in significant amounts in Asturias, Cantabria and Galicia, as well as again among Basques.[33] Cases in the Azores and Latin America have also been reported. In 2008 two research papers by López-Parra[28] and Adams,[27] respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men.
[edit] R1b1b2a1a2d
This subclade is defined by the presence of the marker R-U152 also called S28. Its discovery was announced in 2005 by EthnoAncestry and subsequently identified independently by Sims et al. (2007).[34] Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. It is found from Greece westward to the Bay of Biscay in France, but the percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152.
[edit] R1b1b2a1a2e
This subclade is defined by the presence of the marker S68 which was reported by in 2007. It has been seen in an individual from Scotland and another from Sweden. This subclade is unlikely to be found in much more than 2% of the R1b population[35]
[edit] R1b1b2a1a2f
This subclade is defined by the presence of the marker L21. Early results suggest that it is common in the British Isles, appears in France, Germany and Scandinavia, but is rare in Iberian or Italian ancestry.
[edit] R1b1b2a1a2f2
This subclade is defined by the presence of the marker M222. It is particularly associated with the Irish and Scots. In this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as it is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.[36]
[edit] R1b1c
R1b1c is defined by the presence of SNP marker M335. This haplogroup was created by the 2008 reorganisation of nomenclature and should not be confused with R1b1b2, which was previously R1b1c. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[37]
The M335 marker was first published in 2004, when one example was discovered in Turkey, which was classified at that time as R1b4.[38].
[edit] Distribution
R1b reaches its highest frequency in Atlantic Europe. Results from studies with small sample sizes should be treated with caution until more thorough testing is completed.
[edit] Europe
- In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Portugal, Spain, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%.
- It is found in Basques: 92%,[39] Catalans: 80%,[39], other Spanish: 78%,[40], Portuguese: 70%,[41] Belgians 63%,[42], Italians (continental Italy): 55%,[43] Germans: 45%,[44] Norwegians: 25.9%,[45] Sicilians: 24.5%,[46] Maltese: 21.9%,[47] Swedes: 20%,[45] Sardinians: 19%.[48]
- In North-eastern Europe, it is found in Czechs & Slovaks: 35.6%,[39] Poles: 20%[49]-16.4%,[39] Latvians: 15%,[50] Hungarians: 13.3%, Russians: 10%,[50] Estonians: 9%,[50] Lithuanians: 5%,[50] Belarusians: 4.2%, Ukrainians: 2.0%[39]-18.9%,[51] Sami: 3.9%.[52]
- In the Balkans, it is found in Greeks: 13.5%[53]-22.8%,[39] Albanians: 17.6%,[39] Romanians: 13%,[51] Slovenes: 21%,[50] Bulgarians: 17.0%,[41] 16.3% in Turkey,[54] Croats (mainland): 15.7%,[55] Serbs: 10.6%,[55] Herzegovinians: 3.6%,9.0% in Cypriots[41], [55] Bosnians: 1.4%.[55]
- Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b2 in Bashkirs, although the genetic diversity is low, suggesting a founder effect.[56]
[edit] Caucasus
In the Caucasus, it is found in 32.4%[57] to 36% (17/47 R1-M173(xR1a1a-M17))[58] of Armenians.
[edit] North Africa
- In northeast Africa, the frequency of R1b reaches 40% in the Hausa Sudanese[59], 10% in all of the Sudan[60] & 4.1% in Egyptians[61].
- In northwest Africa, the frequency of R1b is 10.8% in Algerian Arabs from Oran[62], 7% in Tunisian Arabs[63], 5.8% in Algerian Berbers[64] and about 2.5% in Morocco[65].
[edit] Asia
- In Southwest Asia, the frequency of R1b reaches 11.3% in Iraq[66], 11.2% in Kurds[67], 9.9% Syrians[68], 8.4% Palestinians[69], 7.9% in Jordan[70], 5.7% in Lebanon[71] and 4.3% in the UAE[72].
