List of homing endonuclease cutting sites

From Wikipedia, the free encyclopedia
Jump to: navigation, search
Legend of nucleobases
Code Nucleotide represented
A Adenine (A)
C Cytosine (C)
G Guanine (G)
T Thymine (T)
N A, C, G or T
M A or C
R A or G
W A or T
Y C or T
S C or G
K G or T
H A, C or T
B C, G or T
V A, C or G
D A, G or T


The homing endonucleases are a special type of restriction enzymes encoded by introns or inteins. They act on the cellular DNA of the cell that synthesizes them; to be precise, in the opposite allele of the gene that encode them.[1]

Further information: Homing endonuclease.

Homing endonucleases[edit]

The list includes some of the most studied examples. The following concepts have been detailed:

Enzyme SF PDB code Source D SCL Recognition sequence Cut
I-AniI [2] HI 1P8K Aspergillus nidulans E mito 5' TTGAGGAGGTTTCTCTGTAAATAA
3' AACTCCTCCAAAGAGACATTTATT
5' ---TTGAGGAGGTTTC   TCTGTAAATAA--- 3'
3' ---AACTCCTCC   AAAGAGACATTTATT--- 5'
I-CeuI [3][4][5][6] HI 2EX5 Chlamydomonas eugametos E chloro 5' TAACTATAACGGTCCTAAGGTAGCGA
3' ATTGATATTGCCAGGATTCCATCGCT
5' ---TAACTATAACGGTCCTAA   GGTAGCGA--- 3'
3' ---ATTGATATTGCCAG   GATTCCATCGCT--- 5'
I-ChuI [7][8] HI Chlamydomonas humicola E chloro 5' GAAGGTTTGGCACCTCGATGTCGGCTCATC
3' CTTCCAAACCGTGGAGCTACAGCCGAGTAG
5' ---GAAGGTTTGGCACCTCG   ATGTCGGCTCATC--- 3'
3' ---CTTCCAAACCGTG   GAGCTACAGCCGAGTAG--- 5'
I-CpaI [8][9] HI Chlamydomonas pallidostigmata E chloro 5' CGATCCTAAGGTAGCGAAATTCA
3' GCTAGGATTCCATCGCTTTAAGT
5' ---CGATCCTAAGGTAGCGAA   ATTCA--- 3'
3' ---GCTAGGATTCCATC   GCTTTAAGT--- 5'
I-CpaII [10] HI Chlamydomonas pallidostigmata E chloro 5' CCCGGCTAACTCTGTGCCAG
3' GGGCCGATTGAGACACGGTC
5' ---CCCGGCTAACTC   TGTGCCAG--- 3'
5' ---GGGCCGAT   TGAGACACGGTC--- 3'
I-CreI [11] HI 1BP7 Chlamydomonas reinhardtii E chloro 5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG
3' GACCCAAGTTTTGCAGCACTCTGTCAAACC
5' ---CTGGGTTCAAAACGTCGTGA   GACAGTTTGG--- 3'
3' ---GACCCAAGTTTTGCAG   CACTCTGTCAAACC--- 5'
I-DmoI HI 1B24 Desulfurococcus mobilis A chrm 5' ATGCCTTGCCGGGTAAGTTCCGGCGCGCAT
3' TACGGAACGGCCCATTCAAGGCCGCGCGTA
5' ---ATGCCTTGCCGGGTAA   GTTCCGGCGCGCAT--- 3'
3' ---TACGGAACGGCC   CATTCAAGGCCGCGCGTA--- 5'
H-DreI [12] 1MOW Escherichia coli pI-DreI B 5' CAAAACGTCGTAAGTTCCGGCGCG
3' GTTTTGCAGCATTCAAGGCCGCGC
5' ---CAAAACGTCGTAA   GTTCCGGCGCG--- 3'
3' ---GTTTTGCAG   CATTCAAGGCCGCGC--- 5'
I-HmuI [13][14] HIII 1U3E Bacillus subtilis phage SPO1 B phage 5' AGTAATGAGCCTAACGCTCAGCAA
