Haplogroup R1b (Y-DNA)

From Wikipedia, the free encyclopedia

  (Redirected from R1b)
Jump to: navigation, search
Haplogroup R1b

Haplogroup R1b (Y-DNA).jpg

Time of origin less than 18,500 years BP[1]
Place of origin Western Asia [2] or Central Asia.[3]
Ancestor R1
Descendants R1b1
Defining mutations M343
Highest frequencies People of Atlantic Europe : Irish 93%, Basques 92%, Welsh 86%, Northern Portuguese 80%, Scottish 77%, English 75%, Belgians 70%, Spanish 65%, Dutch 65%, Southern Portuguese 60%, Bashkirs 55%, German 45%, Hausa 40%, Czechs and Slovaks 36%, Armenians 36%, Italian 36%, Turkmens 35%,Chad 20-35% and Hazara 32%), Chadic speakers.
Haplogroup R1b Distribution

In human genetics, Haplogroup R1b is the most frequently occurring Y-chromosome haplogroup in Western Europe.

More specifically, R1b's frequency is highest in the populations of Atlantic Europe and, due to European emigration, in North America, South America, and Australia. In Ireland and the Basque Country its frequency exceeds 90% and approaches 100% in Western Ireland.[4] The incidence of R1b is 70% or more in parts of northern and western England, northern Spain, northern Portugal, western France, Wales, Scotland. R1b's incidence declines gradually with distance from these areas but it is still common across the central areas of Europe. R1b is the most frequent haplogroup in Germany, and is common in southern Scandinavia and in Italy.

R1b is also present at lower frequencies throughout Eastern Europe, Western Asia, and parts of North Africa and appears in an isolated pocket of Sub-Saharan Africa.

Haplogroup R1b is defined by the presence of single-nucleotide polymorphism (SNP) M343, which was discovered in 2004.[5] From 2002 to 2005, R1b was defined by the presence of SNP P25. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[6]

Contents

[edit] Origins

In 2008 T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP.[1]

R1b* (that is R1b with no subsequent mutations) is extremely rare. Examples have been found in Europe and Western Asia, for example two in a sample from Turkey.[7] However it is possible that some or all examples represent a reversion of marker P25 from R1b1*.[8] Most examples of R1b fall into its much more recent subclades.

It was initially believed that R1b originated in western Europe where (considered as a whole, including subclades) it reaches its highest frequencies. However R1b's variance increases as one moves east, leading to the view that R1b originated further east, and (M269) expanded into Europe in the Neolithic not Paleolithic.[9] Many geneticists now believe that R1b arose in Central Asia[3] or Western Asia.[2]

[edit] Subclades

R1b is a descendant of Haplogroup R1. Systematic descent-based names of the subclades have been changing rapidly with the discovery of new SNPs clarifying and augmenting the descent tree. The identifiers below are those from the 2009 revision of the ISOGG tree.


M343
P25

R-M18 (R1b1a)


P297

R-M73 (R1b1b1)


M269
L23
L51
P310
U106

R-U198 (R1b1b2a1a1a)



R-S26 (R1b1b2a1a1c)


L48
L47

R-L44 (R1b1b2a1a1d1a)



R-L47* (R1b1b2a1a1d1*)




R-L48* (R1b1b2a1a1d*)




R-U106* (R1b1b2a1a1*)



P312

R-M153 (R1b1b2a1a2b)



R-M167 (R1b1b2a1a2c)


U152
L2

R-L20 (R1b1b2a1a2d3a)



R-L2* (R1b1b2a1a2d3*)




R-U152* (R1b1b2a1a2d*)




R-S68 (R1b1b2a1a2e)


L21

R-M222 (R1b1b2a1a2f2)



R-L21* (R1b1b2a1a2f*)




R-P312* (R1b1b2a1a2*)




R-P310* (R1b1b2a1a*)




R-L51* (R1b1b2a1*)




R-L23* (R1b1b2a*)




R-M269* (R1b1b2*)




R-P297* (R1b1b*)




R-P25* (R1b1*)




R-M343* (R1b*)




[edit] R1b1

R1b1 is defined by the presence of SNP marker P25.

