Haplogroup Q-M242

From Wikipedia, the free encyclopedia
Jump to navigation Jump to search
Haplogroup Q
Global frequency distribution map of haplogroup Q-M242 (Y-DNA).png
Frequency distribution of haplogroup Q-M242.[1]
Possible time of origin17,200 to 31,700 years ago [2][3][4] (approximately 24,500 years BP)
Possible place of originCentral Asia,[5][6] South Central Siberia[3]
DescendantsQ1 (L232/S432)
Defining mutationsM242 rs8179021
Highest frequenciesKets 93.8%,[7] Indigenous of South America 92%,[8] Turkmens from Karakalpakstan (mainly Yomut) 73%,[9] Selkups 66.4%.,[7] Altaians 63.6%.,[10] Tuvans 62.5%.,[11] Chelkans 60.0%.,[10] Greenlandic Inuit 54%,[12] Tubalar 41%,[10] Siberian Tatars 38%,[13] Other Turkic peoples, Inuit, the indigenous peoples of the Americas, Akha people of northern Thailand, Mon-Khmer people and some tribes of Assam

Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.

Q-M242 is the predominant Y-DNA haplogroup among Native Americans and several peoples of Central Asia and Northern Siberia. It is also the predominant Y-DNA of the Akha tribe in northern Thailand and the Dayak people of Indonesia.


Haplogroup Q-M242 is one of the two branches of P1-M45 also known as K2b2a (The other is R-M207).

Q-M242 is believed to have arisen around the Altai Mountains area (or South Central Siberia),[3] approximately 17,000[3] to 31,700 years ago.[4] However, the matter remains unclear due to limited sample sizes and changing definitions of Haplogroup Q: early definitions used a combination of the SNPs M242, P36.2, and MEH2 as defining mutations.

Technical specification of mutation[edit]

The polymorphism, “M242”, is a C→T transition residing in intron 1 (IVS-866) of the DBY gene and was discovered by Mark Seielstad et al. in 2003. [14] The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc


In Y chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single-nucleotide polymorphisms (SNPs) or unique-event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees[edit]

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The 2015 ISOGG tree[edit]

The subclades of Haplogroup Q-M242 with their defining mutation (s), according to the 2015 ISOGG tree[5] are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The Genomic Research Center draft tree[edit]

Below is a 2012 tree by Thomas Krahn of the Genomic Research Center.[15] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[16]

The Y Chromosome Consortium tree[edit]

This is the 2008 tree produced by the Y Chromosome Consortium (YCC).[17] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[18] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

Phylogenetic variants[edit]

The subclade (under Q-MEH2) proposed by Sharma (2007), which shows polymorphism (ss4bp, rs41352448) at 72,314 position of human arylsulfatase D pseudogene, is not represented in any current trees under Q-MEH2.[19] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.[6]



Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are descendants of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait.[3] These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In North America, two other Q-lineages also have been found. These are Q-P89.1 (under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Regardless, Q-M242 came to dominate the paternal lineages in the Americas.

North America[edit]

In the indigenous people of North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache,[3] 87%[3] in SC Apache,[20] and about 80% in North American Eskimo (Inuit)–Aleut populations. (Q-M3 occupies 46% among Q in North America)[21]

On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he turned out to be genetically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than Native Americans.[22] Today, the frequency of Q runs at 53.7% (122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in east Sermersooq at 82% and the lowest in Qeqqata at 30%.[12]

Q-M242 is estimated to occupy 3.1% of the whole US population in 2010:[23]

Ethnicity Percentage of USA population † Haplogroup Q frequency
White people 63.7% Q-P36* 0.6% & Q-M3 0.1%
Hispanic 16.3% Q-P36* 3.8% & Q-M3 7.9%
Black 12.6% Q-P36* (xM3) 0.2%
Asian 4.8% ~0%
Native American ‡ 0.9% Q-P36* 31.2% & Q-M3 26.9%
Source :[23]

† According to the US National Population Census data (2010)[24]

‡ Mainland and Alaska, not including the Pacific islands

Mesoamerica & South America[edit]

Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.[8] Q-M242 built many ancient cultures and civilizations such as Tiwanaku, Caral(Norte Chico civilization), Maya, Inca, Aztec, and so on.

As a result of five centuries of wide-scale mestizaje between indigenous Americans and European foreigners, today in Mesoamerica and South America the frequencies of Q-M242 (mostly M3) among the whole male population of each country are lower than Tribal/Mayan populations, but nonetheless run far higher than in the population of North America. Also the second most Native American prevalent haplosubclade of R1b(M269) is found in both the American (Indigenous) population and is the most common Y-chromosome haplosubclade among European males (especially those country-origin engaged in Colonization) leads to what may be a Native American male inherited trait to be labeled, incorrectly, as a European one.[25]

The frequencies of Q among the whole male population of each country reach as follow:

Based on the data above, the average frequency in the whole male population of Mesoamerica and South America is estimated to be about 18%. However, extrapolating for the entirety of Latin America would lead to extreme errors as the overall studies sample sizes are far too small nor are they accounting for genetic drift. Further, they're based on the smallest ancient dataset (corpses) in adequate condition available for any race on the planet. To point out, this skews any analysis towards a more European proportion. This also ignores the recent R1b(M269) misattribution.


Q-M242 originated in Asia (Altai regions), and is widely distributed across it.[3] Q-M242 is found in Russia, Siberia (Kets,[7] Selkups, Siberian Yupik people, Nivkhs, Chukchi people,[39] Yukaghirs, Tuvans,[40] Altai people,[10] Koryaks, etc.), Mongolia,[41] China,[42][43] Uyghurs,[41] Tibet,[44] Korea, Japan, Indonesia,[45] Vietnam,[46] Thailand,[47] India,[48] Pakistan,[48] Afghanistan, Iran,[49] Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on. (For details, see below.)