3' TCATTACTCGGATTGCGAGTCGTT
  Nicking endonuclease: *
  3' ---TCATTACTCGGATTGC   GAGTCGTT--- 5'
I-HmuII [14][15] HIII Bacillus subtilis phage SP82 B phage 5' AGTAATGAGCCTAACGCTCAACAA
3' TCATTACTCGGATTGCGAGTTGTT
  Nicking endonuclease: *
  3' ---TCATTACTCGGATTGCGAGTTGTTN35   NNNN--- 5'
I-LlaI [16][17] HIII Lactococcus lactis B chrm 5' CACATCCATAACCATATCATTTTT
3' GTGTAGGTATTGGTATAGTAAAAA
5' ---CACATCCATAA   CCATATCATTTTT--- 3'
3' ---GTGTAGGTATTGGTATAGTAA   AAA--- 5'
I-MsoI 1M5X Monomastix sp. E 5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG
3' GACCCAAGTTTTGCAGCACTCTGTCAAACC
5' ---CTGGGTTCAAAACGTCGTGA   GACAGTTTGG--- 3'
3' ---GACCCAAGTTTTGCAG   CACTCTGTCAAACC--- 5'
PI-PfuI 1DQ3 Pyrococcus furiosus Vc1 A 5' GAAGATGGGAGGAGGGACCGGACTCAACTT
3' CTTCTACCCTCCTCCCTGGCCTGAGTTGAA
5' ---GAAGATGGGAGGAGGG   ACCGGACTCAACTT--- 3'
3' ---CTTCTACCCTCC   TCCCTGGCCTGAGTTGAA--- 5'
PI-PkoII 2CW7 Pyrococcus kodakarensis KOD1 A 5' CAGTACTACGGTTAC
3' GTCATGATGCCAATG
5' ---CAGTACTACG  GTTAC--- 3'
3' ---GTCATG  ATGCCAATG--- 5'
I-PorI [18][19] HIII Pyrobaculum organotrophum A chrm 5' GCGAGCCCGTAAGGGTGTGTACGGG
3' CGCTCGGGCATTCCCACACATGCCC
5' ---GCGAGCCCGTAAGGGT   GTGTACGGG--- 3'
3' ---CGCTCGGGCATT   CCCACACATGCCC--- 5'
I-PpoI HIV 1EVX Physarum polycephalum E nuclear 5' TAACTATGACTCTCTTAAGGTAGCCAAAT
3' ATTGATACTGAGAGAATTCCATCGGTTTA
5' ---TAACTATGACTCTCTTAA   GGTAGCCAAAT--- 3'
3' ---ATTGATACTGAGAG   AATTCCATCGGTTTA--- 5'
PI-PspI HI Pyrococcus sp. A chrm 5' TGGCAAACAGCTATTATGGGTATTATGGGT
3' ACCGTTTGTCGATAATACCCATAATACCCA
5' ---TGGCAAACAGCTATTAT   GGGTATTATGGGT--- 3'
3' ---ACCGTTTGTCGAT   AATACCCATAATACCCA--- 5'
I-ScaI [20][21] HI Saccharomyces capensis E mito 5' TGTCACATTGAGGTGCACTAGTTATTAC
3' ACAGTGTAACTCCACGTGATCAATAATG
5' ---TGTCACATTGAGGTGCACT   AGTTATTAC--- 3'
3' ---ACAGTGTAACTCCAC   GTGATCAATAATG--- 5'
I-SceI [4][5] HI 1R7M Saccharomyces cerevisiae E mito 5' AGTTACGCTAGGGATAACAGGGTAATATAG
3' TCAATGCGATCCCTATTGTCCCATTATATC
5' ---AGTTACGCTAGGGATAA   CAGGGTAATATAG--- 3'
3' ---TCAATGCGATCCC   TATTGTCCCATTATATC--- 5'
PI-SceI [22][23] HI 1VDE Saccharomyces cerevisiae E 5' ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCA
3' TAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGT
5' ---ATCTATGTCGGGTGC   GGAGAAAGAGGTAATGAAATGGCA--- 3'
3' ---TAGATACAGCC   CACGCCTCTTTCTCCATTACTTTACCGT--- 5'
I-SceII [24][25][26] HI Saccharomyces cerevisiae E mito 5' TTTTGATTCTTTGGTCACCCTGAAGTATA
3' AAAACTAAGAAACCAGTGGGACTTCATAT