R1b1* is found in Northern Cameroon in west central Africa at a very high frequency, where it is considered to represent an early back-migration from Asia.[10] R1b1 reaches a maximum frequency of more than 90% among the Kirdi.[11] R1* (which seems likely also to be R1b1, though not tested for M343 and P25) was also reported in the Bantu of southern Cameroon, and in Oman, Egypt, and the Hutu of Rwanda. Again the authors of the study felt that their data suggested an ancient back migration from Asia to Africa.[12] Another example of R1b1* was discovered in Guinea-Bissau.[13] Further examples have been found among speakers of a variety of different languages in Sudan.[14]

[edit] R1b1a

R1b1a is defined by the presence of SNP marker M18. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[1] It has been found only at low frequencies in samples from Sardinia[15] and Lebanon.[16]

[edit] R1b1b

R1b1b is defined by the presence of SNP marker P297. In 2008 this polymorphism was recognised to combine M73 and M269 into one R1b1b cluster.[1]

[edit] R1b1b1

R1b1b1 is defined by the presence of SNP marker M73. It has been found in SE Europe and SW Asia[17] and at generally low frequencies throughout central Eurasia. Haplogroup R1b1b1 Y-DNA has been found with especially high frequency among Hazaras in Pakistan (8/25 = 32% R1b1b1-M73[18]) and among Bashkirs in southern Russia (62/471 = 13.2% R1b1b1-M73 [0/52 = 0.0% Sterlibashevskiy - 44/80 = 55.0% Abzelilovskiy]), with the highest frequency being found among the Bashkirs of the Abzelilovo region.

[edit] R1b1b2

R-M269
Long-hand: R1b1b2 (formerly R1b1c, R1b3)
Defining SNP: M269
Parent Clade: R-P297
Subclades: R-P311

This subclade is defined by the presence of the M269 marker. It is the subclade most closely corresponding to Haplotype 15. From 2003 to 2005 what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c.

This subgroup, may have existed before the last Ice Age,[19] but can be seen as much younger. A much newer estimate for R1b1b2 arising is around 5,000 to 8,000 years ago.[20]

[edit] R1b1b2a1a1

This subclade is defined by the presence of the marker U106, also known as S21 and M405. It appears to represent over 25% of R1b.

In Europe, the subclade (including its own subclades) has a distribution running north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in, Italy (3.5%), and Turkey (0.4%).[21] The frequency of this subclade remains unknown in certain parts of Europe such as Iberia and the Balkans.

R-U106
Long-hand: R1b1b2a1a/R1b1b2g/R1b1c9
Defining SNP: U106/S21/M405
Parent Clade: P310/S129
Subclades: U198/S29/M405, S26/L1/DYS439(null), L48/S162 (comprising L44, L45, L46, L47), L5, L6, P89.2, P107

The age of U106 is around 3,100-3,900 years old.

The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106").[22]

Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.

Downstream of U106 are U198/S29/M467, P107, P89.2, L1/S26/DYS439(null), L5, L6, L48/S162 (with L47, which contains L44 - further subdivided in the L45, L46 and L164 subgroups; L148; L179; and L188), L127.2 and L199.

[edit] R1b1b2a1a1a

This subclade is defined by the presence of the marker U198, also known as S29 and M467. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[21] The age of U198 is around 2-3,000 years.

[edit] R1b1b2a1a1c

This subclade is defined by the presence of the marker L1/S26/DYS439(null). It occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry,[23] is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or null439.[24]

[edit] R1b1b2a1a1d

This subclade is defined by the presence of the marker L48/S162 and is also known as R1b1b2a1a4 (by Family Tree DNA - FTDNA). It is the largest subclade of R1b1b2a1a1. As of May 15, 2009, based on FTDNA tests of samples from 256 people, L48 was detected in 146, or 57.0% of those tested. From among those with L48+ results, 90% have DYS390 of 23 or less, while 10% a value of 24 or more. Among those tested L48-, 16% have DYS390 of 23 or less, while 84% a value of 24 or more. Therefore, there seems to be a correlation between values of 23 or lower for DYS390 and L48+, among those tested U106+.[25] The age of L48 is around 2,900-3,100 years old.

