Haplogroup I-M253

From Wikipedia, the free encyclopedia
Jump to navigation Jump to search
Haplogroup I1 (M253)
Possible time of origin3,170–4,600[1]-5,070 BP (today's diversification)[2][3] (previously 11,000 BP[4] to 33,000 BP[5]) 27,500 (diversification with I2-FGC77992)[1]
Possible place of originNorthern Europe
AncestorI* (M170)
DescendantsI1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Defining mutationsM253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[6] It is a primary branch of Haplogroup I-M170 (I*).

The haplogroup is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its absence in pre-Neolithic DNA samples it can't have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8][9][10] 37% of Norwegian males,[11][12][13] 34.8% of Danish males,[14][15][16] and about 28% of Finnish males.[17] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Odin".[18]

Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.

All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]

Before a reclassification in 2008,[19] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).

Origins[edit]

Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far no DNA-studies have been able to locate it in Mesolithic hunter-gatherers. As of November 2020, only 3 ancient DNA samples dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1. The first is an individual sample labelled BAB5 from Neolithic Hungary.[20] Another is an individual belonging to the middle Neolithic Chasséen culture labelled Cx161. Cx161 had a genetic affinity to other contemporary Neolithic farmers of Europe.[21] Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179.[22] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture.[23]

Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among Scandinavian Mesolithic DNA samples.[24][25] I1 first appears in Scandinavia during the late Neolithic but does not increase in frequency until the beginning of the Nordic Bronze Age.[26][27][28][23]

Given the nature of ancient DNA samples Cx161 and RISE179, a possible explanation for why haplogroup I1 is thus far absent among Mesolithic and Neolithic hunter-gatherers in Scandinavia is that I1 may have been present as a minor lineage in Central European Neolithic cultures such as the Rössen culture, Globular Amphora culture and the Funnelbeaker culture.[29] It could later have been assimilated by the people of the Corded Ware culture and brought to Scandinavia as a part of the Battle Axe culture.[30][31][32] Given that I1 has not been found in any DNA samples in Scandinavia predating the Battle Axe culture, it is likely that the haplogroup was brought there by the people of that culture.[33][34]

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]

In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[14] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".

Latest results (Sept. 2019) published by Y-Full suggest I1 (I-M253) was formed 27.500 ybp (95 CI: 29.800 ybp – 25.200 ybp) with TMRCA 4.600 ybp (95 CI: 5.200 ybp – 4.000 ybp).

A 2014 study in Hungary uncovered remains of two individuals from the Linear Pottery culture, one of whom was found to have carried the M253 SNP which defines Haplogroup I1. This culture is thought to have been present between 7,500 and 6,500 years ago.[35]

Structure[edit]

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • FGC20030; I1a1a~
        • S4767; I1a1a1~
              • I-M227; I1a1a1a1a
        • A394; I1a1a2~
        • Y11221; I1a1a3~
        • A5338; I1a1a4~
      • CTS10028; I1a1b
        • I-L22 (L22/S142); I1a1b1
          • CTS11651/Z2338; I1a1b1a~
            • I-P109; I1a1b1a1
              • I-Y3662; I1a1b1a1e~
                • I-S14887; I1a1b1a1e2~
                  • I-Y11203; I1a1b1a1e2d~
                    • I-Y29630; I1a1b1a1e2d2~
            • CTS6017; I1a1b1a2
            • I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
            • CTS6868; I1a1b1a4
              • I-Z74; I1a1b1a4a
                • CTS2208; I1a1b1a4a1~
                  • I-L287; I1a1b1a4a1a
                    • I-L258 (L258/S335); I1a1b1a4a1a1
                • I-L813; I1a1b1a4a2
                • FGC12562; I1a1b1a4a3~
          • CTS11603/S4744; I1a1b1b~
                • I-L300 (L300/S241); I1a1b1b1a1
        • FGC10477/Y13056; I1a1b2
        • A8178, A8182, A8200, A8204; I1a1b3~
        • F13534.2/Y17263.2; I1a1b4~
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Historical expansion[edit]

Percentage of major Y-DNA haplogroups in Europe; Haplogroup I1 represented by light blue.

Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[36][37] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[38]

I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [39] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[40][41] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[42]

Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[43] Material findings associated with the Lombards have been excavated in Crypta Balbi.

The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[44] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.

The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[45]

During the Viking Age, I-M253 saw another expansion. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[46]

Geographical distribution[edit]

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia and Canada.

Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
Albanians (Tirana)
Albanians (North Macedonia)
55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
Albanians (Tirana)
Albanians (North Macedonia)
Kosovo Albanians (Pristina)
55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
Battaglia et al. 2008
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
Denmark 122 39.3% (48/122) 32.8% (40/122) 0.0 Underhill et al. 2007
England 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finland (national) 28.0 Lappalainen et al. 2006
Finland: West 230 40% (92/230) Lappalainen et al. 2008
Finland: East 306 19% (58/306) Lappalainen et al. 2008
Finland: Satakunta region 50+ Lappalainen et al. 20089
France 58 17.2 8.6 1.7 Underhill et al. 2007
France 12 16.7 16.7 0.0 Cann et al. 2002
France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
Germany 125 24 15.2 0.0 Underhill et al. 2007
Greece 171 15.8 2.3 0.0 Underhill et al. 2007
Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
Ireland 100 11 6.0 0.0 Underhill et al. 2007
Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
Latvia 113 3.5 Lappalainen et al. 2008
Lithuania 164 4.9 Lappalainen et al. 2008
Netherlands 93 20.4 14 0.0 Underhill et al. 2007
Norway 1766 37% (653/1766) Stenersen et al 2006
Russia (national) 16 25 12.5 0.0 Cann et al. 2002
Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
Russia: Karelians 132 15.2 Lappalainen et al. 2008
Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
Sweden (national) 38.0 Lappalainen et al. 2009
Sweden: Västra Götaland 52 Lappalainen et al. 2009
Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ukraine: Cherkasy 114 28.1 4.3 0.0 Underhill et al. 2007
Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[47] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[48] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253[edit]

Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[49]

The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024.[50][51] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades.[52][53] Some prominent historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov, a Russian prince and field-marshal, as well as Count Illarion Ivanovich Vorontsov-Dashkov, a general of the Russian Empire.

The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to have carried the I1-S2077 subclade of I1-Z63.[54][55][56]

Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be I-M253.[57] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.

Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.[58]

William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project[59]

William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project[59]

General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee. The latter was one of the Founding Fathers of the United States of America.[60]

Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395.[61]

The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project.[62] They were lords and princes of Monaco up until 1949. This noble family also provided one prince of Salerno, as well as 3 doges of Genoa. In addition to that, many members of the family became archbishops and cardinals. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.

President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.[63][64]

The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.[65][66]

Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.[67]

The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.[68][69]

Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1.[70][71]

Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1.[67]

The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com.[72][73][74]

Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project.[75][76][77]

Greek general Theodoros Kolokotronis and other male members of the Kolokotronis family have been found to carry I1-M253.[78][79]

As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819.[80][81]

Markers[edit]

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[82]

Type: SNP
Source: M (Peter Underhill of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
ISOGG HG: I1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Nucleotide alleles change (mutation): C to T

Name: M307[83]

Type: SNP
Source: M (Peter Underhill)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: TTATTGGCATTTCAGGAAGTG
Primer R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Nucleotide alleles change (mutation): G to A

Name: P30[84]

Type: SNP
Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGTGGGCTGTTTGAAAAAGA
Primer R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40[85]

Type: SNP
Source: PS (Michael Hammer and James F. Wilson)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGAGAAAAGGTGAGAAACC
Primer R: GGACAAGGGGCAGATT
YCC HG: I1
Nucleotide alleles change (mutation): C to T
Region: ARSDP

See also[edit]

References[edit]