5' ---TTTTGATTCTTTGGTCACCC   TGAAGTATA--- 3'
3' ---AAAACTAAGAAACCAG   TGGGACTTCATAT--- 5'
I-SecIII [24][27][28] HI Saccharomyces cerevisiae E mito 5' ATTGGAGGTTTTGGTAACTATTTATTACC
3' TAACCTCCAAAACCATTGATAAATAATGG
5' ---ATTGGAGGTTTTGGTAAC   TATTTATTACC--- 3'
3' ---TAACCTCCAAAACC   ATTGATAAATAATGG--- 5'
I-SceIV [24][29][30] HI Saccharomyces cerevisiae E mito 5' TCTTTTCTCTTGATTAGCCCTAATCTACG
3' AGAAAAGAGAACTAATCGGGATTAGATGC
5' ---TCTTTTCTCTTGATTA   GCCCTAATCTACG--- 3'
3' ---AGAAAAGAGAAC   TAATCGGGATTAGATGC--- 5'
I-SceV [24][31] HIII Saccharomyces cerevisiae E mito 5' AATAATTTTCTTCTTAGTAATGCC
3' TTATTAAAAGAAGAATCATTACGG
5' ---AATAATTTTCT   TCTTAGTAATGCC--- 3'
3' ---TTATTAAAAGAAGAATCATTA   CGG--- 5'
I-SceVI [24][32] HIII Saccharomyces cerevisiae E mito 5' GTTATTTAATGTTTTAGTAGTTGG
3' CAATAAATTACAAAATCATCAACC
5' ---GTTATTTAATG   TTTTAGTAGTTGG--- 3'
3' ---CAATAAATTACAAAATCATCA   ACC--- 5'
I-SceVII [20] HI Saccharomyces cerevisiae E mito 5' TGTCACATTGAGGTGCACTAGTTATTAC
3' ACAGTGTAACTCCACGTGATCAATAATG
  Unknown **
I-Ssp6803I 2OST Synechocystis sp. PCC 6803 B 5' GTCGGGCTCATAACCCGAA
3' CAGCCCGAGTATTGGGCTT
5' ---GTCGGGCT   CATAACCCGAA--- 3'
3' ---CAGCCCGAGTA   TTGGGCTT--- 5'
I-TevI [33][34][35] HII 1I3J Escherichia coli phage T4 B phage 5' AGTGGTATCAACGCTCAGTAGATG
3' TCACCATAGT TGCGAGTCATCTAC
5' ---AGTGGTATCAAC   GCTCAGTAGATG--- 3'
3' ---TCACCATAGT   TGCGAGTCATCTAC--- 5'
I-TevII [33][36] HII Escherichia coli phage T4 B phage 5' GCTTATGAGTATGAAGTGAACACGTTATTC
3' CGAATACTCATACTTCACTTGTGCAATAAG
5' ---GCTTATGAGTATGAAGTGAACACGT   TATTC--- 3'
3' ---CGAATACTCATACTTCACTTGTG   CAATAAG--- 5'
I-TevIII [37] HIII Escherichia coli phage RB3 B phage 5' TATGTATCTTTTGCGTGTACCTTTAACTTC
3' ATACATAGAAAACGCACATGGAAATTGAAG
5' ---T   ATGTATCTTTTGCGTGTACCTTTAACTTC--- 3'
3' ---AT   ACATAGAAAACGCACATGGAAATTGAAG--- 5'
PI-TliI [38][39] HI Thermococcus litoralis A chrm 5' TAYGCNGAYACNGACGGYTTYT
3' ATRCGNCTRTGNCTGCCTAARA
5' ---TAYGCNGAYACNGACGG   YTTYT--- 3'
3' ---ATRCGNCTRTGNC   TGCCTAARA--- 5'
PI-TliII [22][39][40] HI Thermococcus litoralis A chrm 5' AAATTGCTTGCAAACAGCTATTACGGCTAT
3' TTTAACGAACGTTTGTCGATAATGCCGATA
  Unknown **
I-Tsp061I 2DCH Thermoproteus sp. IC-061 A 5' CTTCAGTATGCCCCGAAAC
3' GAAGTCATACGGGGCTTTG
5' ---CTTCAGTAT   GCCCCGAAAC--- 3'
3' ---GAAGT   CATACGGGGCTTTG--- 5'
I-Vdi141I 3E54 Vulcanisaeta distributa IC-141 A 5' CCTGACTCTCTTAAGGTAGCCAAA
3' GGACTGAGAGAATTCCATCGGTTT
5' ---CCTGACTCTCTTAA   GGTAGCCAAA--- 3'
3' ---GGACTGAG   AGAATTCCATCGGTTT--- 5'