North Asia[edit]

In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study (Dulik 2012),[50] Q-M242 (mostly Q-M346 including some Q-M3) has been found in 24.3% (46/189: 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0% (15/25: all Q-M346), followed by Tubalars at 41% (11/27: 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17% (20/120). In a former study, Q-M242 is found in 4.2% of southern Altaians and 32.0% of northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol (Baygol). The frequency reaches 13.7% (20/146) in the whole samples.[10] In another study,[51] the frequency rises up to 25.8% (23/89: all Q-M346) in Altaians. Based on the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongolia, shows higher frequency of Q-M242. It is found in 14%[52]~38.0% (41/108)[51] of Tuvans. Also, Todjins (Tozhu Tuvans) in eastern Tuva show the frequency at ≤22.2% (8/36 P(xR1)[53])~38.5% (10/26, all Q-M346(xM3)).[51] So, the average frequency of Q-M242 among Tuvans-Todjins in Tuva Republic is about 25%. Haplogroup Q-M242 has been found in 5.9% (3/51) of a sample of Tuvans from the village of Kanasi, 9.8% (5/51) of a sample of Tuvans from the village of Hemu, and 62.5% (30/48) of a sample of Tuvans from the village of Baihaba in northern Xinjiang near the international border with Altai Republic.[11]

In Siberian Tatars, the Ishtyako-Tokuz sub-group of Tobol-Irtysh group has a frequency of Q-M242 at 38%.[13]

The highest frequencies of Q-M242 in Eurasia are witnessed in Kets (central Siberia) at 93.8% (45/48) and in Selkups (north Siberia) at 66.4% (87/131).[7] Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains[3] (Altai-Sayan region). Their populations are currently small in number, being just under 1,500 and 5,000 respectively. In linguistic anthropology, the Ket language is significant as it is currently the only surviving one in the Yeniseian language family which has been linked by some scholars to the Native American Na-Dené languages[54] and, more controversially, the language of the Huns. (See: L. Lieti, E. Pulleybank,[55] E. Vajda,[56] A. Vovin,[57] etc.) Q-M346 is also found at lower rates in Sojots (7.1%, Q-M346), Khakassians (6.3%, Q-M346), Kalmyks (3.4%, Q-M25, Q-M346)[51] and Khanty,[58] and so on.

In far eastern Siberia, Q-M242 is found in 35.3% of Nivkhs (Gilyaks) in the lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Yupik people in Chukotka (Chukchi Peninsula).[39] It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka.[40] It is also found in 15% (Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.[28]

East Asia[edit]

In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346 (mostly Q-L330) occupies 1.4[28]~3.1%[49] of Mongols (1/2~2/3 among Q samples), followed by Q1a1a1-M120 (0.25[28]~1.25%[49]), Q1a1b-M25 (0.25[28]~0.63%[49]), Q1b-M378. In another study, Q is found in 4% of Mongols.[8] Karafet et al. (2018) found Q-L54(xM3) in 2.7% (2/75) and Q-M25 in another 2.7% (2/75) for a total of 5.3% (4/75) haplogroup Q Y-DNA in a sample of Khalkha Mongols from Ulaanbaatar, Mongolia.[59] Based on these studies, the average frequency of Q-M242 in Mongols is estimated to be about 4~5%.

However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China (the provinces of which the capitals locate northern to Huai River-Qin Mountains line). Q-M242 ranged from 4~8% in northwest China (Xinjiang, Gansu, Shaanxi), north China (Shanxi, Hebei), central China (Henan), and upper east China (Shandong) to 3~4% in northeast China. The average frequency of Q-M242 in northern China is around 4.5%. However, it decreases to about 2% in southern China.[42][43] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from east China.[60] In another study published in 2011, Hua Zhong et al. found haplogroup Q-M242 in 3.99% (34/853, including 30/853 Q-M120, 3/853 Q-M346, and 1/853 Q-M25) of a pool of samples of Han Chinese from northern China and 1.71% (15/876, including 14/876 Q-M120 and 1/876 Q-M346) of a pool of samples of Han Chinese from southern China.[61]

Q-M242 has been found with notable frequency in some samples of Uyghurs: 15.38% (22/143, including 6/143 Q-M378, 5/143 Q-P36.2*, 4/143 Q-M120, 4/143 Q-M346, 1/143 Q-M25) of a sample of Uyghurs from the Turpan area (吐鲁番地区),[62] 7.9% (6/76, including 2/76 Q1b1-L215/Page82/S325, 1/76 Q1a2-M346*, 1/76 Q1a1a1-M120, 1/76 Q1a2a1c-L330*, 1/76 Q1a2a1c1-L332) of a sample of Dolan Uyghurs (刀郎人) from Horiqol Township of Awat County,[63] and 7.74% (37/478, including 24/478 Q-M346, 7/478 Q-P36.2*, 5/478 Q-M120) of a sample of Uyghurs from the Hotan area (和田地区).[64] However, other studies have found haplogroup Q in much smaller percentages of Uyghur samples: 3.0% (2/67) Q-P36 Uygur,[65] 1.6% (1/64) Q-M120 Lop Uyghur (罗布人).[63] Haplogroup Q was not observed in a sample of 39 Keriyan Uyghurs (克里雅人) from the village of Darya Boyi, located on the Keriya River deep in the Taklamakan Desert.[63]

Haplogroup Q was observed in 3.2% (5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet in one study[44] and in 1.23% (29/2354) of males in Tibet in another study,[66] but this haplogroup was not observed in a sample of males from Tibet (n=105) in a third study.[65]

It is found in about 1.9% of South Koreans,[67][68][69] showing the highest frequency in Seoul and Gyeonggi Province at 2.7% and decreasing ones to the south (Kim 2010). It has been found in about 0.3% of Japanese[70][65][71][72][73] (with known examples from Shizuoka[65] and Saitama[72]) and in 0.3%[47]~1.2%[74] of Taiwanese.

Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.[75]

Southeast Asia[edit]

Haplogroup Q shows low frequencies in Southeast Asia. In a study,[45] the frequencies of haplogroup Q is 5.4% (2/37) in Indonesia, 3.1% (2/64) in the Philippines, 2.5% (1/40) in Thailand. However, other studies show 0% or near 0% frequencies in those countries.[47]

In the case of Vietnam, the frequency is 7.1% in one study of a sample of Vietnamese reported to be from southern Vietnam[76][77] and 4.3% in a sample of Kinh people from Ho Chi Minh City in southern Vietnam,[73] but 0% or under 1% in other studies in which samples have been collected in Hanoi in northern Vietnam.[45][77][47] So, it is hard to define average frequencies.

Only some regions and ethnic groups in the continent show high frequencies. Q-M242 is found in 2.8% (3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in 18.8% in Ayeyarwady (2/11) and 7.1% Bago (1/14) regions in southwest Myanmar.[78] And, Q-M242 is found in 55.6% (15/27) in the Akha tribe in northern Thailand.[47]

Central Asia[edit]

In Central Asia, the southern regions show higher frequencies of Q than the northern ones.

