Alu element
An Alu element is a short stretch of DNA originally characterized by the action of the Alu restriction endonuclease. Alu elements of different kinds occur in large numbers in primate genomes. In fact, Alu elements are the most abundant mobile elements in the human genome. They are derived from the small cytoplasmic 7SL RNA, a component of the signal recognition particle. The event, when a copy of the 7SL RNA became a precursor of the Alu elements, took place in the genome of an ancestor of Supraprimates.[1]
Alu insertions have been implicated in several inherited human diseases and in various forms of cancer.
The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans.
Contents |
[edit] The Alu family
The Alu family is a family of repetitive elements in the human genome. Modern Alu elements are about 300 base pairs long and are therefore classified as short interspersed elements (SINEs) among the class of repetitive DNA elements. The typical structure is
5'Part A- A5TACA6 -Part B - PolyA Tail - 3'
where Part A and Part B are similar peptide sequences, but of opposite direction. Expressed another way, it is believed modern Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers)over 100 mkya. Hence its dimeric structure of two similar but distinct monomers (left and right arms, and in opposite directions)joined by an A-rich linker.[2] The length of the polyA tail varies between Alu families.
There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However less than 0.5% are polymorphic.[3] In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ and AluS, and other Alu subfamilies were also independently discovered by several groups.[4] Later on, a sub-subfamily of AluS which included active Alu elements was given a separate name AluY. The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements).
[edit] 7SL RNA
The sequence of the DNA for the 299 nucleotide long 7SL RNA [5]:
gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgAGGCTGgaGGATCGcttgAGTCCAggAGTTCTgggct gtagtgcgctatgccgatcgggtgtccgcactaagttcggcatcaatatggtgacctcccgggagcgggggaccaccaggttgcctaagga ggggtgaaccggcccaggtcggaaacggagcaggtcaaaactcccgtgctgatcagtagtgggatcgcgcctgtgaatagccactgcactc cagcctgggcaacatagcgagaccccgtctct
The functional retinoic acid response element hexamer sites [6] are in upper case and overlap the internal transcriptional promoter. The recognition sequence of the Alu endonuclease is 5' AG/CT 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues (in bold above). The Alu endonuclease is so-named because it was isolated from Arthrobacter luteus.
[edit] Alu elements
Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. Alu elements do not encode for protein products and depend on LINE retrotransposons for their replication.[7]
Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of Alu elements thus reveals details of ancestry because individuals will only share a particular Alu element insertion if they have a common ancestor.
Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans.[8]
[edit] Impact of Alu in humans
Alu elements are a common source of mutation in humans, but such mutations are often confined to non-coding regions where they have little discernible impact on the bearer[citation needed]. However, the variation generated can be used in studies of the movement and ancestry of human populations[citation needed], and the mutagenic effect of Alu[9] and retrotransposons in general[10] has played a major role in the recent evolution of the human genome. There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans:
[edit] Associations with human disease
Alu insertions are sometimes disruptive and can result in inherited disorders. However, most Alu variation acts as markers that segregate with the disease so the presence of a particular Alu allele does not mean that the carrier will definitely get the disease. The first report of Alu-mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer.[11]
The following human diseases have been linked with Alu insertions:[12]
- Breast cancer
- Ewing's sarcoma
- Familial hypercholesterolemia
- Hemophilia
- Neurofibromatosis
- Diabetes mellitus type II
And the following diseases have been associated with single-nucleotide DNA variations in Alu elements impacting transcription levels[13]:
[edit] Other alu-associated human mutations
- The ACE gene, encoding angiotensin-converting enzyme, has 2 common variants, one with an Alu insertion (ACE-I) and one with the Alu deleted (ACE-D). This variation has been linked to changes in sporting ability: the presence of the Alu element is associated with better performance in endurance-oriented events (e.g. triathlons), whereas its absence is associated with strength- and power-oriented performance[14]
- The opsin gene duplication which resulted in the re-gaining of trichromacy in Old World primates (including humans) is flanked by an Alu element[15], implicating the role of Alu in the evolution of three colour vision.