  1. ^ a b c https://yfull.com/tree/I1/
  2. ^ a b Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  3. ^ a b Batini, Chiara; Hallast, Pille; Zadik, Daniel; Delser, Pierpaolo Maisano; Benazzo, Andrea; Ghirotto, Silvia; Arroyo-Pardo, Eduardo; Cavalleri, Gianpiero L.; De Knijff, Peter; Dupuy, Berit Myhre; Eriksen, Heidi A.; King, Turi E.; De Munain, Adolfo López; López-Parra, Ana M.; Loutradis, Aphrodite; Milasin, Jelena; Novelletto, Andrea; Pamjav, Horolma; Sajantila, Antti; Tolun, Aslıhan; Winney, Bruce; Jobling, Mark A. (2015). "TMRCAs of major haplogroups in Europe estimated using two methods. Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group". Nature Communications. 6: 7152. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
  4. ^ Rootsi, Siiri; et al. (2004). "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
  5. ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
  6. ^ a b ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
  7. ^ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). "Migration Waves to the Baltic Sea Region". Annals of Human Genetics. 72 (3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
  8. ^ Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J.; Lahermo, P. (2009). "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. S2CID 205598345.
  9. ^ https://www.familytreedna.com/public/Sweden?iframe=ymap
  10. ^ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–348. doi:10.1111/j.1469-1809.2007.00429.x. ISSN 0003-4800. PMID 18294359. S2CID 32079904.
  11. ^ Dupuy, Berit Myhre; Stenersen, Margurethe; Lu, Tim T.; Olaisen, Bjørnar (2006-12-01). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–19. doi:10.1016/j.forsciint.2005.11.009. ISSN 0379-0738. PMID 16337760.
  12. ^ "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2020-11-26.
  13. ^ "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
  14. ^ a b Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  15. ^ Sanchez, J.J (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–349. doi:10.1016/S0531-5131(03)01635-2 – via isfg.org.
  16. ^ "FamilyTreeDNA - Denmark DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  17. ^ Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp. 207–15.
  18. ^ "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
  19. ^ Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  20. ^ Szécsényi-Nagy, Anna; Brandt, Guido; Keerl, Victoria; Jakucs, János; Haak, Wolfgang; Möller-Rieker, Sabine; Köhler, Kitti; Mende, Balázs; Fecher, Marc; Oross, Krisztián; Paluch, Tibor; Osztás, Anett; Kiss, Viktória; Pálfi, György; Molnár, Erika; Sebők, Katalin; Czene, András; Paluch, Tibor; Šlaus, Mario; Novak, Mario; Pećina-Šlaus, Nives; Ősz, Brigitta; Voicsek, Vanda; Somogyi, Krisztina; Tóth, Gábor; Kromer, Bernd; Bánffy, Eszter; Alt, Kurt (2014). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". doi:10.1101/008664. S2CID 196648568. Cite journal requires |journal= (help)
  21. ^ Brunel, Samantha; Bennett, E. Andrew; Cardin, Laurent; Garraud, Damien; Emam, Hélène Barrand; Beylier, Alexandre; Boulestin, Bruno; Chenal, Fanny; Ciesielski, Elsa; Convertini, Fabien; Dedet, Bernard (2020-06-09). "Ancient genomes from present-day France unveil 7,000 years of its demographic history". Proceedings of the National Academy of Sciences. 117 (23): 12791–12798. doi:10.1073/pnas.1918034117. ISSN 0027-8424. PMC 7293694. PMID 32457149.
  22. ^ Allentoft, Morten E.; Sikora, Martin; Sjögren, Karl-Göran; Rasmussen, Simon; Rasmussen, Morten; Stenderup, Jesper; Damgaard, Peter B.; Schroeder, Hannes; Ahlström, Torbjörn; Vinner, Lasse; Malaspinas, Anna-Sapfo; Margaryan, Ashot; Higham, Tom; Chivall, David; Lynnerup, Niels; Harvig, Lise; Baron, Justyna; Casa, Philippe Della; Dąbrowski, Paweł; Duffy, Paul R.; Ebel, Alexander V.; Epimakhov, Andrey; Frei, Karin; Furmanek, Mirosław; Gralak, Tomasz; Gromov, Andrey; Gronkiewicz, Stanisław; Grupe, Gisela; Hajdu, Tamás; et al. (2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–172. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