In the northern regions, Q-M242 is found in about 2%[79]~6%[80][81] (average 4%) of Kazakhs. A study published in 2017 found haplogroup Q Y-DNA in 3.17% (41/1294) of a large pool of samples of Kazakh tribes; however, haplogroup Q was concentrated in the members of the Qangly tribe (27/40 = 67.5%), and it was much less common among the other tribes.[82] The Qangly tribe is related at least in name to the earlier Kankalis and probably also the Kangar union. Haplogroup Q is found in about 2% of Kyrgyz people.[49][80][81]

In the southern regions, Q-M242 is found in 5%[83]~6%[80][81] of Tajiks (Tajikistan). Karafet et al. 2001 found P-DYS257(xQ1b1a1a-M3, R-UTY2), which should be roughly equivalent to haplogroup Q-M242(xM3), in 4/54 = 7.4% of a sample of Uzbeks, apparently sampled in Uzbekistan.[84] Wells et al. 2001 found P-M45(xM120, M124, M3, M173), which should be roughly equivalent to a mix of Q-M242(xM120, M3) and R2-M479(xR2a-M124), in 20/366 = 5.5% of a pool of samples of Uzbeks from seven different regions of Uzbekistan.[80] Di Cristofaro et al. 2013 found Q-M242 in 11/127 = 8.7% of a pool of samples of Uzbeks from three different provinces of Afghanistan, including 5/94 Q-M242(xM120, M25, M346, M378), 4/94 Q-M346, and 1/94 Q-M25 (10/94 = 10.6% Q-M242 total) in a sample of Uzbeks from Jawzjan Province, whose northern border abuts the southeastern corner of Turkmenistan, and 1/28 Q-M242(xM120, M25, M346, M378) in a sample of Uzbeks from Sar-e Pol Province.[49] Wells et al. (2001) found P-M45(xM120, M124, M3, M173) in 10.0% (3/30) of a sample of Turkmens from Turkmenistan, whereas Karafet et al. (2018) found Q-M25 in 50.0% (22/44) of another sample of Turkmens from Turkmenistan, so the frequency of haplogroup Q in that country is not yet clear. However, Grugni et al. (2012) found Q-M242 in 42.6% (29/68) of a sample of Turkmens from Golestan, Iran, and Di Cristofaro et al. (2013) found Q-M25 in 31.1% (23/74) and Q-M346 in 2.7% (2/74) for a total of 33.8% (25/74) Q-M242 in a sample of Turkmens from Jawzjan, Afghanistan, so the frequency of Q-M242 may reach about 40% in Turkmens of Afghanistan and Iran who live in the areas adjacent to Turkmenistan.

Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In another study (Cristofaro 2013) with a larger sampling, the frequency of Q rises to 8.9% (45/507). Haplogroup Q occurs at a frequency of 8% (11/136) in Afghan Pashtuns and 3% (5/142) in Afghan Tajiks[85][86]. In this study(Cristofaro 2013), Turkmens of Jowzjan Province which is neighboring to Turkmenistan show the highest frequency at 33.8% (25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7% (11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[49] .

Southwest Asia[edit]

Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.

Q-M242 accounts for 5.5% (52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples (52) in the study consist of various subclades such as Q* (3), Q-M120 (1), Q-M25 (30), Q-M346 (8), Q-M378 (10). The highest frequency is at 42.6% (29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan (Persian people), 6.8% in Khorasan (Persian people), 6% in Lorestan (Luristan, Lurs), 4.9% in Azarbaijan Gharbi (5.1% of Assyrians and 4.8% of Azeris), 4.5% in Fars (Persian people), and so on.[87] Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[88][89][90]

In a study (Zahery 2011), the frequency of Q is 1.9% (3/154: all Q-M378) in Iraqis (x Marsh Arabs), and 2.8% (4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.[91][92]

Approximately 2.5% (4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8% (3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8% (1/121: Q*) in Oman peoples.[93][94]

Haplogroup Q-M242 has also been found in 1.1% (1/87, Q-P36) Syrians[76] and 2.0% (18/914, 14 Q*, 4 Q-M25) in Lebanese.[95]

Approximately 2% (10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q.[96] In a study (Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe (one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[97]

South Asia[edit]

In Pakistan at the eastern end of the Iranian Plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[98]~3.4% (6/176).[99]

In a study (Sharma2007), Q-M242 is observed in 2.38% (15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel (Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies (Sengupta 2006, Seielstad 2003). And, the accumulated result (frequency) of 3 studies is turned out to be 1.3% (21/1615), with 11 out of 21 Q samples.[6] (For more information, see Y-DNA haplogroups in populations of South Asia)

In a regional study in Gujarat (Western India), Q-M242 was found at its highest 12% (3/25) among Nana Chaudharis while the overall percentage in Gujarat was found to be 2.8% (8/284).[100] In another study, 2.6% of Tharus in Chitwan district and 6.1% (3/49) of Hindus in New Delhi, the capital of India were found to be Q-M242 positive.[101]

In a study in which Q-M242 is just classified in P* group, P* (x R1, R2) accounts for 9.7% (23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in three ethnic groups of Bangladesh.[102] In many cases, all or most of P* (x R1, R2) means Q-M242, and thus most of P* (9.7%) samples in that study can be estimated to be Q-M242.

1.2% of Nepalese people in Kathmandu, the capital of Nepal and 3.2% of people from Tibet are in Q-M242.[44]

3.3% of Sri Lankans[76] are also in Q-M242.


Q-M242 is distributed across most European countries at low frequencies, and the frequencies decrease to the west and to the south.

Central- and Eastern Europe[edit]

In Central- Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians,[103] 1.5% of Belarusians,[104] 1.3% of Ukrainians[citation needed] 1.3% of Poles (Poland),[105] 2% of Czechs,[106] 1.5% of Slovaks,[107] about 2.2% of Hungarians,[108][109] 1.2% of Romanians,[110] 0.8% of Moldovans,[111] and 0.5% (4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians[112] On the other hand, 3.1% of Székelys from Transylvania (who have claimed to be descendants of Attila’s Huns) turned out to be P* (xR1-M173),[113] which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Székelys (Szeklers) reaches 4.3%.[114][115]

The Caucasus region shows a frequency at 1.2% in a study,[89] but it may reach over 4% in Azerbaijan, in that 4.9% of the neighboring Iranian Azerbaijanis harbor Q-M242.[88] It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378 (L245), Q-M346, and Q-M25.[116]

Northern Europe[edit]

In Northern Europe, haplogroup Q comprises about 2.5% of males. According to the Swedish Haplogroup Database, 4.1% (27/664, as of Jan 2016) of Swedish males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. By county, they are distributed intensively in the southern region (Götaland,: not to be confused with Gotland), and rarely to the north. If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

In Norway, Q-M242 is found in about 2.6% (~4%[117]) of males, with Q-L804 being more common than Q-F1161/L527.[118] It is observed among 1.6% of males in Denmark, 3% in the Faroe Islands (known to be related to Vikings).[119] In an article (Helgason et al.) on the haplotypes of Icelanders, 7.2% (13/181) of males in Iceland are labelled as R1b-Branch A, but they are actually Q-M242.[117][120] On the other hand, it is 0.2% in Finland,[121] 4.6% in Latvia,[122] 1.1% in Lithuania,[123] 0.5% in Estonia.