R1b1b2a1a1d has a subclade R1b1b2a1a1d1 (defined by the marker L47), which in turn, seems to be including subclades R1b1b2a1a1d1* and R1b1b2a1a1d1a defined by the marker L44. As of November 13, 2009, based on FTDNA and other published tests of samples from the R1b-U106 project, there were at least 122 published test results (including Craig Venters) for L47, with 20 positive (16.4%), including 13 persons originated from the British Isles and Ireland, one person from Picardy, France and one Ashkenazic person of probable Sephardic origin (so caled Iberian Ashkenazin) from Belarus [26]. As well, due to the genetic distances among the members so far L47+, the age of this cluster is probably quite old, perhaps 2,700-2,900 years[citation needed]. It is possible that L47 emerged not too long after the L48 "parent" cluster. Preliminary data would strongly suggest that the L48 SNP occurred only a short period of time after the U106 SNP occurred, likely 200 years or less[citation needed]. With limited data for L46+ haplotypes at this point, it would appear that the L47 SNP occurred only a short period of time after the L48 SNP occurred, likely 200 years or less. However, more results and proper statistical analysis will be required. So far, these are only observations based on a few initial results. For the R1b1b2a1a1d1a defined by marker L44, as of May 15, 2009, based on FTDNA tests of samples from the R1b-U106 project, there were 37 test results for L44, with 6 positive (16.2%) and 31 negative. Downstream of L44, L46 has 37 test results, with 6 positive (16.2%) and 31 negative. As well, it is possible that L45 could be downstream of L44 and upstream of 46, but FTDNA has not started testing L45 yet. The age of L46 could be around 1,500 years before present (YBP)[citation needed].

[edit] R1b1b2a1a2

R-P312
Long-hand: R1b1b2a1a2
Defining SNP: P312 (also called S116, rs34276300)
Parent Clade: R-P310
Subclades: R-M153, R-M167, R-U152, R-L21

The P312 SNP appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of this SNP relative to the above list.

[edit] R1b1b2a1a2b

This subclade is defined by the presence of the marker R-M153. It has been found mostly in Basques and Gascons, among whom it represents a sizeable fraction of the Y-DNA pool[27][28][29], though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001[30]) it was described as H102 and included 7 Basques and one Andalusian.

[edit] R1b1b2a1a2c

This subclade is defined by the presence of the marker R-M167/SRY2627. The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[31]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000 Rosser[32] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001 Bosch described this marker as H103, in 5 Basques and 5 Catalans.[30] Further regional studies have located it in significant amounts in Asturias, Cantabria and Galicia, as well as again among Basques.[33] Cases in the Azores and Latin America have also been reported. In 2008 two research papers by López-Parra[29] and Adams,[28] respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men.

[edit] R1b1b2a1a2d

This subclade is defined by the presence of the marker R-U152 also called S28. Its discovery was announced in 2005 by EthnoAncestry[23] and subsequently identified independently by Sims et al. (2007).[34] Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. It is found from Greece westward to the Bay of Biscay in France, but the percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152.

[edit] R1b1b2a1a2e

This subclade is defined by the presence of the marker S68 which was reported by in 2007. It has been seen in an individual from Scotland and another from Sweden. This subclade is unlikely to be found in much more than 2% of the R1b population.[23]

[edit] R1b1b2a1a2f

This subclade is defined by the presence of the marker L21. Early results suggest that it is common in Britain, appears in France, Germany and Scandinavia, but is rare in Iberian or Italian ancestry.

[edit] R1b1b2a1a2f2

This subclade is defined by the presence of the marker M222. It is particularly associated with the Irish and Scots. In this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as it is suggested to have been the Y-chromosome haplogroup of the Uí Néill dynastic kindred of ancient Ireland.[35]

[edit] R1b1c

R1b1c is defined by the presence of SNP marker M335. This haplogroup was created by the 2008 reorganisation of nomenclature and should not be confused with R1b1b2, which was previously called R1b1c. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[1]

The M335 marker was first published in 2004, when one example was discovered in Turkey, which was classified at that time as R1b4.[7] Newly reclassified as The majority of men with a western European background are haplogroup R1b; having the SNP mutation that corresponds to Trinity's "Niall" STR pattern puts you in the subgroup R1b1b2a1b5b. (Because this R1b1b2-etc. designation keeps changing as new SNPs are found-- it started as R1b1c7-- we'll refer to it by the common shorthand designation R-M222.)