- Other Central Asian results: Turkmens 36.7% R1-M173(xR1a1a-M17) in a sample of 30 individuals,[58] Uzbeks: 9.8% R1-M173(xR1a1a-M17),[58] Tatars: 8.7% [73], Kazakhs: 5.6% R1-M173(xR1a1a-M17)[58], Uyghurs 8.2% P-M45(xR1a1a-M17)[74]-19.4% P-92R7(xR1a-SRY10831.2)[75]
- In South Asia, the frequency of R1b is about 7.4% in Pakistan (including 4.5% R1b1b1-M73 and 2.8% R1b1b2-M269), while it is almost not found in India (0.55% R1b1b2-M269)[76]. Haplogroup R1b1b2-M269 has been found in approximately 11% of a sample of Newars in Nepal.[77]
- In Lebanese Christians R1b can reach upto 25-50%, but sharply drops when considering the whole population of Lebanon because Lebanese Muslims usually have a high number of haplogroup J.
[edit] Haplotypes
[edit] Atlantic Modal Haplotype
A common haplotype within R1b is sometimes called the Atlantic Modal Haplotype, or haplotype 15. It reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 33% in Portugal as a whole and more than 90% in NW Portugal, while the highest value is to be found among Spanish Basques. It was discovered prior to many of the SNPs now used to identify subclades of R1b and references to it can be found in some of the older literature. It corresponds most closely with subclade R1b1b2a1a [L11].
- R1b Modal Haplotype. Ysearch 55GU9
- R1b Modal Ysearch C7BED
- R1b (NW Irish) Modal Ysearch M5UKQ
- Comparison
[edit] Haplotype 35
There also exists a haplotype associated with R1b1b2 characterized by DYS393=12 which is known in the literature as Haplotype 35 (ht35), or the Armenian Modal Haplotype.
[edit] Mutation
The technical details of M343 (rs9786184) are:
- Nucleotide change: C to A
- Position (base pair): 402
- Total size (base pairs): 424
- Forward 5'? 3': tttaacctcctccagctctgca
- Reverse 5'? 3': acccccacatatctccagg
This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.
[edit] Popular culture
Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.
[edit] See also
- Human Y-chromosome DNA haplogroup
- Atlantic Modal Haplotype
- Genealogical DNA test
- Prehistoric Europe
- Y-DNA haplogroups by ethnic groups
|
Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes) |
|||||||||||||||||||||||||||||||
| most recent common Y-ancestor | |||||||||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| A | BT | ||||||||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| B | CT | ||||||||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| CF | DE | ||||||||||||||||||||||||||||||
| | | | | ||||||||||||||||||||||||||||||
| C | F | D | E | ||||||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| G | H | IJK | |||||||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| IJ | K | ||||||||||||||||||||||||||||||
| | | | | ||||||||||||||||||||||||||||||
| I | J | L | M | NOP | S | T | |||||||||||||||||||||||||
| | | |||||||||||||||||||||||||||||||
| NO | P | ||||||||||||||||||||||||||||||
| | | | | ||||||||||||||||||||||||||||||
| N | O | Q | R | ||||||||||||||||||||||||||||
| R |
|
||||||||||||
[edit] References
- ^ Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree
- ^ Cinnioglu, Cengiz; et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127–148. doi:.
- ^ Y Chromosome Consortium (2002-01-18). "YCC NRY Tree 2002". http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html. Retrieved on 2007-12-13.
- ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
- ^ Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4.
- ^ S.M. Adams et al., The case of the unreliable SNP: recurrent back-mutation of Y-chromosomal marker P25 through gene conversion, Forensic Science Int vol. 159, no, 1 (2006 May 25), pp. 14-20.
- ^ B. Arredi, E. S. Poloni and C. Tyler-Smith, The peopling of Europe, in M. Crawford (ed.), Anthropological Genetics: Theory, methods and applications (2007), p. 394.
- ^ "Variations of R1b Ydna in Europe: Distribution and Origins". http://www.worldfamilies.net/Tools/r1b_ydna_in_europe.
- ^ International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009
- ^ url="http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf"]
- ^ Fulvio Cruciani et al., A Back Migration from Asia to Sub-Saharan Africa is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes, Am. J. Hum. Genet, 70:1197–1214, 2002, pp. 13-14. Note that it was reported here as R1*-M173 but the following study makes the subclade clear; [http://hammerlab.biosci.arizona.edu/publications/Wood_2005_EUR.pdf Elizabeth T. Wood et al., Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes, European Journal of Human Genetics (2005) 13, pp. 867–876.
- ^ [1] The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations - J. R. Luis et al., Am. J. Hum. Genet. 74:000–000, 2004.
- ^ A. Rosa et al., Y-chromosomal diversity in the population of Guinea-Bissau: a multiethnic perspective, BMC Evolutionary Biology 2007, 7:124 doi:10.1186/1471-2148-7-124
- ^ Hisham Y. Hassan et al., Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History, American Journal of Physical Anthropology, vol. 137 (2008), no. 3, pp. 316-323.
- ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
- ^ D. Contu et al., Y-Chromosome Based Evidence for Pre-Neolithic Origin of the Genetically Homogeneous but Diverse Sardinian Population: Inference for Association Scans, PLoS ONE, Issue 1 (January 2008), pp.1-8.
- ^ Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
- ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
- ^ [2] Dennis Wright - The Irish Type III Website
- ^ Ornella Semino et al., The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective, Science', vol. 290 (2000), no. 5494, pp. 1155 - 1159.
- ^ Arredi, Poloni and Tyler-Smith (2007). "The Peopling of Europe". Michael Crawford, Anthropological Genetics, pp. 380-408. http://books.google.ca/books?id=tlSspaBLkhoC&pg=PA380&lpg=PA394#PPA394,M1.
- ^ a b [3] Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405, The Croatian Medical Journal, Vol. 48, No. 4. (August 2007), pp. 450-459
- ^ Family Tree DNA: Null 439
- ^ results
- ^ See the "Ivanhoe" clan migration map
- ^ McEwan's Genealogy Page: "R1b1c4 aka M153"
- ^ a b Susan M. Adams et al., The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula. AJHG, 2008
- ^ a b A.M. López-parra et al., In search of the Pre- and Post-Neolithic Genetic Substrates in Iberia: Evidence from Y-Chromosome in Pyrenean Populations. Annals of Human Genetics 2008
- ^ Bosch et al., High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
- ^ M.E. Hurles et al., Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism, 1999
- ^ Z.H. Rosser et al., Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language, 2000
- ^ Bosch et al. High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
- ^ McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"
- ^ McEwan Genealogy Page S28
- ^ EthnoAncestry
- ^ New York Times: Percentage of men in Ireland who are believed to descend from King Niall of the Nine hostages
- ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
- ^ Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4.
- ^ a b c d e f g Ornella Semino, A. Silvana Santachiara-Benerecetti, Francesco Falaschi, L. Luca Cavalli-Sforza and Peter A. Underhill, "Ethiopians and Khoisan Share the Deepest Clades of the Human Y-Chromosome Phylogeny," The American Journal of Human Genetics, Volume 70, Issue 1, 265-268, 1 January 2002.
- ^ 582/1002, The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula, Adams et al. 2008
- ^ a b c Rosser et al. (2000)
- ^ 395/657, Micro-Phylogeographic and Demographic of Portuguese Male Lineages, Beleza et al. 2005
- ^ 280/699, Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter, Capelli et al. 2007
- ^ 473/1215, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
- ^ a b [4] Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland - Agnar Helgason et al., 2000, Am. J. Hum. Genet. 67:697–717, 2000
- ^ 57/232, Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome, Gaetano et al. 2008
- ^ American Journal of Human Genetics doi: :10.1016/j.ajhg.2008.10.012, Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean, Pierre A. Zalloua et al.
- ^ 174/930, Y-Chromosome Based Evidence for Pre-Neolithic Origin of the Genetically Homogeneous but Diverse Sardinian Population: Inference for Association Scans, Contu et al. 2008
- ^ 106/913, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
- ^ a b c d e Oxford Journals [5]
- ^ a b Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
- ^ Tambets et al. (2004).
