Guide RNA: Difference between revisions

Content deleted Content added

Inline

Revision as of 21:27, 24 February 2024

Guide RNA (gRNA) or singel guide RNA (sgRNA) is a short sequence of RNA that functions as a guide for the Cas9-endonuclease or other Cas-proteins^[1] that cut the double-stranded DNA and thereby can be used for gene editing.^[2] In bacteria and archaea, gRNAs are a part of the CRISPR-Cas system that serves as an adaptive immune defense that protects the organism from viruses. Here the short gRNAs serve as detectors of foreign DNA and direct the Cas-enzymes that degrades the foreign nucleic acid.^[1]^[3]

History

RNA-editing Guide RNA was discovered in 1990 by B. Blum, N. Bakalara, and L. Simpson in the eukaryotic parasite, Leishmania tarentolaes mitochondrial maxicircle DNA, by Northern Blot Hybridization.^[4] Furthermore, several studies have been carried out to determine the structure and function of gRNA and the CRISPR-Cas system in the mid-2000s and the years to follow,^[2] with the most notable breakthrough in 2012, when it was discovered that gRNA can be used to guide a Cas9 endonuclease to introduce target specific breaks in double-stranded DNA. This discovery led to a nobels price for Jennifer Doudna and Emmanuelle Charpentier in 2020.^[3]

Guide RNA in Protists

Trypanosomatid protists and other kinetoplastids have a post-transcriptional RNA modification process known as "RNA editing" that performs a uridine insertion/deletion inside the mitochondria.^[5]^[6] This mitochondrial DNA is circular and is divided into maxicircles and minicircles. A mitochondrion contains about 50 maxicircles which have both coding and non coding regions and consists of approximately 20 kb. The coding region is highly conserved (16-17kb) and the non-coding region varies depending on the species. Minicircles are small (around 1 kb) but more numerous than maxicircles, a mitochondrion contains several thousands minicircles.^[7]^[8]^[9] Maxicircles can encode "cryptogenes" and some gRNAs; minicircles can encode the majority of gRNAs. Some gRNA genes show identical insertion and deletion sites even if they have different sequences, whereas other gRNA sequences are not complementary to pre-edited mRNA. Maxicircles and minicircles molecules are catenated into a giant network of DNA inside the mitochondrion.^[4]^[9]^[10]

The majority of maxicircle transcripts cannot be translated into proteins due to frameshifts in their sequences. These frameshifts are corrected post-transcriptionally through the insertion and deletion of uridine residues at precise sites, which then create an open reading frame. This open reading frame is subsequently translated into a protein that is homologous to mitochondrial proteins found in other cells.^[11] The process of uridine insertion and deletion is mediated by short guide RNAs (gRNAs),which encode the editing information through complementary sequences, and allow for base pairing between guanine and uracil (GU) as well as between guanine and cytosine (GC), facilitating the editing process.^[12]

The function of the gRNA-mRNA Complex

Guide RNAs are mainly transcribed from the intergenic region of DNA maxicircle and have sequences complementary to mRNA. The 3' end of gRNAs contains an oligo 'U' tail (5-24 nucleotides in length) which is in a nonencoded region but interacts and forms a stable complex with A and G rich regions of pre-edited mRNA and gRNA, that are thermodynamically stabilized by a 5' and 3' anchors.^[13] This initial hybrid helps in the recognition of specific mRNA site to be edited.^[14]

RNA editing typically progresses from the 3' to the 5' end on the mRNA. The initial editing process begins when a gRNA forms an RNA duplex with a complementary mRNA sequence located just downstream of the editing site. This pairing recruits a number of ribonucleoprotein complexes that direct the cleavage of the first mismatched base adjacent to the gRNA-mRNA anchor. Following this, Uridylyltransferase inserts a 'U' at the 3' end, and RNA ligase then joins the two severed ends. The process repeats at the next upstream editing site in a similar manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of sequential editing is known as the enzyme cascade model.^[14]^[12]^[15]

In the case of "pan-edited" mRNAs,^[16] the duplex unwinds and another gRNA forms a duplex with the edited mRNA sequence, initiating another round of editing. These overlapping gRNAs form an editing "domain". Some genes contain multiple editing domains.^[17] The extent of editing for any particular gene varies among trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition ^[18] model has been proposed to explain the partial, and in some cases, complete loss of editing through evolution. Although the loss of editing is typically lethal, such losses have been observed in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.^[16]

It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It might have originated in the early mitochondria of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids,^[19] and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.