[edit] Distribution

R1b reaches its highest frequency in Atlantic Europe. Results from studies with small sample sizes should be treated with caution until more thorough testing is completed.

[edit] Eurasia

  • In South Asia, R1b is present at 8% in Iranians,[69] 7.4% in Pakistanis (including 4.5% R1b1b1-M73 and 2.8% R1b1b2-M269), while it is almost not found in India (0.55% R1b1b2-M269).[18] Haplogroup R1b1b2-M269 has been found in approximately 11% of a sample of Newars in Nepal.[70]
  • In the Caucasus, haplogroup R1b may be found in 43 % of Ossetian males[47] and in as many as 32.4% (238/734 P-92R7(xR1a1-SRY10831b))[71] to 36% (17/47 R1-M173(xR1a1a-M17))[54] of Armenians. It also has been found with lower frequency among Georgians (6/66 = 9.1% R1b1b2-M269[72] to 9/63 = 14.3% R1-M173(xR1a1a-M17)[73]) and Balkarians (2/38 = 5.3% R1b1-P25(xR1b1b2-M269) and 3/38 = 7.9% R1b1b2-M269 for a total of 5/38 = 13.2% R1b[72]).
  • Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b1 and R1b1b2 in Bashkirs, although the genetic diversity is low, suggesting a founder effect.[74][75]

[edit] Africa

[edit] Haplotypes

[edit] Atlantic Modal Haplotype

A common haplotype within R1b is sometimes called the Atlantic Modal Haplotype, or haplotype 15. It reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 70% in Portugal as a whole and more than 90% in NW Portugal, while the highest value is to be found among Spanish Basques. It was discovered prior to many of the SNPs now used to identify subclades of R1b and references to it can be found in some of the older literature. It corresponds most closely with subclade R1b1b2a1a [L11].

[edit] Haplotype 35

There also exists a haplotype associated with R1b1b2 characterized by DYS393=12 which is known in the literature as Haplotype 35 (ht35), or the Armenian Modal Haplotype.

[edit] Mutation

The technical details of M343 (rs9786184) are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5'? 3': tttaacctcctccagctctgca
Reverse 5'? 3': acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

[edit] Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve.

Stephen Oppenheimer also deals with this haplogroup in his book Origins of the British, giving the R1b clan patriarch the Basque name "Ruisko" in honour of what he thought was the Iberian origin of R1b.

[edit] See also

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L MNOPS T
|
M NO P S
| |
N O Q R
R
R1

