LRRC24: Difference between revisions

From Wikipedia, the free encyclopedia
Browse history interactively
← Previous editNext edit →
Content deleted Content added
VisualWikitext
Mxfraser (talk | contribs)
26 edits
Added to "expression" section
Mxfraser (talk | contribs)
26 edits
Added to "Interactions" section and added "Clinical Significance" section
Tags: Visual edit adding email address
Line 1: Line 1:
{{GNF_Protein_box |Name=Leucine-Rich Repeat-Containing 24|image_source=|HGNCid=|MGIid=|Symbol=LRRC24|AltSymbols=LRRC14OS|ECnumber=|Homologene=|GeneAtlas_image=|Function=|NotAProtein=|Orthologs=|Hs_EntrezGene=441381|Hs_Ensembl=ENSG00000254402|Hs_RefseqmRNA=NM_001024678.3|Hs_RefseqProtein=NP_001019849.2|Hs_GenLoc_db=hg38|Hs_GenLoc_chr=8|Hs_GenLoc_start=144522377|Hs_GenLoc_end=144527018|Hs_Uniprot=Q50LG9|Mm_EntrezGene=378937|Mm_Ensembl=ENSMUSG00000033707|Mm_RefseqmRNA=NM_198119.2|Mm_RefseqProtein=NP_932787.1|Mm_GenLoc_db=mm10|Mm_GenLoc_chr=12|Mm_GenLoc_start=56694976|Mm_GenLoc_end=56714605|Mm_Uniprot=Q8BHA1|path=|IUPHAR=}}'''Leucine-rich repeat-containing 24''', also known as '''LRRC24''', is an integral membrane protein that in humans is encoded by the ''LRRC24'' gene.<ref name=":0">{{cite web|url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|title=LRRC24 Gene (Protein Coding)|website=genecards.com|accessdate=February 22, 2016}}</ref><ref name=":1">{{Cite web
{{GNF_Protein_box |Name=Leucine-Rich Repeat-Containing 24|image_source=|HGNCid=HGNC:28947|MGIid=|Symbol=LRRC24|AltSymbols=LRRC14OS|ECnumber=|Homologene=|GeneAtlas_image=|Function=|NotAProtein=|Orthologs=|Hs_EntrezGene=441381|Hs_Ensembl=ENSG00000254402|Hs_RefseqmRNA=NM_001024678.3|Hs_RefseqProtein=NP_001019849.2|Hs_GenLoc_db=hg38|Hs_GenLoc_chr=8|Hs_GenLoc_start=144522377|Hs_GenLoc_end=144527018|Hs_Uniprot=Q50LG9|Mm_EntrezGene=378937|Mm_Ensembl=ENSMUSG00000033707|Mm_RefseqmRNA=NM_198119.2|Mm_RefseqProtein=NP_932787.1|Mm_GenLoc_db=mm10|Mm_GenLoc_chr=12|Mm_GenLoc_start=56694976|Mm_GenLoc_end=56714605|Mm_Uniprot=Q8BHA1|path=|IUPHAR=}}'''Leucine-rich repeat-containing 24''', also known as '''LRRC24''', is an integral membrane protein that in humans is encoded by the ''LRRC24'' gene.<ref name=":0">{{cite web|url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|title=LRRC24 Gene (Protein Coding)|website=genecards.com|accessdate=February 22, 2016}}</ref><ref name=":1">{{Cite web
| url = http://www.ncbi.nlm.nih.gov/gene/441381
| url = http://www.ncbi.nlm.nih.gov/gene/441381
| title = LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI
| title = LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI
Line 68: Line 68:
|406-426
|406-426
|Transmembrane domain (TMEM)<ref>{{Cite journal|last=Krogh|first=A.|last2=Larsson|first2=B.|last3=von Heijne|first3=G.|last4=Sonnhammer|first4=E. L.|date=2001-01-19|title=Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes|url=http://www.ncbi.nlm.nih.gov/pubmed/11152613|journal=Journal of Molecular Biology|volume=305|issue=3|pages=567–580|doi=10.1006/jmbi.2000.4315|issn=0022-2836|pmid=11152613}}</ref>
|Transmembrane domain (TMEM)<ref>{{Cite journal|last=Krogh|first=A.|last2=Larsson|first2=B.|last3=von Heijne|first3=G.|last4=Sonnhammer|first4=E. L.|date=2001-01-19|title=Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes|url=http://www.ncbi.nlm.nih.gov/pubmed/11152613|journal=Journal of Molecular Biology|volume=305|issue=3|pages=567–580|doi=10.1006/jmbi.2000.4315|issn=0022-2836|pmid=11152613}}</ref>
|}
⚫
|}[[File:LRRC24 Protein Diagram.png|thumb|371x371px|Diagram of LRRC24. Domains are labelled as predicted<ref>{{Cite web|url=http://www.ncbi.nlm.nih.gov/gene/441381|title=LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref>; grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator<ref>{{Cite web|url=http://prosite.expasy.org/cgi-bin/prosite/mydomains/|title=Prosite MyDomains - Image Creator|last=SIB Swiss Institute of Bioinformatics|first=|date=|website=|publisher=|access-date=}}</ref>   ]]