Western Europe[edit]

In Western Europe, Q-M242 is observed at very low frequencies, around 0.5% in most of the countries, such as Germany, France, United Kingdom, etc., but some regions show a little higher. It is 2.1% in Switzerland,[124] and it reaches 5.1% in Lyon (Rhône-Alpes) region of France.[125] It is about 4% in Shetland of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland (also in some areas of Scandinavia, Faroe Islands, Iceland, and the Great United Kingdom) has turned out to be generically closely linked to the Q-M242 in Central Asia, . Also, Shetland (Norse) Q-M242 is revealed to be linked to some Q-M242 of Azeris (Azerbaijan).[117]

Southern Europe[edit]

Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3% (13/91) in Hvar Islands and 6.1% (8/132) in Korčula.[125] Also, it is about 0.6% in Italy, but it rises to 2.5% (6/236) in Sicily, where it reaches 16.7% (3/18) in Mazara del Vallo region, followed by 7.1% (2/28) in Ragusa, 3.6% in Sciacca,[126] and 3.7% in Belvedere Marittimo.[127]

On the other hand, according to a study (Behar 2004), 5.2% (23/441) of Ashkenazi Jewish males belong to haplogroup Q-P36.[128] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3% (4/174)[129]~5.6% (3/53)[130] of Sephardi Jews are in haplogroup Q.


Haplogroup Q is rarely found across North Africa. It is observed in 0.7% (1/147),[94] of Egyptians and in 0.6% (1/156)[89] of Algerian people. Surprisingly, it is also witnessed in 0.8% (3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

Subclade distribution[edit]

Y-DNA Q samples from ancient sites[edit]

  • South Central Siberia (near Altai)
  • North America
  • Altai (West Mongolia)
    • Tsagaan Asga and Takhilgat Uzuur-5 Kurgan sites, westernmost Mongolian Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93 (B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54 (period unknown), 1 Q-M242 (B.C. 28C), 1 C-M130 (B.C. 10C)[149]
  • Greenland
  • China
    • Hengbei site (Peng kingdom cemetery of Western Zhou period), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[151]
      • In another paper, the social status of those human remains of ancient Peng kingdom(倗国) are analyzed. aristocrats: 3 Q1a1 (prostrate 2, supine 1), 2 O3a (supine 2), 1 N (prostrate) / commoners : 8 Q1a1 (prostrate 4, supine 4), 3 O3a (prostrate 1, supine 2), 3 O* (supine 3) / slaves: 3 O3a, 2 O2a, 1 O*[152]
      • (cf) Pengbo (倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
    • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120[151] (with a lot of animal bones and bronze swords and other weapons, etc.)
    • Heigouliang, Xinjiang, 2200YBP: 6 Q1a* (not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q* (not Q1a, not Q1b: unable to determine subclades):[153]
      • In a paper (Lihongjie 2012), the author analyzed the Y-DNAs of the ancient male samples from the 2nd or 1st century BCE cemetery at Heigouliang in Xinjiang – which is also believed to be the site of a summer palace for Xiongnu kings – which is east of the Barkol basin and near the city of Hami. The Y-DNA of 12 men excavated from the site belonged to Q-MEH2 (Q1a) or Q-M378 (Q1b). The Q-M378 men among them were regarded as hosts of the tombs; half of the Q-MEH2 men appeared to be hosts and the other half as sacrificial victims.
    • Xiongnu site in Barkol, Xinjiang, all 3 Q-M3
      • In L. L. Kang et al. (2013), three samples from a Xiongnu) site in Barkol, Xinjiang were found to be Q-M3 (Q1a2a1a1). And, as Q-M3 is mostly found in Yeniseians and Native Americans, the authors suggest that the Xiongnu had connections to speakers of the Yeniseian languages.[154][155] These discoveries from the above papers (Li 2012, Kang et al., 2013) have some positive implications on the not as yet clearly verified theory that the Xiongnu were precursors of the Huns.
    • Mongolian noble burials in the Yuan dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q (not analysed subclade, the principal occupant Gaodangwang Korguz (高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)[156]
      • (cf) Korguz was a son of a princess of Kublai Khan (元 世祖), and was the king of the Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son. (Do not confuse this man with the Uyghur governor, Korguz who died in 1242.) The Ongud tribe (汪古部) was a descendant of the Shatuo tribe (沙陀族) which was a tribe of Göktürks (Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building three dynasties. His two queens were all princesses of the Yuan dynasty (Kublai Khan's granddaughters). It was very important for the Yuan dynasty to maintain a marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of the Yuan dynasty married kings of the Ongud tribe.

See also[edit]


Y-DNA Q-M242 subclades[edit]

Y-DNA backbone tree[edit]

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
F1  F2  F3  GHIJK
I   J     LT [χ 5]       K2 [χ 6]
L     T    K2a [χ 7]        K2b [χ 8]     K2c     K2d K2e [χ 9]  
K-M2313 [χ 10]     K2b1 [χ 11] P [χ 12]
NO   S [χ 13]  M [χ 14]    P1     P2