R1a



R1b




R2



[edit] References

  1. ^ a b c d e Karafet, TM; Mendez, FL; Meilerman, MB; Underhill, PA; Zegura, SL; Hammer, MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree.". Genome research 18 (5): 830–8. doi:10.1101/gr.7172008. PMID 18385274. 
  2. ^ a b International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009
  3. ^ a b "Variations of R1b Ydna in Europe: Distribution and Origins". http://www.worldfamilies.net/Tools/r1b_ydna_in_europe. 
  4. ^ a b http://www.roperld.com/YBiallelicHaplogroups.htm
  5. ^ Cinnioğlu, C; King, R; Kivisild, T; Kalfoğlu, E; Atasoy, S; Cavalleri, GL; Lillie, AS; Roseman, CC et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Human genetics 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  6. ^ Y Chromosome Consortium (January 18, 2002). "YCC NRY Tree 2002". http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html. Retrieved December 13, 2007. 
  7. ^ a b Cinnioğlu, C; King; Kivisild; Kalfoğlu; Atasoy; Cavalleri; Lillie; Roseman et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Human genetics 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf. 
  8. ^ Adams, SM; King; Bosch; Jobling (2006). "The case of the unreliable SNP: recurrent back-mutation of Y-chromosomal marker P25 through gene conversion.". Forensic science international 159 (1): 14–20. doi:10.1016/j.forsciint.2005.06.003. PMID 16026953. 
  9. ^ B. Arredi, E. S. Poloni and C. Tyler-Smith (2007). "The peopling of Europe". in Crawford, Michael H.. Anthropological genetics: theory, methods and applications. Cambridge, UK: Cambridge University Press. p. 394. ISBN 0-521-54697-4. 
  10. ^ Cruciani, F; Santolamazza; Shen; Macaulay; Moral; Olckers; Modiano; Holmes et al. (2002). "A back migration from Asia to sub-Saharan Africa is supported by high-resolution analysis of human Y-chromosome haplotypes.". American journal of human genetics 70 (5): 1197–214. doi:10.1086/340257. PMID 11910562. , pp. 13–14. Note that it was reported here as R1*-M173 but the following study makes the subclade clear; Wood, ET; Stover; Ehret; Destro-Bisol; Spedini; Mcleod; Louie; Bamshad et al. (2005). "Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes.". European journal of human genetics : EJHG 13 (7): 867–76. doi:10.1038/sj.ejhg.5201408. PMID 15856073. http://hammerlab.biosci.arizona.edu/publications/Wood_2005_EUR.pdf. 
  11. ^ Eupedia[verification needed]
  12. ^ Luis, JR; Rowold; Regueiro; Caeiro; Cinnioğlu; Roseman; Underhill; Cavalli-Sforza et al. (2004). "The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations.". American journal of human genetics 74 (3): 532–44. doi:10.1086/382286. PMID 14973781. 
  13. ^ Rosa, A; Ornelas; Jobling; Brehm; Villems (2007). "Y-chromosomal diversity in the population of Guinea-Bissau: a multiethnic perspective.". BMC evolutionary biology 7: 124. doi:10.1186/1471-2148-7-124. PMID 17662131. 
  14. ^ Hassan, HY; Underhill, PA; Cavalli-Sforza, LL; Ibrahim, ME (2008). "Y-chromosome variation among Sudanese: restricted gene flow, concordance with language, geography, and history.". American journal of physical anthropology 137 (3): 316–23. doi:10.1002/ajpa.20876. PMID 18618658. 
  15. ^ Contu, D; Morelli; Santoni; Foster; Francalacci; Cucca (2008). "Y-chromosome based evidence for pre-neolithic origin of the genetically homogeneous but diverse Sardinian population: inference for association scans.". PloS one 3 (1): e1430. doi:10.1371/journal.pone.0001430. PMID 18183308. 
  16. ^ Zalloua, PA; Xue; Khalife; Makhoul; Debiane; Platt; Royyuru; Herrera et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events.". American journal of human genetics 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMID 18374297. 
  17. ^ [1] Dennis Wright - The Irish Type III Website[unreliable source?]