*: Nicking endonuclease: These enzymes cut only one DNA strand, leaving the other strand untouched.
**: Unknown cutting site: Researchers have not been able to determine the exact cutting site of these enzymes yet.

See also[edit]

Information sources[edit]

Databases and lists of restriction enzymes:

  • Very comprehensive database of restriction enzymes supported by New England Biolabs©. It includes all kind of biological, structural, kinetical and commercial information about thousands of enzymes. Also includes related literature for every molecule: Roberts RJ, Vincze T, Posfai J, Macelis D. "REBASE". Retrieved 2010-01-07. Restriction Enzyme Database. 
  • Database of inteins, hosted by New England Biolabs©. Perler FB. "InBase". Retrieved 2010-02-05. The Intein Database and Registry .[41]
  • Detailed information for biochemical experiments: "Enzyme finder". Retrieved 2010-01-07. New England Biolabs© enzyme finder. 
  • Alphabetical list of enzymes and their restriction sites: "GenScript© Restriction Enzyme webpage". Retrieved 2010-01-07. 
  • General information about restriction sites and biochemical conditions for restriction reactions: "Restriction Enzymes Resource". Retrieved 2010-01-07. Promega© restriction enzymes webpage. 

Databases of proteins:

  • Database of protein structures, solved at atomic resolution: "PDB". Research Collaboratory for Structural Bioinformatics (RCSB). Retrieved 2010-01-25. RCSB Protein Data Bank. 
  • Databases of proteins: Swiss Institute of Bioinformatics (SIB); European Bioinformatics Institute (EBI). "UniProtKB/Swiss-Prot & TrEMBL". Retrieved 2010-01-25. Swiss-Prot is a curated protein sequence database which strives to provide a high level of annotation (such as the description of the function of a protein, its domains structure, post-translational modifications, variants, etc.), a minimal level of redundancy and high level of integration with other databases. TrEMBL is a computer-annotated supplement of Swiss-Prot that contains all the translations of EMBL nucleotide sequence entries not yet integrated in Swiss-Prot. 

Notes and references[edit]