  1. ^ Balanovsky O, Gurianov V, Zaporozhchenko V, Balaganskaya O, Urasin V, Zhabagin M; et al. (2017). "Phylogeography of human Y-chromosome haplogroup Q3-L275 from an academic/citizen science collaboration". BMC Evol Biol. 17 (Suppl 1): 18. doi:10.1186/s12862-016-0870-2. PMC 5333174. PMID 28251872.CS1 maint: multiple names: authors list (link)
  2. ^ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (PDF). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  3. ^ a b c d e f g h i Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.
  4. ^ a b YFull YTree v4.02
  5. ^ a b Y-DNA Haplogroup Q and its Subclades - 2016
  6. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7 (1): 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.
  7. ^ a b c d Karafet, T. M. (2002). "High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life". Human Biology. 74 (6): 761–789. doi:10.1353/hub.2003.0006. PMID 12617488. S2CID 9443804.
  8. ^ a b c d Bortolini, Maria-Catira; Salzano, Francisco M.; Thomas, Mark G.; Stuart, Steven; Nasanen, Selja P.K.; Bau, Claiton H.D.; Hutz, Mara H.; Layrisse, Zulay; et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–539. doi:10.1086/377588. PMC 1180678. PMID 12900798.
  9. ^ https://www.researchgate.net/publication/310645015_Gene_pool_of_Turkmens_from_Karakalpakstan_in_their_Central_Asian_context_Y-chromosome_polymorphism[full citation needed]
  10. ^ a b c d e Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups". Genetika. 43 (5): 675–687. doi:10.1134/S1022795407050110. PMID 17633562. S2CID 566825.
  11. ^ a b Yong-Ke, Zhang; Zheng, Chen; An, FAN; et al. (2009). "Genetic relationships between Tuva population and the neighboring populations in the Altai Region of Xinjiang Uygur Autonomous Region". Hereditas. 31 (8): 818–824. doi:10.3724/SP.J.1005.2009.00818. PMID 19689942.
  12. ^ a b Katharina Olofsson, Jill; et al. (2015). "Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders". PLOS ONE. 10 (1): e0116573. Bibcode:2015PLoSO..1016573O. doi:10.1371/journal.pone.0116573. PMC 4312058. PMID 25635810.
  13. ^ a b Пять генофондов пяти субэтносов сибирских татар
  14. ^ Seielstad, Mark; Yuldasheva, Nadira; Singh, Nadia; Underhill, Peter; Oefner, Peter; Shen, Peidong; Wells, R. Spencer (2003). "A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas". The American Journal of Human Genetics. 73 (3): 700–705. doi:10.1086/377589. ISSN 0002-9297. PMC 1180698. PMID 12929085.
  15. ^ Proposed Tree Archived 2011-07-11 at the Wayback Machine
  16. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Archived from the original on 2015-08-15. Retrieved 2012. Check date values in: |access-date= (help)
  17. ^ Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  18. ^ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  19. ^ That is because it is a value for the STR DYS435 with a value of 8--> 9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
  20. ^ Malhi, RS; Gonzalez-Oliver, A; Schroeder, KB; Kemp, BM; Greenberg, JA; Dobrowski, SZ; Smith, DG; Resendez, A; Karafet, T; Hammer, M; Zegura, S; Brovko, T (2008). "Distribution of Y chromosomes among native North Americans: a study of Athapaskan population history". Am. J. Phys. Anthropol. 137 (4): 412–24. doi:10.1002/ajpa.20883. PMC 2584155. PMID 18618732.
  21. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Archived from the original on 2009-11-04. Retrieved 2010-01-30.
  22. ^ a b Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; et al. (February 2010). "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature. 463 (7282): 757–762. Bibcode:2010Natur.463..757R. doi:10.1038/nature08835. PMC 3951495. PMID 20148029.
  23. ^ a b Hammer; et al. (Dec 2006). "Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases". Forensic Sci. Int. 164 (1): 45–55. doi:10.1016/j.forsciint.2005.11.013. PMID 16337103.
  24. ^ Population Estimates Archived 2014-12-18 at the Wayback Machine
  25. ^ Haak, Wolfgang; Lazaridis, Iosif; Patterson, Nick; Rohland, Nadin; Mallick, Swapan; Llamas, Bastien; Brandt, Guido; Nordenfelt, Susanne; Harney, Eadaoin; Stewardson, Kristin; Fu, Qiaomei; Mittnik, Alissa; Bánffy, Eszter; Economou, Christos; Francken, Michael; Friederich, Susanne; Pena, Rafael Garrido; Hallgren, Fredrik; Khartanovich, Valery; Khokhlov, Aleksandr; Kunst, Michael; Kuznetsov, Pavel; Meller, Harald; Mochalov, Oleg; Moiseyev, Vayacheslav; Nicklisch, Nicole; Pichler, Sandra L.; Risch, Roberto; Rojo Guerra, Manuel A.; Roth, Christina; Szécsényi-Nagy, Anna; Wahl, Joachim; Meyer, Matthias; Krause, Johannes; Brown, Dorcas; Anthony, David; Cooper, Alan; Alt, Kurt Werner; Reich, David (11 June 2015). "Massive migration from the steppe was a source for Indo-Europeanlanguages in Europe". Nature. 522 (7555): 207–211. arXiv:1502.02783. Bibcode:2015Natur.522..207H. doi:10.1038/nature14317. PMC 5048219. PMID 25731166.
  26. ^ Vullo, Carlos; et al. (2014). "Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations". Int J Legal Med. 129 (4): 673–680. doi:10.1007/s00414-014-1025-x. PMID 24878616. S2CID 2906322.
  27. ^ Söchtig, Jens; et al. (2015). "Genomic insights on the ethno-history of the Maya and the 'Ladinos' from Guatemala". BMC Genomics. 16: 131. doi:10.1186/s12864-015-1339-1. PMC 4422311. PMID 25887241. => Guatemala population consists of about 40% Tribal Natives (Mayans)+60% Native (Spanish Speaking). According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%
  28. ^ a b c d e f g h i Battaglia; et al. (2013). "The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q". PLOS ONE. 8 (8): e71390. Bibcode:2013PLoSO...871390B. doi:10.1371/journal.pone.0071390. PMC 3749222. PMID 23990949.
  29. ^ Gaviria, A.; et al. (2013). "Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population". Forensic Sci. Int. Genet. Suppl. 4 (1): e310–e311. doi:10.1016/j.fsigss.2013.10.158.
  30. ^ Martínez-Cortés, G; et al. (2012). "Admixture and population structure in Mexican-Mestizos based on paternal lineages". J. Hum. Genet. 57 (9): 568–74. doi:10.1038/jhg.2012.67. PMID 22832385.
  31. ^ Lovo-Gómez, J; et al. (Sep 2007). "The genetic male legacy from El Salvador". Forensic Sci. Int. 171 (2–3): 198–203. doi:10.1016/j.forsciint.2006.07.005. PMID 16916590.
  32. ^ Grugni (2015). "Exploring the Y Chromosomal Ancestry of Modern Panamanians". PLOS ONE. 10 (12): e0144223. Bibcode:2015PLoSO..1044223G. doi:10.1371/journal.pone.0144223. PMC 4670172. PMID 26636572.
  33. ^ Rojas, Win; et al. (2010). "Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers". American Journal of Physical Anthropology. 143 (1): 13–20. doi:10.1002/ajpa.21270. PMID 20734436.=> (DANE, 2006) 86% of the whole Colombian population self-reported as of Mixed Ancestary, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12% (114/954) of MA, 95.7% (135/141) of NA, and 23.8% (5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