  18. ^ a b Sengupta, S; Zhivotovsky; King; Mehdi; Edmonds; Chow; Lin; Mitra et al. (February 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". American journal of human genetics 78 (2): 202–21. doi:10.1086/499411. PMID 16400607. "8/176 R-M73 and 5/176 R-M269 for a total of 13/176 R1b in Pakistan and 4/728 R-M269 in India". 
  19. ^ Semino, O; Passarino; Oefner; Lin; Arbuzova; Beckman; De Benedictis; Francalacci et al. (2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective.". Science 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453. 
  20. ^ Arredi, Poloni and Tyler-Smith (2007). "The Peopling of Europe". in Michael Crawford. Anthropological Genetics. Cambridge: Cambridge University Press. pp. 380–408. ISBN 978-0-521-54697-3. http://books.google.ca/books?id=tlSspaBLkhoC&pg=PA380&lpg=PA394#PPA394,M1. 
  21. ^ a b Myres, NM; Ekins; Lin; Cavalli-Sforza; Woodward; Underhill (2007). "Y-chromosome short tandem repeat DYS458.2 non-consensus alleles occur independently in both binary haplogroups J1-M267 and R1b3-M405.". Croatian medical journal 48 (4): 450–9. PMID 17696299. PMC 2080563. http://www.cmj.hr/2007/48/4/17696299.htm. 
  22. ^ Sims, LM; Garvey; Ballantyne (2007). "Sub-populations within the major European and African derived haplogroups R1b3 and E3a are differentiated by previously phylogenetically undefined Y-SNPs.". Human mutation 28 (1): 97. doi:10.1002/humu.9469. PMID 17154278. http://www3.interscience.wiley.com/homepages/38515/pdf/940.pdf. 
  23. ^ a b c http://ethnoancestry.com/R1b.html[unreliable source?]
  24. ^ Family Tree DNA: Null 439
  25. ^ results
  26. ^ [2]
  27. ^ McEwan's Genealogy Page: "R1b1c4 aka M153"[self-published source?]
  28. ^ a b c d e Adams, SM; Bosch; Balaresque; Ballereau; Lee; Arroyo; López-Parra; Aler et al. (2008). "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula". American journal of human genetics 83 (6): 725–36. doi:10.1016/j.ajhg.2008.11.007. PMID 19061982. 
  29. ^ a b López-Parra, AM; Gusmão; Tavares; Baeza; Amorim; Mesa; Prata; Arroyo-Pardo (2009). "In search of the pre- and post-neolithic genetic substrates in Iberia: evidence from Y-chromosome in Pyrenean populations.". Annals of human genetics 73 (1): 42–53. doi:10.1111/j.1469-1809.2008.00478.x. PMID 18803634. 
  30. ^ a b Bosch, E; Calafell; Comas; Oefner; Underhill; Bertranpetit (2001). "High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula.". American journal of human genetics 68 (4): 1019–29. doi:10.1086/319521. PMID 11254456. 
  31. ^ Hurles, ME; Veitia; Arroyo; Armenteros; Bertranpetit; Pérez-Lezaun; Bosch; Shlumukova et al. (1999). "Recent male-mediated gene flow over a linguistic barrier in Iberia, suggested by analysis of a Y-chromosomal DNA polymorphism.". American journal of human genetics 65 (5): 1437–48. doi:10.1086/302617. PMID 10521311. 
  32. ^ a b c d Rosser, ZH; Zerjal; Hurles; Adojaan; Alavantic; Amorim; Amos; Armenteros et al. (2000). "Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language.". American journal of human genetics 67 (6): 1526–43. doi:10.1086/316890. PMID 11078479. 
  33. ^ McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"[self-published source?]
  34. ^ McEwan Genealogy Page S28[self-published source?]
  35. ^ New York Times: Percentage of men in Ireland who are believed to descend from King Niall of the Nine hostages
  36. ^ a b c d e f g Semino, O; Santachiara-Benerecetti; Falaschi; Cavalli-Sforza; Underhill (2002). "Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny.". American journal of human genetics 70 (1): 265–8. doi:10.1086/338306. PMID 11719903. 
  37. ^ 286/348, "The genetic position of Western Brittany (Finistère, France) in the Celtic Y chromosome landscape", K.Rouault et al. 2009
  38. ^ Lyon(n=129), Strasbourg (n=99), Kalevi Wiik, Where did European Men Come From ?, Journal of Genetic Genealogy 4:35-85, 2008 , p.77