  1. ^ Lambowitz AM, Belfort M (1993). "Introns as mobile genetic elements". Annu Rev Biochem. 62: 587–622. doi:10.1146/annurev.bi.62.070193.003103. PMID 8352597. 
  2. ^ Naito T, Kusano K, Kobayashi I (February 1995). "Selfish behavior of restriction-modification systems". Science. 267 (5199): 897–99. doi:10.1126/science.7846533. PMID 7846533. 
  3. ^ Jacquier A, Dujon B (June 1985). "An intron-encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene". Cell. 41 (2): 383–94. doi:10.1016/S0092-8674(85)80011-8. PMID 3886163. 
  4. ^ a b Gauthier A, Turmel M, Lemieux C (January 1991). "A group I intron in the chloroplast large subunit rRNA gene of Chlamydomonas eugametos encodes a double-strand endonuclease that cleaves the homing site of this intron". Curr Genet. 19 (1): 43–47. doi:10.1007/BF00362086. PMID 2036685. 
  5. ^ a b Marshall P, Lemieux C (August 1991). "Cleavage pattern of the homing endonuclease encoded by the fifth intron in the chloroplast large subunit rRNA-encoding gene of Chlamydomonas eugametos". Gene. 104 (2): 241–5. doi:10.1016/0378-1119(91)90256-B. PMID 1916294. 
  6. ^ Turmel M, Boulanger J, Schnare MN, Gray MW, Lemieux C (March 1991). "Six group I introns and three internal transcribed spacers in the chloroplast large subunit ribosomal RNA gene of the green alga Chlamydomonas eugametos". J Mol Biol. 218 (2): 293–311. doi:10.1016/0022-2836(91)90713-G. PMID 1849178. 
  7. ^ Côté V, Mercier JP, Lemieux C, Turmel M (July 1993). "The single group-I intron in the chloroplast rrnL gene of Chlamydomonas humicola encodes a site-specific DNA endonuclease (I-ChuI)". Gene. 129 (1): 69–76. doi:10.1016/0378-1119(93)90697-2. PMID 8335261. 
  8. ^ a b Turmel M, Gutell RR, Mercier JP, Otis C, Lemieux C (July 1993). "Analysis of the chloroplast large subunit ribosomal RNA gene from 17 Chlamydomonas taxa. Three internal transcribed spacers and 12 group I intron insertion sites". J Mol Biol. 232 (2): 446–67. doi:10.1006/jmbi.1993.1402. PMID 8393936. 
  9. ^ Turmel M, Côté V, Otis C, Mercier JP, Gray MW, Lonergan KM, Lemieux C (July 1995). "Evolutionary transfer of ORF-containing group I introns between different subcellular compartments (chloroplast and mitochondrion)". Mol Biol Evol. 12 (4): 533–45. PMID 7659010. 
  10. ^ Turmel M, Mercier JP, Côté V, Otis C, Lemieux C (July 1995). "The site-specific DNA endonuclease encoded by a group I intron in the Chlamydomonas pallidostigmatica chloroplast small subunit rRNA gene introduces a single-strand break at low concentrations of Mg2+". Nucleic Acids Res. 23 (13): 2519–25. doi:10.1093/nar/23.13.2519. PMC 307060Freely accessible. PMID 7630730. 
  11. ^ Jurica MS, Monnat RJ, Stoddard BL (October 1998). "DNA recognition and cleavage by the LAGLIDADG homing endonuclease I-CreI". Mol. Cell. 2 (4): 469–76. doi:10.1016/S1097-2765(00)80146-X. PMID 9809068. 
  12. ^ Chevalier BS, Kortemme T, Chadsey MS, Baker D, Monnat RJ, Stoddard BL (October 2002). "Design, activity, and structure of a highly specific artificial endonuclease". Mol. Cell. 10 (4): 895–905. doi:10.1016/S1097-2765(02)00690-1. PMID 12419232. 
  13. ^ Goodrich-Blair H, Scarlato V, Gott JM, Xu M, Shub DA (October 1990). "A self-splicing group I intron in the DNA polymerase gene of Bacillus subtilis bacteriophage SPO1". Cell. 63 (2): 417–24. doi:10.1016/0092-8674(90)90174-D. PMID 2119891. 
  14. ^ a b Goodrich-Blair H, Shub DA (January 1996). "Beyond homing: competition between intron endonucleases confers a selective advantage on flanking genetic markers". Cell. 84 (2): 211–21. doi:10.1016/S0092-8674(00)80976-9. PMID 8565067. 