- ^ R. J. King, S. S. Özcan, T. Carter, E. Kalfoğlu, S. Atasoy, C. Triantaphyllidis, A. Kouvatsi, A. A. Lin, C-E. T. Chow, L. A. Zhivotovsky, M. Michalodimitrakis, P. A. Underhill (2008), "Differential Y-chromosome Anatolian Influences on the Greek and Cretan Neolithic," Annals of Human Genetics 72 (2), 205–214 doi:10.1111/j.1469-1809.2007.00414.x
- ^ 76/523, Y-Chromosome Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al. 2004
- ^ a b c d Pericic, M; Lauc LB, Klaric IM, Rootsi S, Janicijevic B, Rudan I, Terzic R, Colak I, Kvesic A, Popovic D, Sijacki A, Behluli I, Dordevic D, Efremovska L, Bajec DD, Stefanovic BD, Villems R, Rudan P (2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:. PMID 15944443. http://mbe.oxfordjournals.org/cgi/content/full/22/10/1964. Haplogroup frequency data in table 1
- ^ A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005
- ^ 238/734, Weale et al. (2004)
- ^ a b c d R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
- ^ 13/32, Y-Chromosome Variation Among Sudanese:Restricted Gene Flow, Concordance With Language, Geography, and History, Hassan et al. 2008
- ^ 43/445, Hassan et al. 2008
- ^ 6/147, Luis et al. 2001
- ^ 11/102, Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample
- ^ 10/139 Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula , Adams et al. 2008
- ^ 3/54 Arredi et al. 2004
- ^ Combined Adams et al. 2008; Bosch et al. 2001 and Maria Brotilini et al. 2004
- ^ 16/139, Zaheri et al. 2003,Y-chromosome and mtDNA polymorphisms in Iraq
- ^ Wells et al. (2001), Nebel et al. (2001), Nasidze et al. (2005), Cruciani et al. (2004)
- ^ Semino et al. (2000), Hammer et al. (2000), Di Giacomo et al. (2004), Cruciani et al. 2004
- ^ Nebel et al. (2001),Cruciani et al. (2004), Hammer et al. (2000)
- ^ Flores et al. (2005) Isolates in a corridor of migrations: a high-resolution analysis. of Y- chromosome variation in Jordan
- ^ Wells et al. (2001), Semino et al. (2000), Hammer et al. (2000), Semino et al. (2004), Zalloua et al. (2008) 47/935, Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events, Zalloua et al. 2008
- ^ 7/164, Cadenas et al. 2008
- ^ Tambets et al. (2004)
- ^ Ruixia Zhou, Daqun Yang, Hua Zhang, Weiping Yu, Lizhe An, Xilong Wang, Hong Li, Jiujin Xu, and Xiaodong Xie, "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape," Annals of Human Biology (2008), 35:2, 198 — 211.
- ^ Yali Xue, Tatiana Zerjal, Weidong Bao, Suling Zhu, Qunfang Shu, Jiujin Xu, Ruofu Du, Songbin ***, Pu Li, Matthew E. Hurles, Huanming Yang, Chris Tyler-Smith, "Male demography in East Asia: a north-south contrast in human population expansion times," Genetics 2006.
- ^ 8/176 R-M73 and 5/176 R-M269 for a total of 13/176 R1b in Pakistan and 4/728 R-M269 in India; Sanghamitra Sengupta et al., "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists", American Journal of Human Genetics, Volume 78, Issue 2, February 2006, Pages 202-221, doi:10.1086/499411.
- ^ Tenzin Gayden et al., "The Himalayas as a Directional Barrier to Gene Flow," American Journal of Human Genetics, Volume 80, Issue 5, 884-894, 1 May 2007.
[edit] Bibliography
- Luigi Luca Cavalli-Sforza (1994). The History and Geography of Human Genes. Princeton University Press. ISBN 0-691-08750-4
- Michel Morvan (1996) The linguistic origins of basque (in french), Bordeaux University Press. ISBN 2-86781-182-1
- Semino et al. (2000), The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans, Science, Vol 290
- Wells et al. (2001), The Eurasian Heartland: A continental perspective on Y-chromosome diversity, PNAS, Vol 98
[edit] External links
- International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009
- EthnoAncestry R1b info/ Map of S21 and S29 frequencies as determined by EthnoAncestry's research arm
- Spread of R1b, from the Genographic Project, National Geographic
- R1b1b2 Subclade Maps: M167, M222, S21, S28
- World Haplogroup Maps Note especially the dominance of R1b in Western Europe.
- Danish Demes Regional DNA Project: Haplogroup R1b
- null439 project
- General SNP Marker Page DNA Heritage
- John McEwan's Y Chromosome DNA Genealogy Page
- David Faux - Shetland Isles Haplogroup R1b
- Dennis Wright - Irish Type III Homepage
[edit] Maps
[edit] Projects
- R1* Haplogroup Project
- FTDNA Kerchner's R1b and Subclades YDNA Haplogroup Project
- R1b1b1 Haplogroup Project
- R1b1b2* Haplogroup Project
- R1b-U106/S21+ aka R1b1b2a1a Haplogroup Project
- R1b1b2a1b4 aka R1b(U152+) Project
- R1b1b2a1b5 aka R1b1b2a1a2f aka L21+ Project
- R1b-U198/S29+ Project
- R-M222 Haplogroup Project
- R1b1* DNA Project
- FTDNA The Jewish R1b Project
- British Isles DNA Project