  39. ^ Beleza, S; Gusmão; Lopes; Alves; Gomes; Giouzeli; Calafell; Carracedo et al. (2006). "Micro-phylogeographic and demographic history of Portuguese male lineages.". Annals of human genetics 70 (Pt 2): 181–94. doi:10.1111/j.1529-8817.2005.00221.x. PMID 16626329. "395/657". 
  40. ^ Capelli, C; Brisighelli; Scarnicci; Arredi; Caglia'; Vetrugno; Tofanelli; Onofri et al. (2007). "Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter.". Molecular phylogenetics and evolution 44 (1): 228–39. doi:10.1016/j.ympev.2006.11.030. PMID 17275346. "280/699". 
  41. ^ Kayser, M; Lao; Anslinger; Augustin; Bargel; Edelmann; Elias; Heinrich et al. (2005). "Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis.". Human genetics 117 (5): 428–43. doi:10.1007/s00439-005-1333-9. PMID 15959808. "473/1215". 
  42. ^ a b Helgason, A; Sigureardottir; Nicholson; Sykes; Hill; Bradley; Bosnes; Gulcher et al. (2000). "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". The American Journal of Human Genetics 67: 697. doi:10.1086/303046. 
  43. ^ Di Gaetano, C; Cerutti, N; Crobu, F; Robino, C; Inturri, S; Gino, S; Guarrera, S; Underhill, PA et al. (2009). "Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome.". European journal of human genetics : EJHG 17 (1): 91–9. doi:10.1038/ejhg.2008.120. PMID 18685561. "57/232". 
  44. ^ Zalloua, PA; Platt, DE; El Sibai, M; Khalife, J; Makhoul, N; Haber, M; Xue, Y; Izaabel, H et al. (2008). "Identifying genetic traces of historical expansions: Phoenician footprints in the Mediterranean.". American journal of human genetics 83 (5): 633–42. doi:10.1016/j.ajhg.2008.10.012. PMID 18976729. 
  45. ^ Contu, D; Morelli; Santoni; Foster; Francalacci; Cucca (2008). "Y-chromosome based evidence for pre-neolithic origin of the genetically homogeneous but diverse Sardinian population: inference for association scans.". PloS one 3 (1): e1430. doi:10.1371/journal.pone.0001430. PMID 18183308. "174/930". 
  46. ^ Kayser, M; Lao; Anslinger; Augustin; Bargel; Edelmann; Elias; Heinrich et al. (2005). "Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis.". Human genetics 117 (5): 428–43. doi:10.1007/s00439-005-1333-910.1007/s00439-005-1333-9 (inactive 2009-09-30). PMID 15959808. "106/913". 
  47. ^ a b c d e f g h i j Pericić, M; Lauc; Klarić; Rootsi; Janićijevic; Rudan; Terzić; Colak et al. (2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations.". Molecular biology and evolution 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443.  Haplogroup frequency data in table 1
  48. ^ a b Varzari, Alexander (July 27, 2006). "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms". 
  49. ^ a b Tambets et al. (2004).[verification needed]
  50. ^ King, RJ; Ozcan, SS; Carter, T; Kalfoğlu, E; Atasoy, S; Triantaphyllidis, C; Kouvatsi, A; Lin, AA et al. (2008). "Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic.". Annals of human genetics 72 (Pt 2): 205–14. doi:10.1111/j.1469-1809.2007.00414.x. PMID 18269686. 
  51. ^ Regueiro et al. (2006), "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration", Hum Hered 61: 132–143, doi:10.1159/000093774, http://content.karger.com/ProdukteDB/produkte.asp?Aktion=ShowPDF&ArtikelNr=93774&ProduktNr=224250&filename=93774.pdf 
  52. ^ 76/523
    Cinnioğlu, C; King; Kivisild; Kalfoğlu; Atasoy; Cavalleri; Lillie; Roseman et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Human genetics 114 (2): 127–48. doi:10.1007/s00439-003-1031-410.1007/s00439-003-1031-4 (inactive 2009-09-30). PMID 14586639. 
  53. ^ Al-Zahery, N; Semino; Benuzzi; Magri; Passarino; Torroni; Santachiara-Benerecetti (2003). "Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations". Molecular phylogenetics and evolution 28 (3): 458–72. doi:10.1016/S1055-7903(03)00039-3. PMID 12927131. "16/139". 
  54. ^ a b c d e f Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMID 11526236. 
  55. ^ a b Nebel et al. (2001)[verification needed]
  56. ^ Nasidze et al. (2005)[verification needed]