Guide RNA sequences

In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:

mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5'   A  A   AGAAA   A G  G C UUUAACUUCAGGUUGU 3'

The mRNA is now "repaired" by adding U's at each editing site in succession, giving the following sequence:

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).^[4]

Guide RNA in Prokaryotes

CRISPR In Prokaryotes

Prokaryotes as bacteria and archaea, use CRISPR (clustered regularly interspaced short palindromic repeats) and its associated Cas enzymes, as their adaptive immune system. When prokaryotes are infected by phages, and manage to fend off the attack, specific Cas enzymes cut the phage DNA (or RNA) and integrate the fragments into the CRISPR sequence interspaces. These stored segments are then recognized during future virus attacks, allowing Cas enzymes to use RNA copies of these segments, along with their associated CRISPR sequences, as gRNA to identify and neutralize the foreign sequences.^[20]^[21]^[22]

Structure

Guide RNA targets the complementary sequences by simple Watson-Crick base pairing.^[23] In the type II CRISPR/cas system, the sgRNA directs the Cas-enzyme to target specific regions in the genome for targeted DNA cleavage. The sgRNA is an artificially engineered combination of two RNA molecules: CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The crRNA component is responsible for binding to the target-specific DNA region, while the tracrRNA component is responsible for the activation of the Cas9 endonuclease activity. These two components are linked by a short tetraloop structure, resulting in the formation of the sgRNA. The tracrRNA consist of base pairs that form a stem-loop structure, enabling its attachment to the endonuclease enzyme. The transcription of the CRISPR locus generates crRNA, which contains spacer regions flanked by repeat sequences, typically 18-20 base pairs in length. This crRNA guides the Cas9 endonuclease to the complementary target region on the DNA, where it cleaves the DNA, forming what is known as the effector complex. Modifications in the crRNA sequence within the sgRNA can alter the binding location, allowing for precise targeting of different DNA regions, effectively making it a programmable system for genome editing.^[24]^[25]^[26]

Applications

Designing gRNAs

The targeting specificity of CRISPR-Cas9 is determined by the 20-nt sequence at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif (PAM) which is a short DNA sequence usually 2-6 base pairs in length that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site. After base pairing of the gRNA to the target, Cas9 mediates a double-strand break about 3-nt upstream of PAM.

The GC content of the guide sequence should be 40-80%. High GC content stabilizes the RNA-DNA duplex while destabilizing off-target hybridization. The length of the guide sequence should be between 17-24bp noting a shorter sequence minimizes off-target effects. Guide sequences less than 17bp have a chance of targeting multiple loci.

CRISPR Cas9

CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas9 is a technique used for gene editing and gene therapy. Cas is an endonuclease enzyme that cuts the DNA at a specific location directed by a guide RNA. This is a target-specific technique that can introduce gene knock out or knock in depending on the double strand repair pathway. Evidence shows that both in-vitro and in-vivo required tracrRNA for Cas9 and target DNA sequence binding. The CRISPR CAS9 system consists of three main stages. The first stage is extension of bases in the CRISPR locus region by addition of foreign DNA spacers in the genome sequence. Several different proteins, like cas1 and cas2, help in finding new spacers. The next stage involves transcription of CRISPR: pre-crRNA (precursor CRISPR RNA) are expressed by the transcription of CRISPR repeat-spacer array. On further modification in the pre-crRNA, they are converted to single spacer flanked regions forming short crRNA. RNA maturation process is similar in type I and II but different in type III, aRNA as tracers are added in this step. The third stage involves binding of cas9 protein and directing it to cleave the DNA segment. The Cas9 protein binds to a combined form of crRNA and tracrRNA forming an effector complex. This act as guide RNA for cas9 protein directing it for its endonuclease activity.^[27]