  34. ^ Núñez, Carolina; et al. (2012). "Y chromosome haplogroup diversity in a Mestizo population of Nicaragua". Forensic Sci. Int. Genet. 6 (6): e192–e195. doi:10.1016/j.fsigen.2012.06.011. PMID 22770600. The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
  35. ^ Corach, Daniel; et al. (2010). "Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA". Annals of Human Genetics. 74 (1): 65–76. doi:10.1111/j.1469-1809.2009.00556.x. PMID 20059473. S2CID 5908692.
  36. ^ Ramallo; et al. (Dec 2009). "Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina". Forensic Science International: Genetics Supplement Series. 2 (1): 431–432. doi:10.1016/j.fsigss.2009.08.047.
  37. ^ Villalta, M.; Rodriguez, A.; González, L.; Arce, V.; Arrieta, G.; Morales, A.; Gusmão, L.; Espinoza, M. (August 2008). "Haplotype data for 12 Y-chromosome STR loci from Costa Rica". Forensic Science International: Genetics Supplement Series. 1 (1): 252–254. doi:10.1016/j.fsigss.2007.10.101.
  38. ^ Palha, T.; et al. (2012). "Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes". PLOS ONE. 7 (7): e40007. Bibcode:2012PLoSO...740007P. doi:10.1371/journal.pone.0040007. PMC 3393733. PMID 22808085.=> about 80 out of 2,024 (3.95%) samples in the paper collected from all the regions of Brazil can be classified as Y-DNA Q.
  39. ^ a b Jeffrey, T.; et al. (Jan 2002). "The Dual Origin and Siberian Affinities of Native American Y Chromosomes". The American Journal of Human Genetics. 70 (1): 192–206. doi:10.1086/338457. PMC 384887. PMID 11731934. The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2 (distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242 (xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
  40. ^ a b Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541. S2CID 31651899.
  41. ^ a b Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  42. ^ a b c Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. Bibcode:2004Natur.431..302W. doi:10.1038/nature02878. PMID 15372031. S2CID 4301581. Supplementary Table 2: NRY haplogroup distribution in Han populations
  43. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912. S2CID 36788262.
  44. ^ a b c d e Gayden, Tenzin; et al. (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". The American Journal of Human Genetics. 80 (5): 884–894. doi:10.1086/516757. PMC 1852741. PMID 17436243.
  45. ^ a b c Kim, Soon-Hee; et al. (2011). "High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea". Investigative Genetics. 2 (1): 10. doi:10.1186/2041-2223-2-10. PMC 3087676. PMID 21463511.
  46. ^ a b Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; et al. (2010). "Major East–West Division Underlies Y Chromosome Stratification across Indonesia". Mol. Biol. Evol. 27 (8): 1833–1844. doi:10.1093/molbev/msq063. PMID 20207712.
  47. ^ a b c d e Trejaut, J.A. (2014). "Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia". BMC Genetics. 15: 77. doi:10.1186/1471-2156-15-77. PMC 4083334. PMID 24965575.
  48. ^ a b c "The Y Chromosome Consortium 2008". Archived from the original on 2008-09-22. Retrieved 2010-07-17.
  49. ^ a b c d e f g Cristofaro; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  50. ^ Dulik, M C (Feb 2012). "Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian". The American Journal of Human Genetics. 90 (2): 229–246. doi:10.1016/j.ajhg.2011.12.014. PMC 3276666. PMID 22281367.
  51. ^ a b c d Malyarchuk, Boris; et al. (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–588. doi:10.1038/jhg.2011.64. PMID 21677663.
  52. ^ KHARKOV, Vladimir Nikolaevich, "СТРУКТУРА И ФИЛОГЕОГРАФИЯ ГЕНОФОНДА КОРЕННОГО НАСЕЛЕНИЯ СИБИРИ ПО МАРКЕРАМ Y-ХРОМОСОМЫ," Genetika 03.02.07 and "АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора биологических наук," Tomsk 2012
  53. ^ Derenko, Miroslava; Malyarchuk, Boris; Denisova, Galina A.; et al. (2006). "Contrasting patterns of Y-chromosome variation in South Siberian populations from Baikal and Altai-Sayan regions". Hum Genet. 118 (5): 591–604. doi:10.1007/s00439-005-0076-y. PMID 16261343. S2CID 23011845.
  54. ^ E. J. VAJDA, "Siberian Link with Na-Dene Languages." The Dene–Yeniseian Connection, ed. by J. Kari and B. Potter(2010), pp.33–99, Anthropological Papers of the University of Alaska, new series, vol. 5(2010), Fairbanks: University of Alaska Fairbanks, Department of Anthropology
  55. ^ E. G. Pulleyblank, "The consonontal system of old Chinese" [Pt 1], Asia Major, vol. IX (1962), pp. 1–2
  56. ^ E. J. Vajda, Yeniseian Peoples and Languages: A History of Yeniseian Studies with an Annotated Bibliography and a Source Guide (2013, Oxford/New York, Routledge) pp.103-106, etc.
  57. ^ "Did the Xiong-nu speak a Yeniseian language?". Central Asiatic Journal. 44 (1): 87–104. 2000.
  58. ^ Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.
  59. ^ Karafet, Tatiana M.; Osipova, Ludmila P.; Savina, Olga V.; et al. (2018). "Siberian genetic diversity reveals complex origins of the Samoyedic-speaking populations". American Journal of Human Biology. 30 (6): e23194. doi:10.1002/ajhb.23194. PMID 30408262.
  60. ^ Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics. 19 (9): 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364. PMID 21505448.
  61. ^ Zhong, Hua; Shi, Hong; Qi, Xue-Bin; Duan, Zi-Yuan; Tan, Ping-Ping; Jin, Li; Su, Bing; Ma, Runlin Z. (2011). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Mol. Biol. Evol. 28 (1): 717–727. doi:10.1093/molbev/msq247. PMID 20837606.
  62. ^ Lu Yan (2011), "Genetic Mixture of Populations in Western China." Shanghai: Fudan University, 2011: 1-84. (Doctoral dissertation in Chinese: 陆艳, “中国西部人群的遗传混合”, 上海:复旦大学,2011: 1-84.)
  63. ^ a b c LIU Shuhu, NIZAM Yilihamu, RABIYAMU Bake, ABDUKERAM Bupatima, and DOLKUN Matyusup, "A study of genetic diversity of three isolated populations in Xinjiang using Y-SNP." Acta Anthropologica Sinica, 2018, 37(1): 146-156.
  64. ^ Shan; et al. (Sep 2014). "Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China". Int J Legal Med. 128 (5): 743–4. doi:10.1007/s00414-013-0948-y. PMID 24398978. S2CID 23248209.
  65. ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; et al. (2006). "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  66. ^ Qi, Xuebin; Cui, Chaoying; Peng, Yi; et al. (2013). "Genetic Evidence of Paleolithic Colonization and Neolithic Expansion of Modern Humans on the Tibetan Plateau". Mol. Biol. Evol. 30 (8): 1761–1778. doi:10.1093/molbev/mst093. PMID 23682168.
  67. ^ Kim, Soon-Hee; et al. (Nov 2010). "'Y chromosome homogeneity in the Korean population". Int J Legal Med. 124 (6): 653–7. doi:10.1007/s00414-010-0501-1. PMID 20714743. S2CID 27125545.
  68. ^ Jin Park, Myung; et al. (2012). "Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses". International Journal of Legal Medicine. 126 (4): 589–599. doi:10.1007/s00414-012-0703-9. PMID 22569803. S2CID 27644576.