[edit] References
- ^ Kriegs JO, Churakov G, Jurka J, Brosius J, Schmitz J (April 2007). "Evolutionary history of 7SL RNA-derived SINEs in Supraprimates". Trends Genet. 23 (4): 158–61. doi:10.1016/j.tig.2007.02.002. PMID 17307271. http://zmbe2.uni-muenster.de/expath/articles/31_Kriegs_TiG.pdf.
- ^ Hasler J, Strub K, (2006). "Alu elements as regulators of gene expression". Nucleic Acids Research 34 (19): 5491–5497.
- ^ Roy-Engel AM, Carroll ML, Vogel E, et al. (September 2001). "Alu insertion polymorphisms for the study of human genomic diversity". Genetics 159 (1): 279–90. PMC 1461783. PMID 11560904. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1461783.
- ^ Jurka J and Smith T' (July 1988). "A fundamental division in the Alu family of repeated sequences". Proceedings of the National Academy of Sciences 85 (July): 279–90.
- ^ "NCBI Genbank DNA encoding 7SL RNA". http://www.ncbi.nlm.nih.gov/nuccore/NR_002715.1.
- ^ Vansant G and Reynolds WF (August 1995). "The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element". Proc. Natl. Acad. Sci. USA 92 (18): 8229–8233. doi:10.1073/pnas.92.18.8229. PMC 41130. PMID 7667273. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=41130.
- ^ Kramerov DA, Vassetzky NS (2005). "Short retroposons in eukaryotic genomes". Int. Rev. Cytol. 247: 165–221. doi:10.1016/S0074-7696(05)47004-7. PMID 16344113.
- ^ And Analysis Consortium, The Chimpanzee Sequencing (September 2005). "Initial sequence of the chimpanzee genome and comparison with the human genome". Nature 437 (7055): 69–87. doi:10.1038/nature04072. PMID 16136131. http://www.nature.com/nature/journal/v437/n7055/full/nature04072.html.
- ^ Shen S, Lin L, Cai JJ, Jiang P, Kenkel EJ, Stroik MR, Sato S, Davidson BL, Xing Y (2011). "Widespread establishment and regulatory impact of Alu exons in human genes". PNAS 108 (7): 2837–42. doi:10.1073/pnas.1012834108. http://www.pnas.org/content/108/7/2837.
- ^ Cordaux R, Batzer MA (2009). "The impact of retrotransposons on human genome evolution". Nature Reviews Genetics 10: 691–703. doi:10.1038/nrg2640. PMC 2884099. PMID 19763152. http://rcordaux.voila.net/pdfs/42.pdf.
- ^ Nyström-Lahti M, Kristo P, Nicolaides NC, et al. (November 1995). "Founding mutations and Alu-mediated recombination in hereditary colon cancer". Nat. Med. 1 (11): 1203–6. doi:10.1038/nm1195-1203. PMID 7584997.
- ^ Batzer MA, Deininger PL (May 2002). "Alu repeats and human genomic diversity". Nat. Rev. Genet. 3 (5): 370–9. doi:10.1038/nrg798. PMID 11988762. http://batzerlab.lsu.edu/Publications/Batzer%20and%20Deininger%202002%20Nature%20Reviews%20Genetics.pdf.
- ^ "SNPedia: SNP in the promoter region of the myeloperoxidase MPO gene". http://www.snpedia.com/index.php/Rs2333227.
- ^ Puthucheary Z, Skipworth J, Rawal J, Loosemore M, Van Someren K, Montgomery H (2011). "The ACE Gene and Human Performance: 12 Years On". Sports Medicine 41: 433–448. doi:10.2165/11588720-000000000-00000. PMID 21615186.
- ^ "The Evolution of Trichromatic Color Vision by Opsin Gene Duplication in New World and Old World Primates". Genome Research: 629–638. 1999. doi:10.1101/gr.9.7.629. PMID 10413401. http://genome.cshlp.org/content/9/7/629.full.
[edit] External links
- MeSH Alu+Repetitive+Sequences
- AF-1(Alu Finder):A web server to find Alu elements in primate genomes.
|
||||||||||||||||||||||||||