RNA mutagenesis

One important gene regulation method is RNA mutagenesis which can be introduced by RNA editing with the help of gRNA.^[28] Guide RNA replaces adenosine with inosine at the specific target site and modify the genetic code.^[29] Adenosine deaminase acts on RNA bringing post transcriptional modification by altering the codons and different protein functions. Guide RNAs are the small nucleolar RNA, these along with riboproteins perform intracellular RNA alterations such as ribomethylation in rRNA and introduction of pseudouridine in preribosomal RNA.^[30] Guide RNAs binds to the anti sense RNA sequence and regulates the RNA modification. It is observed that small interfering RNA (siRNA) and micro RNA (miRNA) are generally used as target RNA sequence and modifications are comparatively easy to introduce because of small size.^[31]

References

^ ^a ^b Mali, Prashant; Yang, Luhan; Esvelt, Kevin M.; Aach, John; Guell, Marc; DiCarlo, James E.; Norville, Julie E.; Church, George M. (2013-02-15). "RNA-guided human genome engineering via Cas9". Science. 339 (6121): 823–826. Bibcode:2013Sci...339..823M. doi:10.1126/science.1232033. ISSN 1095-9203. PMC 3712628. PMID 23287722.
^ ^a ^b Doudna, Jennifer A.; Charpentier, Emmanuelle (2014-11-28). "The new frontier of genome engineering with CRISPR-Cas9". Science. 346 (6213). doi:10.1126/science.1258096. ISSN 0036-8075. PMID 25430774.
^ ^a ^b Jinek, Martin; Chylinski, Krzysztof; Fonfara, Ines; Hauer, Michael; Doudna, Jennifer A.; Charpentier, Emmanuelle (2012-08-17). "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity". Science. 337 (6096): 816–821. Bibcode:2012Sci...337..816J. doi:10.1126/science.1225829. ISSN 1095-9203. PMC 6286148. PMID 22745249.
^ ^a ^b ^c Blum, B.; Bakalara, N.; Simpson, L. (1990-01-26). "A model for RNA editing in kinetoplastid mitochondria: "guide" RNA molecules transcribed from maxicircle DNA provide the edited information". Cell. 60 (2): 189–198. doi:10.1016/0092-8674(90)90735-w. ISSN 0092-8674. PMID 1688737. S2CID 19656609.
^ Simpson, Larry; Sbicego, Sandro; Aphasizhev, Ruslan (2003-03-01). "Uridine insertion/deletion RNA editing in trypanosome mitochondria: A complex business". RNA. 9 (3): 265–276. doi:10.1261/rna.2178403. ISSN 1355-8382. PMC 1370392. PMID 12591999.
^ Li, Feng; Ge, Peng; Hui, Wong H.; Atanasov, Ivo; Rogers, Kestrel; Guo, Qiang; Osato, Daren; Falick, Arnold M.; Zhou, Z. Hong; Simpson, Larry (2009-07-28). "Structure of the core editing complex (L-complex) involved in uridine insertion/deletion RNA editing in trypanosomatid mitochondria". Proceedings of the National Academy of Sciences of the United States of America. 106 (30): 12306–12310. Bibcode:2009PNAS..10612306L. doi:10.1073/pnas.0901754106. ISSN 1091-6490. PMC 2708173. PMID 19590014.
^ Estévez, Antonio M.; Simpson, Larry (November 1999). "Uridine insertion/deletion RNA editing in trypanosome mitochondria — a review". Gene. 240 (2): 247–260. doi:10.1016/S0378-1119(99)00437-0. PMID 10580144.
^ Ochsenreiter, Torsten; Cipriano, Michael; Hajduk, Stephen L. (2007-01-01). "KISS: The kinetoplastid RNA editing sequence search tool". RNA. 13 (1): 1–4. doi:10.1261/rna.232907. ISSN 1355-8382. PMC 1705751. PMID 17123956.