  69. ^ The frequencies of Q-M242 shown in both studies (Kim2010, Park2012) are 1.4% (7/506, Kim) and 1.8% (13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87% (Kim) and 1.91% (Park) respectively, converging to 1.9%.
  70. ^ Peter A. Underhill, Peidong Shen, Alice A. Lin, et al. (2000), "Y chromosome sequence variation and the history of human populations." Nature Genetics, Volume 26, November 2000.
  71. ^ Yali Xue, Tatiana Zerjal, Weidong Bao, et al. (2006), "Male Demography in East Asia: A North–South Contrast in Human Population Expansion Times." Genetics 172: 2431–2439 (April 2006).
  72. ^ a b c Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms" (PDF). Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. hdl:10130/491. PMID 17274803. S2CID 1041367.
  73. ^ a b c d Poznik, G. David; Xue, Yali; Mendez, Fernando L.; et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–599. doi:10.1038/ng.3559. PMC 4884158. PMID 27111036.
  74. ^ a b Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLOS ONE. 9 (8): e103772. Bibcode:2014PLoSO...9j3772W. doi:10.1371/journal.pone.0103772. PMC 4121179. PMID 25090432.
  75. ^ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano
  76. ^ a b c Karafet, TM; et al. (Feb 2005). "Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders". Hum. Biol. 77 (1): 93–114. doi:10.1353/hub.2005.0030. hdl:1808/13586. PMID 16114819. S2CID 7953854.
  77. ^ a b He, J-D; Peng, M-S; Quang, HH; Dang, KP; Trieu, AV; et al. (2012). "Patrilineal Perspective on the Austronesian Diffusion in Mainland Southeast Asia". PLOS ONE. 7 (5): e36437. Bibcode:2012PLoSO...736437H. doi:10.1371/journal.pone.0036437. PMC 3346718. PMID 22586471.
  78. ^ Peng, Min-Sheng; et al. (Aug 2014). "Retrieving Y chromosomal haplogroup trees using GWAS data". Eur J Hum Genet. 22 (8): 1046–1050. doi:10.1038/ejhg.2013.272. PMC 4350590. PMID 24281365.
  79. ^ Turspekov; et al. (2012). "The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs". The Russian Journal of Genetic Genealogy. 2: 1.
  80. ^ a b c d e f Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. Bibcode:2001PNAS...9810244W. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region
  81. ^ a b c Seielstad, Mark; et al. (Sep 2003). "A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas". The American Journal of Human Genetics. 73 (3): 700–705. doi:10.1086/377589. PMC 1180698. PMID 12929085.
  82. ^ E. E. Ashirbekov, D. M. Botbaev, A. M. Belkozhaev, A. O. Abayldaev, A. S. Neupokoeva, J. E. Mukhataev, B. Alzhanuly, D. A. Sharafutdinova, D. D. Mukushkina, M. B. Rakhymgozhin, A. K. Khanseitova, S. A. Limborska, and N. A. Aytkhozhina, "Distribution of Y-Chromosome Haplogroups of the Kazakh from the South Kazakhstan, Zhambyl, and Almaty Regions." Reports of the National Academy of Sciences of the Republic of Kazakhstan, ISSN 2224-5227, Volume 6, Number 316 (2017), 85 - 95.
  83. ^ Malyarchuk, B; et al. (Jan 2013). "Y-chromosome variation in Tajiks and Iranians". Ann. Hum. Biol. 40 (1): 48–54. doi:10.3109/03014460.2012.747628. PMID 23198991. S2CID 2752490.
  84. ^ Karafet; et al. (Sep 2001). "Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes". The American Journal of Human Genetics. 69 (3): 615–628. doi:10.1086/323299. PMC 1235490. PMID 11481588.
  85. ^ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3314501/
  86. ^ https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0076748#s2
  87. ^ a b Grugni, Viola; et al. (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7 (7): e41252. Bibcode:2012PLoSO...741252G. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.
  88. ^ a b Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration". Human Heredity. 61 (3): 132–143. doi:10.1159/000093774. PMID 16770078. S2CID 7017701.
  89. ^ a b c Bekada, Asmahan; et al. (2013). "Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape". PLOS ONE. 8 (2): e56775. Bibcode:2013PLoSO...856775B. doi:10.1371/journal.pone.0056775. PMC 3576335. PMID 23431392.
  90. ^ The frequency of Q is 4% (6/150, all Q-M25) in Regueiro 2006, in which it is 9.1% (3/33) in north Iran and 2.6% (3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2% (35/566) in Bekada 2013 with a large-scale sampling.
  91. ^ Al-Zahery, Nadia; et al. (2011). "In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq". BMC Evolutionary Biology. 11: 288. doi:10.1186/1471-2148-11-288. PMC 3215667. PMID 21970613.
  92. ^ According to scholars, early Sumerians called themselves 'black-headed people', and spoke an agglutinative language with the word order of SOV, which was quite different from common Semitic or Indo-European languages. Among Semitic languages, only Akkadian had SOV word order, which is due to the influence of the Sumerian language.(For more information, see Sumer, Sumerian Language, Akkadian language, and so on.) On the other hand, surprisingly, some ancient writings found in Bolivia such as Pokotia Monolith, have been interpreted with the Proto-Sumerian language. http://www.faculty.ucr.edu/~legneref/biados/texts/WintersPokotia.htm
  93. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
  94. ^ a b c Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.
  95. ^ Zalloua PA, Xue Y, Khalife J, et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  96. ^ a b Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. S2CID 10763736.
  97. ^ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.
  98. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
  99. ^ a b c d e Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230. PMID 16400607.
  100. ^ Khurana, P; et al. (2014). "Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India". PLOS ONE. 9 (3): e90414. Bibcode:2014PLoSO...990414K. doi:10.1371/journal.pone.0090414. PMC 3948632. PMID 24614885.
  101. ^ Fornarino, Simona; et al. (2009). "Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation". BMC Evol. Biol. 9: 154. doi:10.1186/1471-2148-9-154. PMC 2720951. PMID 19573232.
  102. ^ Nahar Gazi, Nurun; et al. (2013). "Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal". PLOS ONE. 8 (10): e75064. Bibcode:2013PLoSO...875064G. doi:10.1371/journal.pone.0075064. PMC 3794028. PMID 24130682.
  103. ^ Malyarchuk, B. A.; et al. (2008). "Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution". Russian Journal of Genetics. 44 (2): 187–192. doi:10.1134/S1022795408020105. S2CID 28165493.
  104. ^ Khar'kov, VN; et al. (Aug 2005). "Frequencies of Y chromosome binary haplogroups in Belarussians". Genetika. 41 (8): 1132–6. doi:10.1007/s11177-005-0182-x. PMID 16161635. S2CID 1357824.
  105. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  106. ^ Ehler, Edvard; et al. (Jun 2011). "Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe". Croat Med J. 52 (3): 358–367. doi:10.3325/cmj.2011.52.358. PMC 3131682. PMID 21674832.
