LRRC24
LRRC24 | |||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Identifiers | |||||||||||||||||||||||||||||||||||||||||||||||||||
Aliases | LRRC24, LRRC14OS, leucine rich repeat containing 24 | ||||||||||||||||||||||||||||||||||||||||||||||||||
External IDs | MGI: 3605040 HomoloGene: 86785 GeneCards: LRRC24 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
Wikidata | |||||||||||||||||||||||||||||||||||||||||||||||||||
|
Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene.[5] The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS.[6] The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.
Gene[edit]
In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand.[5] LRRC24 is composed of five exons, and only a single gene isoform has been identified.[5]
Protein[edit]
General features[edit]
LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.[5][7] The mature form of the protein has a molecular weight of 52.9 kDa.[8] The isoelectric point of the mature human protein is 7.98[9] The protein is largely composed of alpha helices.[10]
Domains[edit]
LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.[5][11]
Feature | Position(s) | Description |
---|---|---|
Signal Peptide | 1-23 | [12] |
Domain | 24-50 | Leucine rich repeat N-terminal domain (LRRNT)[13][14] |
Repeat | 51-72 | Leucine rich repeat 1 (LRR 1)[13][14] |
Repeat | 75-96 | LRR 2[13][14] |
Repeat | 99-120 | LRR 3[13][14] |
Repeat | 123-144 | LRR 4[13][14] |
Repeat | 147-168 | LRR 5[13][14] |
Repeat | 171-192 | LRR 6[13][14] |
Domain | 204-257 | Leucine rich repeat C-terminal domain (LRRCT)[13][14] |
Domain | 259-364 | Immunoglobulin-like domain (Ig-like)[13][14] |
Domain | 406-426 | Transmembrane domain (TMEM)[15] |
Motif | 427-436 | Arginine-rich motif (ARM)[13] |
Localization[edit]
LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.
Homology[edit]
LRRC24 is conserved in Euteleostomi with the exception of Aves.[5][18] Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda.[5] No human paralogs of LRRC24 have been identified.
Expression[edit]
Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain.[20][21][22] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.[20][22][23]
Interactions[edit]
Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24.[24][25] ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates.[25]
LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs).[25] IGFBP7 is also involved in the stimulation of cell adhesion.
Clinical significance[edit]
To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.[26]
References[edit]
- ^ a b c GRCh38: Ensembl release 89: ENSG00000254402 – Ensembl, May 2017
- ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000033707 – Ensembl, May 2017
- ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
- ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
- ^ a b c d e f g "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
- ^ a b "GeneCard". www.genecards.org. Retrieved 2016-05-09.
- ^ "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
- ^ Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–6. Bibcode:1992PNAS...89.2002B. doi:10.1073/pnas.89.6.2002. PMC 48584. PMID 1549558.
- ^ a b Kozlowski LP (October 2016). "IPC - Isoelectric Point Calculator". Biology Direct. 11 (1): 55. doi:10.1186/s13062-016-0159-9. PMC 5075173. PMID 27769290.
- ^ Borrelli KW, Vitalis A, Alcantara R, Guallar V (November 2005). "PELE: Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–11. doi:10.1021/ct0501811. PMID 26631674.
- ^ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
- ^ Petersen TN, Brunak S, von Heijne G, Nielsen H (September 2011). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–6. doi:10.1038/nmeth.1701. PMID 21959131. S2CID 16509924.
- ^ a b c d e f g h i j "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
- ^ a b c d e f g h i "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ Krogh A, Larsson B, von Heijne G, Sonnhammer EL (January 2001). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–80. doi:10.1006/jmbi.2000.4315. PMID 11152613.
- ^ a b "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
- ^ "HomoloGene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ Thompson JD, Higgins DG, Gibson TJ (November 1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–80. doi:10.1093/nar/22.22.4673. PMC 308517. PMID 7984417.
- ^ a b "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ a b "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
- ^ "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
- ^ Gilsohn E, Volk T (2010-01-01). "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration. 4 (3): 368–71. doi:10.4161/cam.4.3.11606. PMC 2958611. PMID 20404543.
- ^ a b c Söllner C, Wright GJ (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi:10.1186/gb-2009-10-9-r99. PMC 2768988. PMID 19765300.
- ^ "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.