^ ^a ^b Cooper, Sinclair; Wadsworth, Elizabeth S; Ochsenreiter, Torsten; Ivens, Alasdair; Savill, Nicholas J; Schnaufer, Achim (2019-10-30). "Assembly and annotation of the mitochondrial minicircle genome of a differentiation-competent strain of Trypanosoma brucei". Nucleic Acids Research. 47 (21): 11304–11325. doi:10.1093/nar/gkz928. ISSN 0305-1048. PMC 6868439. PMID 31665448.
^ Blom, Daniël; Haan, Annett De; Burg, Janny Van Den; Berg, Marlene Van Den; Sloof, Paul; Jirku, Milan; Lukes, Julius; Benne, Rob (January 2000). "Mitochondrial minicircles in the free-living bodonid Bodo saltans contain two gRNA gene cassettes and are not found in large networks". RNA. 6 (1): 121–135. doi:10.1017/S1355838200992021. ISSN 1355-8382. PMC 1369900. PMID 10668805.
^ Read, L K; Myler, P J; Stuart, K (January 1992). "Extensive editing of both processed and preprocessed maxicircle CR6 transcripts in Trypanosoma brucei". Journal of Biological Chemistry. 267 (2): 1123–1128. doi:10.1016/s0021-9258(18)48405-0. ISSN 0021-9258. PMID 1730639.
^ ^a ^b Aphasizhev, Ruslan; Aphasizheva, Inna (September 2011). "Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer". WIREs RNA. 2 (5): 669–685. doi:10.1002/wrna.82. ISSN 1757-7004. PMC 3154072. PMID 21823228.
^ Blum, Beat; Simpson, Larry (July 1990). "Guide RNAs in kinetoplastid mitochondria have a nonencoded 3′ oligo(U) tail involved in recognition of the preedited region". Cell. 62 (2): 391–397. doi:10.1016/0092-8674(90)90375-o. ISSN 0092-8674. PMID 1695552. S2CID 2181338.
^ ^a ^b Connell, Gregory J.; Byrne, Elaine M.; Simpson, Larry (1997-02-14). "Guide RNA-independent and Guide RNA-dependent Uridine Insertion into Cytochrome b mRNA in a Mitochondrial Lysate from Leishmania tarentolae ROLE OF RNA SECONDARY STRUCTURE". Journal of Biological Chemistry. 272 (7): 4212–4218. doi:10.1074/jbc.272.7.4212. ISSN 0021-9258. PMID 9020135.
^ Byrne, E. M.; Connell, G. J.; Simpson, L. (1996-12). "Guide RNA-directed uridine insertion RNA editing in vitro". The EMBO Journal. 15 (23): 6758–6765. doi:10.1002/j.1460-2075.1996.tb01065.x. ISSN 0261-4189. {{cite journal}}: Check date values in: |date= (help)
^ ^a ^b Maslov, Dmitri A. (October 2010). "Complete set of mitochondrial pan-edited mRNAs in Leishmania mexicana amazonensis LV78". Molecular and Biochemical Parasitology. 173 (2): 107–114. doi:10.1016/j.molbiopara.2010.05.013. ISSN 0166-6851. PMC 2913609. PMID 20546801.
^ Maslov, Dmitri A.; Simpson, Larry (1992-08). "The polarity of editing within a multiple gRNA-mediated domain is due to formation of anchors for upstream gRNAs by downstream editing". Cell. 70 (3): 459–467. doi:10.1016/0092-8674(92)90170-H. {{cite journal}}: Check date values in: |date= (help)
^ Brosius, Jürgen (2003), "The contribution of RNAs and retroposition to evolutionary novelties", Contemporary Issues in Genetics and Evolution, Dordrecht: Springer Netherlands, pp. 99–116, ISBN 978-94-010-3982-6, retrieved 2024-02-24
^ Deschamps, P.; Lara, E.; Marande, W.; Lopez-Garcia, P.; Ekelund, F.; Moreira, D. (2010-10-28). "Phylogenomic Analysis of Kinetoplastids Supports That Trypanosomatids Arose from within Bodonids". Molecular Biology and Evolution. 28 (1): 53–58. doi:10.1093/molbev/msq289. ISSN 0737-4038.
