Subsequence

From Wikipedia, the free encyclopedia
Jump to: navigation, search

In mathematics, a subsequence is a sequence that can be derived from another sequence by deleting some elements without changing the order of the remaining elements. For example, the sequence  \langle A,B,D \rangle is a subsequence of  \langle A,B,C,D,E,F \rangle .

Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if

 X = \langle A,C,B,D,E,G,C,E,D,B,G \rangle and
 Y = \langle B,E,G,C,F,E,U,B,K \rangle

then a common subsequence of X and Y could be

 G = \langle B,E,E \rangle.

This would not be the longest common subsequence, since G only has length 3, and the common subsequence  \langle B,E,E,B \rangle has length 4. The longest common subsequence of X and Y is  \langle B,E,G,C,E,B \rangle .

Contents

[edit] Applications

Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.

Take two strands of DNA, say:

ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
and
ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA.

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

[edit] Substring vs. subsequence

In computer science, string is often used as a synonym for sequence, but it is important to note that substring and subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but a subsequence of a string is not always a substring of the string.[1]

[edit] See also

[edit] References

  1. ^ Gusfield, Dan (1999) [1997]. Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology. USA: Cambridge University Press. pp. 4. ISBN 0-521-58519-8. 

This article incorporates material from subsequence on PlanetMath, which is licensed under the Creative Commons Attribution/Share-Alike License.

Personal tools
Namespaces
Variants
Actions
Navigation
Interaction
Toolbox
Print/export
Languages