=== Localization ===
⚫
LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the [[cell membrane]].[[File:LRRC24 Protein Diagram.png|thumb|371x371px|Diagram of LRRC24. Domains are labelled as predicted<ref>{{Cite web|url=http://www.ncbi.nlm.nih.gov/gene/441381|title=LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref>; grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator<ref>{{Cite web|url=http://prosite.expasy.org/cgi-bin/prosite/mydomains/|title=Prosite MyDomains - Image Creator|last=SIB Swiss Institute of Bioinformatics|first=|date=|website=|publisher=|access-date=}}</ref>   ]]


== Homology ==
== Homology ==
Line 78: Line 81:
== Interactions ==
== Interactions ==
[[File:LRRC24 Orthologs Unrooted Tree .png|thumb|370x370px|An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree<ref>{{Cite web|url=http://www.ncbi.nlm.nih.gov/gene/441381|title=LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref> and ClustalW<ref>{{Cite web|url=http://isoelectric.ovh.org/|title=Isoelectric Point Calculator|last=Kozlowski|first=LP|date=2007-2016|website=|publisher=|access-date=}}</ref><ref>{{Cite journal|last=Thompson|first=J D|last2=Higgins|first2=D G|last3=Gibson|first3=T J|date=1994-11-11|title=CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC308517/|journal=Nucleic Acids Research|volume=22|issue=22|pages=4673–4680|issn=0305-1048|pmc=308517|pmid=7984417}}</ref>.
[[File:LRRC24 Orthologs Unrooted Tree .png|thumb|370x370px|An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree<ref>{{Cite web|url=http://www.ncbi.nlm.nih.gov/gene/441381|title=LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref> and ClustalW<ref>{{Cite web|url=http://isoelectric.ovh.org/|title=Isoelectric Point Calculator|last=Kozlowski|first=LP|date=2007-2016|website=|publisher=|access-date=}}</ref><ref>{{Cite journal|last=Thompson|first=J D|last2=Higgins|first2=D G|last3=Gibson|first3=T J|date=1994-11-11|title=CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC308517/|journal=Nucleic Acids Research|volume=22|issue=22|pages=4673–4680|issn=0305-1048|pmc=308517|pmid=7984417}}</ref>.
]]Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. [[ROBO2]] was found to interact with LRRC24.<ref>{{Cite journal|last=Gilsohn|first=Eli|last2=Volk|first2=Talila|date=2010-01-01|title=Fine tuning cellular recognition|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2958611/|journal=Cell Adhesion & Migration|volume=4|issue=3|pages=368–371|doi=10.4161/cam.4.3.11606|issn=1933-6918|pmc=2958611|pmid=20404543}}</ref><ref name=":6">{{Cite journal|last=Söllner|first=Christian|last2=Wright|first2=Gavin J|date=2009-01-01|title=A cell surface interaction network of neural leucine-rich repeat receptors|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2768988/|journal=Genome Biology|volume=10|issue=9|pages=R99|doi=10.1186/gb-2009-10-9-r99|issn=1465-6906|pmc=2768988|pmid=19765300}}</ref> Interestingly, ROBO2 is a member of the [[Roundabout (gene family)|Roundabout gene family]], which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in [[synaptogenesis]], as well as the maintenance of the nervous system in vertebrates<ref name=":6" />.
]]

LRRC24 has also been found to interact with [[IGFBP7]], a known regulator of [[Insulin-like growth factor|insulin-like growth factors]] (IGFs).<ref name=":6" /> IGFBP7 is also involved in the stimulation of cell adhesion.