^ Wiedenheft, Blake; Sternberg, Samuel H.; Doudna, Jennifer A. (2012-02). "RNA-guided genetic silencing systems in bacteria and archaea". Nature. 482 (7385): 331–338. doi:10.1038/nature10886. ISSN 1476-4687. {{cite journal}}: Check date values in: |date= (help)
^ Bhaya, Devaki; Davison, Michelle; Barrangou, Rodolphe (2011). "CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation". Annual Review of Genetics. 45: 273–297. doi:10.1146/annurev-genet-110410-132430. ISSN 1545-2948. PMID 22060043.
^ Terns, Michael P.; Terns, Rebecca M. (2011-06). "CRISPR-based adaptive immune systems". Current Opinion in Microbiology. 14 (3): 321–327. doi:10.1016/j.mib.2011.03.005. ISSN 1879-0364. PMC 3119747. PMID 21531607. {{cite journal}}: Check date values in: |date= (help)
^ Stuart, Kenneth D.; Schnaufer, Achim; Ernst, Nancy Lewis; Panigrahi, Aswini K. (February 2005). "Complex management: RNA editing in trypanosomes". Trends in Biochemical Sciences. 30 (2): 97–105. doi:10.1016/j.tibs.2004.12.006. ISSN 0968-0004. PMID 15691655.
^ Jiang, Fuguo; Doudna, Jennifer A. (2017-05-22). "CRISPR–Cas9 Structures and Mechanisms". Annual Review of Biophysics. 46 (1): 505–529. doi:10.1146/annurev-biophys-062215-010822. ISSN 1936-122X.
^ Chylinski, Krzysztof; Makarova, Kira S.; Charpentier, Emmanuelle; Koonin, Eugene V. (2014-04-11). "Classification and evolution of type II CRISPR-Cas systems". Nucleic Acids Research. 42 (10): 6091–6105. doi:10.1093/nar/gku241. ISSN 1362-4962. PMC 4041416. PMID 24728998.{{cite journal}}: CS1 maint: PMC format (link)
^ Chylinski, Krzysztof; Le Rhun, Anaïs; Charpentier, Emmanuelle (2013-05). "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems". RNA Biology. 10 (5): 726–737. doi:10.4161/rna.24321. ISSN 1547-6286. PMC 3737331. PMID 23563642. {{cite journal}}: Check date values in: |date= (help)CS1 maint: PMC format (link)
^ Karvelis, Tautvydas; Gasiunas, Giedrius; Miksys, Algirdas; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus (2013-05-01). "crRNA and tracrRNA guide Cas9-mediated DNA interference in Streptococcus thermophilus". RNA Biology. 10 (5): 841–851. doi:10.4161/rna.24203. ISSN 1547-6286. PMC 3737341. PMID 23535272.
^ Bass, Brenda L. (2002). "RNA editing by adenosine deaminases that act on RNA". Annual Review of Biochemistry. 71: 817–846. doi:10.1146/annurev.biochem.71.110601.135501. ISSN 0066-4154. PMC 1823043. PMID 12045112.
^ Fukuda, Masatora; Umeno, Hiromitsu; Nose, Kanako; Nishitarumizu, Azusa; Noguchi, Ryoma; Nakagawa, Hiroyuki (2017-02-02). "Construction of a guide-RNA for site-directed RNA mutagenesis utilising intracellular A-to-I RNA editing". Scientific Reports. 7: 41478. Bibcode:2017NatSR...741478F. doi:10.1038/srep41478. ISSN 2045-2322. PMC 5288656. PMID 28148949.
^ Maden, B. E. (1990). "The numerous modified nucleotides in eukaryotic ribosomal RNA". Progress in Nucleic Acid Research and Molecular Biology. 39: 241–303. doi:10.1016/s0079-6603(08)60629-7. ISBN 978-0-12-540039-8. ISSN 0079-6603. PMID 2247610.
^ Ha, Minju; Kim, V. Narry (August 2014). "Regulation of microRNA biogenesis". Nature Reviews. Molecular Cell Biology. 15 (8): 509–524. doi:10.1038/nrm3838. ISSN 1471-0080. PMID 25027649.