  15. ^ Goodrich-Blair H, Shub DA (September 1994). "The DNA polymerase genes of several HMU-bacteriophages have similar group I introns with highly divergent open reading frames". Nucleic Acids Res. 22 (18): 3715–21. doi:10.1093/nar/22.18.3715. PMC 308352Freely accessible. PMID 7937082. 
  16. ^ Shearman C, Godon JJ, Gasson M (July 1996). "Splicing of a group II intron in a functional transfer gene of Lactococcus lactis". Mol Microbiol. 21 (1): 45–53. doi:10.1046/j.1365-2958.1996.00610.x. PMID 8843433. 
  17. ^ Mills DA, McKay LL, Dunny GM (June 1996). "Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci". J Bacteriol. 178 (12): 3531–8. PMC 178122Freely accessible. PMID 8655550. 
  18. ^ Lykke-Andersen J, Thi-Ngoc HP, Garrett RA (November 1994). "DNA substrate specificity and cleavage kinetics of an archaeal homing-type endonuclease from Pyrobaculum organotrophum". Nucleic Acids Res. 22 (22): 4583–90. doi:10.1093/nar/22.22.4583. PMC 308504Freely accessible. PMID 7984405. 
  19. ^ Dalgaard JZ, Garrett RA (November 1992). "Protein-coding introns from the 23S rRNA-encoding gene form stable circles in the hyperthermophilic archaeon Pyrobaculum organotrophum". Gene. 121 (1): 103–10. doi:10.1016/0378-1119(92)90167-N. PMID 1427083. 
  20. ^ a b Szczepanek T, Lazowska J (July 1996). "Replacement of two non-adjacent amino acids in the S.cerevisiae bi2 intron-encoded RNA maturase is sufficient to gain a homing-endonuclease activity". EMBO J. 15 (14): 3758–67. PMC 452048Freely accessible. PMID 8670880. 
  21. ^ Lazowska J, Szczepanek T, Macadre C, Dokova M (1992). "Two homologous mitochondrial introns from closely related Saccharomyces species differ by only a few amino acid replacements in their Open Reading Frames: one is mobile, the other is not". C R Acad Sci Paris. 315 (2): 37–41. PMID 1330224. 
  22. ^ a b Kane PM, Yamashiro CT, Wolczyk DF, Neff N, Goebl M, Stevens TH (November 1990). "Protein splicing converts the yeast TFP1 gene product to the 69-kD subunit of the vacuolar H(+)-adenosine triphosphatase". Science. 250 (4981): 651–7. doi:10.1126/science.2146742. PMID 2146742. 
  23. ^ Gimble FS, Thorner J (May 1992). "Homing of a DNA endonuclease gene by meiotic gene conversion in Saccharomyces cerevisiae". Nature. 357 (6376): 301–6. doi:10.1038/357301a0. PMID 1534148. 
  24. ^ a b c d e Bonitz SG, Coruzzi G, Thalenfeld BE, Tzagoloff A, Macino G (December 1980). "Assembly of the mitochondrial membrane system. Structure and nucleotide sequence of the gene coding for subunit 1 of yeast cytochrme oxidase". J Biol Chem. 255 (24): 11927–41. PMID 6254986. 
  25. ^ Hanson DK, Lamb MR, Mahler HR, Perlman PS (March 1982). "Evidence for translated intervening sequences in the mitochondrial genome of Saccharomyces cerevisiae". J Biol Chem. 257 (6): 3218–24. PMID 6277926. 
  26. ^ Delahodde A, Goguel V, Becam AM, Creusot F, Perea J, Banroques J, Jacq C (February 1989). "Site-specific DNA endonuclease and RNA maturase activities of two homologous intron-encoded proteins from yeast mitochondria". Cell. 56 (3): 431–41. doi:10.1016/0092-8674(89)90246-8. PMID 2536593. 
  27. ^ Sargueil B, Delahodde A, Hatat D, Tian GL, Lazowska J, Jacq C (February 1991). "A new specific DNA endonuclease activity in yeast mitochondria". Mol Gen Genet. 225 (2): 340–1. doi:10.1007/BF00269867. PMID 1848651. 