== Clinical Significance ==
To date, no study has specifically implicated LRRC24 or the ''LRRC24'' gene with any case of clinical significance.<ref>{{Cite web|url=http://www.ncbi.nlm.nih.gov/dbvar|title=Home - dbVar - NCBI|last=dbvar@ncbi.nlm.nih.gov|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref>


==References==
==References==

Revision as of 21:18, 9 May 2016

LRRC24
Identifiers
AliasesLRRC24, LRRC14OS, leucine rich repeat containing 24
External IDsMGI: 3605040 HomoloGene: 86785 GeneCards: LRRC24
Orthologs
SpeciesHumanMouse
Entrez

441381

378937

Ensembl

ENSG00000254402

ENSMUSG00000033707

UniProt

Q50LG9

Q8BHA1

RefSeq (mRNA)

NM_001024678

NM_198119

RefSeq (protein)

NP_001019849

NP_932787

Location (UCSC)Chr 8: 144.52 – 144.53 MbChr 15: 76.6 – 76.61 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

Leucine-rich repeat-containing 24, also known as LRRC24, is an integral membrane protein that in humans is encoded by the LRRC24 gene.[5][6]

Gene

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand.[6] LRRC24 is composed of five exons, and only a single gene isoform has been identified.[6]

Protein

General Features

GeneCards Genomic View for LRRC24 gene[7]

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.[5][6] The mature form of the protein has a molecular weight of 52.9 kDa.[8] The isoelectric point of the mature human protein is 7.98.[9] The protein is largely comprised of alpha helices.[10]

Domains

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.[6][11]

Feature Position(s) Description
Signal Peptide 1-23 [12]
Domain 24-50 Leucine rich repeat N-terminal domain (LRRNT)[13][14]
Repeat 51-72 Leucine rich repeat 1 (LRR 1)[13][14]
Repeat 75-96 LRR 2[13][14]
Repeat 99-120 LRR 3[13][14]
Repeat 123-144 LRR 4[13][14]
Repeat 147-168 LRR 5[13][14]
Repeat 171-292 LRR 6[13][14]
Domain 204-257 Leucine rich repeat C-terminal domain (LRRCT)[13][14]
Domain 259-364 Immunoglobulin-like domain (Ig-like)[13][14]
Domain 406-426 Transmembrane domain (TMEM)[15]

Localization

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Diagram of LRRC24. Domains are labelled as predicted[16]; grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator[17]   

Homology

LRRC24 is conserved in vertebrates with the exception of members of the class Aves.[6] The protein is also conserved in invertebrates of phyla Mollusca and Arthropoda.[6] No human paralogs of LRRC24 have been identified.

Expression

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain.[18][19][20] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.[18][20][21]

Interactions

An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree[22] and ClustalW[23][24].

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24.[25][26] Interestingly, ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates[26].

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs).[26] IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical Significance

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.[27]

References

  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000254402 – Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000033707 – Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ a b "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
  6. ^ a b c d e f g "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
  7. ^ "http://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24". www.genecards.org. Retrieved 2016-05-09. {{cite web}}: External link in |title= (help)
  8. ^ Brendel, V; Bucher, P; Nourbakhsh, I R; Blaisdell, B E; Karlin, S (1992-03-15). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–2006. ISSN 0027-8424. PMC 48584. PMID 1549558.
  9. ^ Kozlowski, LP (2007–2016). "Isoelectric Point Calculator".{{cite web}}: CS1 maint: date format (link)
  10. ^ Borrelli, Kenneth W.; Vitalis, Andreas; Alcantara, Raul; Guallar, Victor (2005-11-01). "PELE:  Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–1311. doi:10.1021/ct0501811. ISSN 1549-9618.
  11. ^ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
  12. ^ Petersen, Thomas Nordahl; Brunak, Søren; von Heijne, Gunnar; Nielsen, Henrik (2011-10-01). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–786. doi:10.1038/nmeth.1701. ISSN 1548-7091.
  13. ^ a b c d e f g h i "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
  14. ^ a b c d e f g h i "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  15. ^ Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E. L. (2001-01-19). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–580. doi:10.1006/jmbi.2000.4315. ISSN 0022-2836. PMID 11152613.
  16. ^ "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  17. ^ SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
  18. ^ a b "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  19. ^ "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  20. ^ a b "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  21. ^ "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
  22. ^ "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  23. ^ Kozlowski, LP (2007–2016). "Isoelectric Point Calculator".{{cite web}}: CS1 maint: date format (link)
  24. ^ Thompson, J D; Higgins, D G; Gibson, T J (1994-11-11). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–4680. ISSN 0305-1048. PMC 308517. PMID 7984417.
  25. ^ Gilsohn, Eli; Volk, Talila (2010-01-01). "Fine tuning cellular recognition". Cell Adhesion & Migration. 4 (3): 368–371. doi:10.4161/cam.4.3.11606. ISSN 1933-6918. PMC 2958611. PMID 20404543.
  26. ^ a b c Söllner, Christian; Wright, Gavin J (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi:10.1186/gb-2009-10-9-r99. ISSN 1465-6906. PMC 2768988. PMID 19765300.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  27. ^ dbvar@ncbi.nlm.nih.gov. "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
Retrieved from "https://en.wikipedia.org/w/index.php?title=LRRC24&oldid=719465186"