@@ Line 15: / Line 15: @@
 [[Trypanosomatid]] protists and other [[Kinetoplastida|kinetoplastids]] have a post-transcriptional RNA modification process known as "RNA editing" that performs a [[uridine]] insertion/deletion inside the [[Mitochondrion|mitochondria]].<ref>{{Cite journal |last1=Simpson |first1=Larry |last2=Sbicego |first2=Sandro |last3=Aphasizhev |first3=Ruslan |date=2003-03-01 |title=Uridine insertion/deletion RNA editing in trypanosome mitochondria: A complex business |url=http://rnajournal.cshlp.org/content/9/3/265 |journal=RNA |language=en |volume=9 |issue=3 |pages=265–276 |doi=10.1261/rna.2178403 |issn=1355-8382 |pmc=1370392 |pmid=12591999}}</ref><ref>{{Cite journal |last1=Li |first1=Feng |last2=Ge |first2=Peng |last3=Hui |first3=Wong H. |last4=Atanasov |first4=Ivo |last5=Rogers |first5=Kestrel |last6=Guo |first6=Qiang |last7=Osato |first7=Daren |last8=Falick |first8=Arnold M. |last9=Zhou |first9=Z. Hong |last10=Simpson |first10=Larry |date=2009-07-28 |title=Structure of the core editing complex (L-complex) involved in uridine insertion/deletion RNA editing in trypanosomatid mitochondria |journal=Proceedings of the National Academy of Sciences of the United States of America |volume=106 |issue=30 |pages=12306–12310 |doi=10.1073/pnas.0901754106 |doi-access=free |issn=1091-6490 |pmc=2708173 |pmid=19590014|bibcode=2009PNAS..10612306L }}</ref> This mitochondrial DNA is circular and is divided into maxicircles and minicircles. A mitochondrion contains about 50 [[maxicircle]]s which have both coding and non coding regions and consists of approximately 20 kb. The coding region is highly conserved (16-17kb) and the non-coding region varies depending on the species. Minicircles are small (around 1 kb) but more numerous than maxicircles, a mitochondrion contains several thousands minicircles.<ref>{{Cite journal |last1=Estévez |first1=Antonio M. |last2=Simpson |first2=Larry |date=November 1999 |title=Uridine insertion/deletion RNA editing in trypanosome mitochondria — a review |url=https://linkinghub.elsevier.com/retrieve/pii/S0378111999004370 |journal=Gene |language=en |volume=240 |issue=2 |pages=247–260 |doi=10.1016/S0378-1119(99)00437-0|pmid=10580144 }}</ref><ref>{{Cite journal |last1=Ochsenreiter |first1=Torsten |last2=Cipriano |first2=Michael |last3=Hajduk |first3=Stephen L. |date=2007-01-01 |title=KISS: The kinetoplastid RNA editing sequence search tool |url=http://rnajournal.cshlp.org/content/13/1/1 |journal=RNA |language=en |volume=13 |issue=1 |pages=1–4 |doi=10.1261/rna.232907 |issn=1355-8382 |pmc=1705751 |pmid=17123956}}</ref><ref name=":2">{{Cite journal |last1=Cooper |first1=Sinclair |last2=Wadsworth |first2=Elizabeth S |last3=Ochsenreiter |first3=Torsten |last4=Ivens |first4=Alasdair |last5=Savill |first5=Nicholas J |last6=Schnaufer |first6=Achim |date=2019-10-30 |title=Assembly and annotation of the mitochondrial minicircle genome of a differentiation-competent strain of Trypanosoma brucei |url=https://doi.org/10.1093/nar/gkz928 |journal=Nucleic Acids Research |volume=47 |issue=21 |pages=11304–11325 |doi=10.1093/nar/gkz928 |issn=0305-1048 |pmc=6868439 |pmid=31665448}}</ref> Maxicircles can encode "[[cryptogene]]s" and some gRNAs; minicircles can encode the majority of gRNAs. Some gRNA genes show identical insertion and deletion sites even if they have different sequences, whereas other gRNA sequences are not complementary to pre-edited mRNA. Maxicircles and minicircles molecules are catenated into a giant network of DNA inside the mitochondrion.<ref name=":1" /><ref name=":2" /><ref>{{Cite journal |last1=Blom |first1=Daniël |last2=Haan |first2=Annett De |last3=Burg |first3=Janny Van Den |last4=Berg |first4=Marlene Van Den |last5=Sloof |first5=Paul |last6=Jirku |first6=Milan |last7=Lukes |first7=Julius |last8=Benne |first8=Rob |date=January 2000 |title=Mitochondrial minicircles in the free-living bodonid Bodo saltans contain two gRNA gene cassettes and are not found in large networks |journal=RNA |language=en |volume=6 |issue=1 |pages=121–135 |doi=10.1017/S1355838200992021 |issn=1355-8382 |pmc=1369900 |pmid=10668805}}</ref>
