List of Y-DNA single-nucleotide polymorphisms

From Wikipedia, the free encyclopedia
Jump to: navigation, search
Mutation number Nucleotide change Position (base pair) Total size (base pairs) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 A to G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M3
M4
M8
M9
M15
M17
M20
M33
M35
M38
M40
M42
M45
M52
M55
M57
M60
M64.1
M75
M89
M91
M94
M95
M96
M105
M122
M124
M130
M131
M132
M139
M145
M168
M170
M172
M173
M174
M175
M176
M179
M201
M203
M207
M213
M214
M216
M217
M231 G to A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 C to T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M258
M267 T to G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M268
M269
M285 G to C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 G to A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 A to T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M297
M299
M304 A to C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M306
M335 T to A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 T to G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 G to C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 C to T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343 C to A 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M347
M349 G to T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M356
M359 T to C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 A to G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 A to G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 A to C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 G to C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 C to G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M405

See also[edit]

External links[edit]