  28. ^ Perea J, Desdouets C, Schapria M, Jacq C (January 1993). "I-Sce III: a novel group I intron-encoded endonuclease from the yeast mitochondria". Nucleic Acids Res. 21 (2): 358. doi:10.1093/nar/21.2.358. PMC 309119Freely accessible. PMID 8441645. 
  29. ^ Moran JV, Wernette CM, Mecklenburg KL, Butow RA, Perlman PS (August 1992). "Intron 5 alpha of the COXI gene of yeast mitochondrial DNA is a mobile group I intron". Nucleic Acids Res. 20 (15): 4069–76. doi:10.1093/nar/20.15.4069. PMC 334089Freely accessible. PMID 1324475. 
  30. ^ Seraphin B, Faye G, Hatat D, Jacq C (April 1992). "The yeast mitochondrial intron aI5 alpha: associated endonuclease activity and in vivo mobility". Gene. 113 (1): 1–8. doi:10.1016/0378-1119(92)90663-A. PMID 1314207. 
  31. ^ Liang F, Romanienko PJ, Weaver DT, Jeggo PA, Jasin M (August 1996). "Chromosomal double-strand break repair in Ku80-deficient cells". PNAS. 93 (17): 8929–33. doi:10.1073/pnas.93.17.8929. PMC 38571Freely accessible. PMID 8799130. 
  32. ^ Yang J, Zimmerly S, Perlman PS, Lambowitz AM (May 1996). "Efficient integration of an intron RNA into double-stranded DNA by reverse splicing". Nature. 381 (6580): 332–5. doi:10.1038/381332a0. PMID 8692273. 
  33. ^ a b Bell-Pedersen D, Quirk S, Clyman J, Belfort M (July 1990). "Intron mobility in phage T4 is dependent upon a distinctive class of endonucleases and independent of DNA sequences encoding the intron core: mechanistic and evolutionary implications". Nucleic Acids Res. 18 (13): 3763–70. doi:10.1093/nar/18.13.3763. PMC 331075Freely accessible. PMID 2165250. 
  34. ^ Chu FK, Maley G, Pedersen-Lane J, Wang AM, Maley F (May 1990). "Characterization of the restriction site of a prokaryotic intron-encoded endonuclease". PNAS. 87 (9): 3574–8. doi:10.1073/pnas.87.9.3574. PMC 53944Freely accessible. PMID 2159153. 
  35. ^ Bell-Pedersen D, Quirk SM, Aubrey M, Belfort M (October 1989). "A site-specific endonuclease and co-conversion of flanking exons associated with the mobile td intron of phage T4". Gene. 82 (1): 119–26. doi:10.1016/0378-1119(89)90036-X. PMID 2555262. 
  36. ^ Shub DA, Gott JM, Xu MQ, Lang BF, Michel F, Tomaschewski J, Pedersen-Lane J, Belfort M (February 1988). "Structural conservation among three homologous introns of bacteriophage T4 and the group I introns of eukaryotes". PNAS. 85 (4): 1151–5. doi:10.1073/pnas.85.4.1151. PMC 279724Freely accessible. PMID 3422485. 
  37. ^ Eddy SR, Gold L (June 1991). "The phage T4 nrdB intron: a deletion mutant of a version found in the wild". Genes Dev. 5 (6): 1032–41. doi:10.1101/gad.5.6.1032. PMID 2044951. 
  38. ^ Xu M, Southworth MW, Mersha FB, Hornstra LJ, Perler FB (December 1993). "In vitro protein splicing of purified precursor and the identification of a branched intermediate". Cell. 75 (7): 1371–7. doi:10.1016/0092-8674(93)90623-X. PMID 8269515. 
  39. ^ a b Perler FB, Comb DG, Jack WE, Moran LS, Qiang B, Kucera RB, Benner J, Slatko BE, Nwankwo DO, Hempstead SK, Carlow CK, Jannasch H (June 1992). "Intervening sequences in an Archaea DNA polymerase gene". PNAS. 89 (12): 5577–81. doi:10.1073/pnas.89.12.5577. PMC 49335Freely accessible. PMID 1608969. 
  40. ^ Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y (April 1990). "Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae". J Biol Chem. 265 (12): 6726–33. PMID 2139027. 
  41. ^ Perler FB (January 2002). "InBase: the Intein Database". Nucleic Acids Res. 30 (1): 383–4. doi:10.1093/nar/30.1.383. PMC 99080Freely accessible. PMID 11752343.