  57. ^ a b Cruciani et al. (2004)[verification needed]
  58. ^ a b Semino et al. (2000)[verification needed]
  59. ^ a b Hammer et al. (2000)[verification needed]
  60. ^ Hammer et al. (2000)
  61. ^ Di Giacomo et al. (2004)
  62. ^ Cruciani et al. 2004
  63. ^ Flores, C; Maca-Meyer; Larruga; Cabrera; Karadsheh; Gonzalez (2005). "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan.". Journal of human genetics 50 (9): 435–41. doi:10.1007/s10038-005-0274-4. PMID 16142507. 
  64. ^ Semino et al. (2004)[verification needed]
  65. ^ Zalloua, PA; Xue; Khalife; Makhoul; Debiane; Platt; Royyuru; Herrera et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events.". American journal of human genetics 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMID 18374297. "47/935". 
  66. ^ 7/164, Cadenas et al. 2008
  67. ^ Zhou, R; Yang; Zhang; Yu; An; Wang; Li; Xu et al. (2008). "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape.". Annals of human biology 35 (2): 198–211. doi:10.1080/03014460801922927. PMID 18428013. 
  68. ^ Xue, Y; Zerjal; Bao; Zhu; Shu; Xu; Du; Fu et al. (April 2006). "Male demography in East Asia: a north-south contrast in human population expansion times". Genetics 172 (4): 2431–9. doi:10.1534/genetics.105.054270. PMID 16489223. 
  69. ^ Regueiro et al. (2006), "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration", Hum Hered 61: 132–143, doi:10.1159/000093774, http://content.karger.com/ProdukteDB/produkte.asp?Aktion=ShowPDF&ArtikelNr=93774&ProduktNr=224250&filename=93774.pdf 
  70. ^ Gayden, T; Cadenas; Regueiro; Singh; Zhivotovsky; Underhill; Cavalli-Sforza; Herrera (2007). "The Himalayas as a directional barrier to gene flow.". American journal of human genetics 80 (5): 884–94. doi:10.1086/516757. PMID 17436243. 
  71. ^ Weale, ME; Yepiskoposyan; Jager; Hovhannisyan; Khudoyan; Burbage-Hall; Bradman; Thomas (2001). "Armenian Y chromosome haplotypes reveal strong regional structure within a single ethno-national group.". Human genetics 109 (6): 659–74. doi:10.1007/s00439-001-0627-9. PMID 11810279. 
  72. ^ a b Battaglia, V; Fornarino, S; Al-Zahery, N; Olivieri, A; Pala, M; Myres, NM; King, RJ; Rootsi, S et al. (2009). "Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe.". European journal of human genetics : EJHG 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMID 19107149. 
  73. ^ Semino, O. (2000). "The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective". Science 290: 1155. doi:10.1126/science.290.5494.1155. 
  74. ^ A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005[verification needed]
  75. ^ Lobov et al. (2009)
  76. ^ a b Hassan, HY; Underhill; Cavalli-Sforza; Ibrahim (2008). "Y-chromosome variation among Sudanese: restricted gene flow, concordance with language, geography, and history.". American journal of physical anthropology 137 (3): 316–23. doi:10.1002/ajpa.20876. PMID 18618658. http://dirkschweitzer.net/E3b-papers/Hassan-Sudan-2008-AJPA.pdf. "13/32". 
  77. ^ http://www.ddl.ish-lyon.cnrs.fr/fulltext/Van%20Der%20Veen/Van%20der%20Veen_2007_Porquerolles.pdf
  78. ^ 6/147, Luis et al. 2001[verification needed]
  79. ^ 3/19 Arredi et al. 2004[verification needed]
  80. ^ Robino, C; Crobu; Di Gaetano; Bekada; Benhamamouch; Cerutti; Piazza; Inturri et al. (2008). "Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample.". International journal of legal medicine 122 (3): 251–5. doi:10.1007/s00414-007-0203-5. PMID 17909833. "11/102". 
  81. ^ Bosch et al. 2001[verification needed]
  82. ^ Maria Brotilini et al. 2004[verification needed]

[edit] Bibliography

  • Luigi Luca Cavalli-Sforza (1994). The History and Geography of Human Genes. Princeton University Press.  ISBN 0-691-08750-4
  • Michel Morvan (1996) The linguistic origins of basque (in french), Bordeaux University Press. ISBN 2-86781-182-1

[edit] External links

[edit] Maps

[edit] Projects