  23. ^ a b Allentoft, Morten E.; Sikora, Martin; Sjögren, Karl-Göran; Rasmussen, Simon; Rasmussen, Morten; Stenderup, Jesper; Damgaard, Peter B.; Schroeder, Hannes; Ahlström, Torbjörn; Vinner, Lasse; Malaspinas, Anna-Sapfo (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–172. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. ISSN 1476-4687. PMID 26062507. S2CID 4399103.
  24. ^ Günther, T.; Malmström, H.; Svensson, E. M.; Omrak, A.; Sánchez-Quinto, F.; Kılınç, G. M.; Krzewińska, M.; Eriksson, G.; Fraser, M.; Edlund, H.; Munters, A. R.; Coutinho, A.; Simões, L. G.; Vicente, M.; Sjölander, A.; Jansen Sellevold, B.; Jørgensen, R.; Claes, P.; Shriver, M. D.; Valdiosera, C.; Netea, M. G.; Apel, J.; Lidén, K.; Skar, B.; Storå, J.; Götherström, A.; Jakobsson, M. (2018). "Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation". PLOS Biology. 16 (1): e2003703. doi:10.1371/journal.pbio.2003703. PMC 5760011. PMID 29315301.
  25. ^ Malmström, H.; Günther, T.; Svensson, E. M.; Juras, A.; Fraser, M.; Munters, A. R.; Tõrv, M.; Lindström, J.; Götherström, A.; Storå, J.; Jakobsson, M.; Jakobsson, Mattias (2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912). doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
  26. ^ Sánchez-Quinto, Federico; Malmström, Helena; Fraser, Magdalena; Girdland-Flink, Linus; Svensson, Emma M.; Simões, Luciana G.; George, Robert; Hollfelder, Nina; Burenhult, Göran; Noble, Gordon; Britton, Kate (2019-05-07). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences. 116 (19): 9469–9474. doi:10.1073/pnas.1818037116. ISSN 0027-8424. PMC 6511028. PMID 30988179.
  27. ^ Skoglund, Pontus; Malmström, Helena; Omrak, Ayça; Raghavan, Maanasa; Valdiosera, Cristina; Günther, Torsten; Hall, Per; Tambets, Kristiina; Parik, Jüri; Sjögren, Karl-Göran; Apel, Jan (2014-05-16). "Genomic Diversity and Admixture Differs for Stone-Age Scandinavian Foragers and Farmers". Science. 344 (6185): 747–750. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. ISSN 0036-8075. PMID 24762536. S2CID 206556994.
  28. ^ Karlsson, Andreas O.; Wallerström, Thomas; Götherström, Anders; Holmlund, Gunilla (August 2006). "Y-chromosome diversity in Sweden – A long-time perspective". European Journal of Human Genetics. 14 (8): 963–970. doi:10.1038/sj.ejhg.5201651. ISSN 1476-5438. PMID 16724001. S2CID 23227271.
  29. ^ https://www.eupedia.com/europe/Haplogroup_I1_Y-DNA.shtml#nordic
  30. ^ Malmström, Helena; Gilbert, M. Thomas P.; Thomas, Mark G.; Brandström, Mikael; Storå, Jan; Molnar, Petra; Andersen, Pernille K.; Bendixen, Christian; Holmlund, Gunilla; Götherström, Anders; Willerslev, Eske (2009-11-03). "Ancient DNA Reveals Lack of Continuity between Neolithic Hunter-Gatherers and Contemporary Scandinavians". Current Biology. 19 (20): 1758–1762. doi:10.1016/j.cub.2009.09.017. ISSN 0960-9822. PMID 19781941. S2CID 9487217.
  31. ^ "Scandinavia's earliest farmers exchanged terminology with Indo-Europeans". phys.org. Retrieved 2020-11-23.
  32. ^ Malmström, Helena; Günther, Torsten; Svensson, Emma M.; Juras, Anna; Fraser, Magdalena; Munters, Arielle R.; Pospieszny, Łukasz; Tõrv, Mari; Lindström, Jonathan; Götherström, Anders; Storå, Jan; Jakobsson, Mattias (2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings of the Royal Society B: Biological Sciences. 286 (1912). doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