  107. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  108. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  109. ^ Kristiina, Tambets. The Western; Eastern; et al. (Apr 2004). "Outliers" Told by Mitochondrial DNA and Y Chromosomes". The American Journal of Human Genetics. 74 (4): 661–682. doi:10.1086/383203. PMC 1181943. PMID 15024688.
  110. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  111. ^ Varzari, Alexander; et al. (2013). "Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome". PLOS ONE. 8 (1): e53731. Bibcode:2013PLoSO...853731V. doi:10.1371/journal.pone.0053731. PMC 3547065. PMID 23341985.
  112. ^ Karachanak, Sena; et al. (2013). "Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry". PLOS ONE. 8 (3): e56779. Bibcode:2013PLoSO...856779K. doi:10.1371/journal.pone.0056779. PMC 3590186. PMID 23483890.
  113. ^ Csányi, B.; et al. (July 2008). "Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin". Annals of Human Genetics. 72 (4): 519–534. doi:10.1111/j.1469-1809.2008.00440.x. PMID 18373723. S2CID 13217908.
  114. ^ Hungarian Bukovina
  115. ^ Q-L712 Subclades of haplogroup Q-M25: Q-L712, Q-L715, Q-L713, Q-YP789
  116. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  117. ^ a b c David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf
  118. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  119. ^ Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
  120. ^ Shetland Islands Haplogroups R1a & Q
  121. ^ "Family Tree DNA - Genetic Testing for Ancestry, Family History & Genealogy".
  122. ^ "Family Tree DNA - My FamilyTree DNA Latvia Project Website".
  123. ^ "Family Tree DNA - LITHUANIAN DNA".
  124. ^ "Family Tree DNA - Switzerland DNA Project".
  125. ^ a b Wiik, Kalevi (2008). "Where did European Men Come From?". Journal of Genetic Genealogy. 4: 35–85.
  126. ^ Di Gaetano, Cornelia; et al. (Jan 2009). "Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome". Eur J Hum Genet. 17 (1): 91–99. doi:10.1038/ejhg.2008.120. PMC 2985948. PMID 18685561.
  127. ^ Brisighelli, F (2012). "Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage". PLOS ONE. 7 (12): e50794. Bibcode:2012PLoSO...750794B. doi:10.1371/journal.pone.0050794. PMC 3519480. PMID 23251386. In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P* (xR1).
  128. ^ a b Behar, DM; et al. (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Hum Genet. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294. S2CID 10310338.
  129. ^ Adams, Susan M.; et al. (Dec 2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". The American Journal of Human Genetics. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.
  130. ^ Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10
  131. ^ Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLOS ONE. 7 (3): e34288. Bibcode:2012PLoSO...734288H. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.
  132. ^ Ghiani, ME; Moral, P; Mitchell, RJ; Hernández, M; García-Moro, C; Vona, G (2006). "Y-chromosome-Specific STR haplotype data on the Rapanui population (Easter Island)". Hum Biol. 78 (5): 565–78. doi:10.1353/hub.2007.0005. PMID 17506287. S2CID 33311525.
  133. ^ Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLOS ONE. 7 (7): e41252. Bibcode:2012PLoSO...741252G. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.
  134. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
  135. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Khoyt, Sanj; Woźniak, Marcin; Grzybowski, Tomasz; Zakharov, Ilya (2013). "Y-chromosome diversity in the Kalmyks at the ethnical and tribal levels". Journal of Human Genetics. 58 (12): 804–811. doi:10.1038/jhg.2013.108. PMID 24132124.
  136. ^ a b c d e f g Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10): e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  137. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLOS ONE. 6 (8): e24282. Bibcode:2011PLoSO...624282C. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623.
  138. ^ Hallast, Pille; Batini, Chiara; Zadik, Daniel; et al. (2014). "The Y-Chromosome Tree Bursts into Leaf: 13,000 High-Confidence SNPs Covering the Majority of Known Clades". Molecular Biology and Evolution. 32 (3): 661–673. doi:10.1093/molbev/msu327. PMC 4327154. PMID 25468874.
  139. ^ Monika Karmin, Lauri Saag, Mário Vicente, et al. (2015), "A recent bottleneck of Y chromosome diversity coincides with a global change in culture." Genome Research 25:1–8. Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org.
  140. ^ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  141. ^ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Archived from the original on 2010-06-22. Retrieved 2009-11-21.
  142. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. S2CID 1571356. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  143. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
  144. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". The American Journal of Human Genetics. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.
  145. ^ YFull - Experimental Y Tree, Y-SNP calls for Afontova Gora 2, Afantova had haplogroup Q1a1 and some type of R derived mtdna.
  146. ^ Rasmussen, M.; Anzick, S.; et al. (February 2014). "The genome of a Late Pleistocene human from a Clovis burial site in western Montana". Nature. 506 (7487): 225–229. Bibcode:2014Natur.506..225R. doi:10.1038/nature13025. PMC 4878442. PMID 24522598.
  147. ^ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  148. ^ Rasmussen, Morten; Sikora, Martin; Albrechtsen, Anders; Korneliussen, Thorfinn Sand; Moreno-Mayar, J. Víctor; Poznik, G. David; Zollikofer, Christoph P. E.; Ponce De León, Marcia S.; Allentoft, Morten E.; Moltke, Ida; Jónsson, Hákon; Valdiosera, Cristina; Malhi, Ripan S.; Orlando, Ludovic; Bustamante, Carlos D.; Stafford, Thomas W.; Meltzer, David J.; Nielsen, Rasmus; Willerslev, Eske (2015). "The ancestry and affiliations of Kennewick Man". Nature. 523 (7561): 455–458. Bibcode:2015Natur.523..455R. doi:10.1038/nature14625. PMC 4878456. PMID 26087396.
  149. ^ Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
  150. ^ "Q-YP1500 YTree".
  151. ^ a b On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  152. ^ Yong-Bin Zhao et al., Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixture into the Han Chinese 3,000 years ago, American Journal of Human Biology (Aug 2014).
  153. ^ Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  154. ^ L. L. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families (2013)
  155. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  156. ^ Qui, Y; et al. (2015). "Identification of kinship and occupant status in Mongolian noble burials of the Yuan dynasty through a multidisciplinary approach". Phil. Trans. R. Soc. B370 (1660): 20130378. doi:10.1098/rstb.2013.0378. PMC 4275886. PMID 25487330.


External links[edit]