  33. ^ Fraser, Magdalena (February 2018). "New insights on cultural dualism and population structure in the Middle Neolithic Funnel Beaker culture on the island of Gotland". Journal of Archaeological Science: Reports. 17: 325–334. doi:10.1016/j.jasrep.2017.09.002 – via ResearchGate.
  34. ^ Mathieson, Iain; Roodenberg, Songül Alpaslan; Posth, Cosimo; Szécsényi-Nagy, Anna; Rohland, Nadin; Mallick, Swapan; Olalde, Iñigo; Broomandkhoshbacht, Nasreen; Candilio, Francesca; Cheronet, Olivia; Fernandes, Daniel (2018-03-08). "The Genomic History of Southeastern Europe". Nature. 555 (7695): 197–203. Bibcode:2018Natur.555..197M. doi:10.1038/nature25778. ISSN 0028-0836. PMC 6091220. PMID 29466330.
  35. ^ "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". bioRxiv 10.1101/008664.
  36. ^ Schmidt, Karl Horst (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–152. ISSN 0935-3518. JSTOR 40849016.
  37. ^ Bergerbrant, Sophie (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 – via diva-portal.org.
  38. ^ Teska, M.; Michalowski, Andrzej (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron Age". www.semanticscholar.org. S2CID 56295624. Retrieved 2020-12-10.
  39. ^ Piontek, Janusz. "2017 Zenczak .....Piontek ... Y-chromosome haplogroup assignment through next generation sequencing of enriched ancient DNA libraries". Cite journal requires |journal= (help)
  40. ^ Amorim, Carlos Eduardo G.; Vai, Stefania; Posth, Cosimo; Modi, Alessandra; Koncz, István; Hakenbeck, Susanne; La Rocca, Maria Cristina; Mende, Balazs; Bobo, Dean; Pohl, Walter; Baricco, Luisella Pejrani (2018-09-11). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. ISSN 2041-1723. PMC 6134036. PMID 30206220.
  41. ^ Estes, Roberta (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained - Genetic Genealogy. Retrieved 2020-12-11.
  42. ^ Labudde, Dirk (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 – via ResearchGate.net.
  43. ^ Antonio, Margaret L.; Gao, Ziyue; Moots, Hannah M.; Lucci, Michaela; Candilio, Francesca; Sawyer, Susanna; Oberreiter, Victoria; Calderon, Diego; Devitofranceschi, Katharina; Aikens, Rachael C.; Aneli, Serena (2019-11-08). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. ISSN 0036-8075. PMC 7093155. PMID 31699931.
  44. ^ Olalde, Iñigo; Mallick, Swapan; Patterson, Nick; Rohland, Nadin; Villalba-Mouco, Vanessa; Silva, Marina; Dulias, Katharina; Edwards, Ceiridwen J.; Gandini, Francesca; Pala, Maria; Soares, Pedro (2019-03-15). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–1234. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. ISSN 0036-8075. PMC 6436108. PMID 30872528.
  45. ^ Martiniano, Rui; Caffell, Anwen; Holst, Malin; Hunter-Mann, Kurt; Montgomery, Janet; Müldner, Gundula; McLaughlin, Russell L.; Teasdale, Matthew D.; van Rheenen, Wouter; Veldink, Jan H.; van den Berg, Leonard H. (2016-01-19). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. ISSN 2041-1723. PMC 4735653. PMID 26783717.
  46. ^ Margaryan, Ashot; Lawson, Daniel; Sikora, Martin; Racimo, Fernando; Rasmussen, Simon; Moltke, Ida; Cassidy, Lara; Jørsboe, Emil; Ingason, Andrés; Pedersen, Mikkel; Korneliussen, Thorfinn (2019-07-17). "Population genomics of the Viking world". bioRxiv. 585 (7825): 390–396. doi:10.1101/703405. PMID 32939067. S2CID 201195157.
  47. ^ Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
  48. ^ Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H.; et al. (2003). "A Y Chromosome Census of the British Isles" (PDF). Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. S2CID 526263.
  49. ^ "Founding Father DNA". isogg.org.
  50. ^ "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy". www.familytreedna.com. Retrieved 2020-12-10.
  51. ^ "Faderslinjen, DNA". www.sikaby.se. Retrieved 2020-12-10.
  52. ^ "FamilyTreeDNA - RussiaDNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  53. ^ "Vår vikingahövding i österled". www.sikaby.se. Retrieved 2020-12-10.
  54. ^ "Sample from Homo sapiens - BioSample - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-10.
  55. ^ Margaryan, Ashot; Lawson, Daniel J.; Sikora, Martin; Racimo, Fernando; Rasmussen, Simon; Moltke, Ida; Cassidy, Lara M.; Jørsboe, Emil; Ingason, Andrés; Pedersen, Mikkel W.; Korneliussen, Thorfinn (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. doi:10.1038/s41586-020-2688-8. ISSN 1476-4687. PMID 32939067.
  56. ^ Duczko, Wladyslaw (2004-01-01). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. BRILL. ISBN 978-90-04-13874-2.
  57. ^ Malmström, Helena; Vretemark, Maria; Tillmar, Andreas; Durling, Mikael Brandström; Skoglund, Pontus; Gilbert, M. Thomas P.; Willerslev, Eske; Holmlund, Gunilla; Götherström, Anders (2012-01-20). "Finding the founder of Stockholm – A kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy - Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–145. doi:10.1016/j.aanat.2011.03.014. ISSN 0940-9602. PMID 21596538.
  58. ^ The British Invasion Finding Your Roots
  59. ^ a b "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
  60. ^ "FamilyTreeDNA - Lee Surname DNA Research Project (and Leigh, Lea, etc)". www.familytreedna.com. Retrieved 2020-12-10.
  61. ^ "FamilyTreeDNA - I1-S4795". www.familytreedna.com. Retrieved 2020-12-10.
  62. ^ "FamilyTreeDNA - GRIMALDI GENEALOGY PROJECT at FtDNA". www.familytreedna.com. Retrieved 2020-12-11.
  63. ^ "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
  64. ^ Hay, Maciamo (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9 – via ResearchGate.
  65. ^ Maciamo. "Eupedia". Eupedia. Retrieved 2020-12-11.
  66. ^ Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
  67. ^ a b Maciamo. "Eupedia". Eupedia. Retrieved 2020-12-10.
  68. ^ "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
  69. ^ "Swedenborg". Höijen (in Swedish). Retrieved 2020-12-10.
  70. ^ "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
  71. ^ "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
  72. ^ "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  73. ^ olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
  74. ^ "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  75. ^ "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
  76. ^ "FamilyTreeDNA - Morse / Moss DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  77. ^ "Peter Morse's Family Tree". www.geni.com. Retrieved 2020-12-10.
  78. ^ "The Kolokotronis Clan and Family Tree". www.facebook.com. Retrieved 2020-12-10.
  79. ^ "I1: Theodoros Kolokotronis, Θεόδωρος Κολοκοτρώνης". Descendants of haplogroup IJ-M429. 2017-12-26. Retrieved 2020-12-11.
  80. ^ "FamilyTreeDNA - Pine/Pyne Genealogy DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  81. ^ "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
  82. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
  83. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
  84. ^ P30[permanent dead link]
  85. ^ P40[permanent dead link]

Sources[edit]

External links[edit]

Haplogroup I databases
General Y-DNA databases

There are several public access databases featuring I-M253, including:

  1. http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  2. http://www.semargl.me/[permanent dead link]
  3. http://www.ysearch.org/
  4. http://www.yhrd.org/
  5. http://www.yfull.com/tree/I1/
Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F2  F3  GHIJK
G HIJK
IJK H
IJ K
I   J     LT [χ 5]       K2 [χ 6]
L     T    K2a [χ 7]        K2b [χ 8]     K2c     K2d K2e [χ 9]  
K-M2313 [χ 10]     K2b1 [χ 11] P [χ 12]
NO   S [χ 13]  M [χ 14]    P1     P2
N O Q R