-The majority of maxicircle transcripts cannot be translated into proteins due to [[Frameshift mutation|frameshifts]] in their sequences. These frameshifts are corrected post-transcriptionally through the insertion and deletion of uridine residues at precise sites, which then create an [[open reading frame]]. This open reading frame is subsequently translated into a protein that is homologous to mitochondrial proteins found in other cells.<ref>{{Cite journal |last1=Read |first1=L K |last2=Myler |first2=P J |last3=Stuart |first3=K |date=January 1992 |title=Extensive editing of both processed and preprocessed maxicircle CR6 transcripts in Trypanosoma brucei. |url=https://doi.org/10.1016/S0021-9258(18)48405-0 |journal=Journal of Biological Chemistry |volume=267 |issue=2 |pages=1123–1128 |doi=10.1016/s0021-9258(18)48405-0 |pmid=1730639 |issn=0021-9258}}</ref> The process of uridine insertion and deletion is mediated by short guide RNAs (gRNAs),which encode the editing information through complementary sequences, and allow for base pairing between guanine and uracil (GU) as well as between guanine and cytosine (GC), facilitating the editing process.<ref>{{Cite journal |last1=Aphasizhev |first1=Ruslan |last2=Aphasizheva |first2=Inna |date=September 2011 |title=Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer |journal=WIREs RNA |language=en |volume=2 |issue=5 |pages=669–685 |doi=10.1002/wrna.82 |issn=1757-7004 |pmc=3154072 |pmid=21823228}}</ref>
+The majority of maxicircle transcripts cannot be translated into proteins due to [[Frameshift mutation|frameshifts]] in their sequences. These frameshifts are corrected post-transcriptionally through the insertion and deletion of uridine residues at precise sites, which then create an [[open reading frame]]. This open reading frame is subsequently translated into a protein that is homologous to mitochondrial proteins found in other cells.<ref>{{Cite journal |last1=Read |first1=L K |last2=Myler |first2=P J |last3=Stuart |first3=K |date=January 1992 |title=Extensive editing of both processed and preprocessed maxicircle CR6 transcripts in Trypanosoma brucei. |url=https://doi.org/10.1016/S0021-9258(18)48405-0 |journal=Journal of Biological Chemistry |volume=267 |issue=2 |pages=1123–1128 |doi=10.1016/s0021-9258(18)48405-0 |pmid=1730639 |issn=0021-9258}}</ref> The process of uridine insertion and deletion is mediated by short guide RNAs (gRNAs),which encode the editing information through complementary sequences, and allow for base pairing between guanine and uracil (GU) as well as between guanine and cytosine (GC), facilitating the editing process.<ref name=":3">{{Cite journal |last1=Aphasizhev |first1=Ruslan |last2=Aphasizheva |first2=Inna |date=September 2011 |title=Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer |journal=WIREs RNA |language=en |volume=2 |issue=5 |pages=669–685 |doi=10.1002/wrna.82 |issn=1757-7004 |pmc=3154072 |pmid=21823228}}</ref>
-=== gRNA-mRNA Complex ===
+=== The function of the gRNA-mRNA Complex ===
 Guide RNAs are mainly transcribed from the intergenic region of DNA maxicircle and have sequences complementary to mRNA. The 3' end of gRNAs contains an oligo 'U' tail (5-24 nucleotides in length) which is in a nonencoded region but interacts and forms a stable complex with A and G rich regions of pre-edited mRNA and gRNA, that are thermodynamically stabilized by a 5' and 3' anchors.<ref>{{Cite journal |last1=Blum |first1=Beat |last2=Simpson |first2=Larry |date=July 1990 |title=Guide RNAs in kinetoplastid mitochondria have a nonencoded 3′ oligo(U) tail involved in recognition of the preedited region |url=http://dx.doi.org/10.1016/0092-8674(90)90375-o |journal=Cell |volume=62 |issue=2 |pages=391–397 |doi=10.1016/0092-8674(90)90375-o |pmid=1695552 |s2cid=2181338 |issn=0092-8674}}</ref> This initial hybrid helps in the recognition of specific mRNA site to be edited.<ref name="Connell">{{Cite journal|last1=Connell|first1=Gregory J.|last2=Byrne|first2=Elaine M.|last3=Simpson|first3=Larry|date=1997-02-14|title=Guide RNA-independent and Guide RNA-dependent Uridine Insertion into Cytochrome b mRNA in a Mitochondrial Lysate from Leishmania tarentolae ROLE OF RNA SECONDARY STRUCTURE|journal=Journal of Biological Chemistry|language=en|volume=272|issue=7|pages=4212–4218|doi=10.1074/jbc.272.7.4212|issn=0021-9258|pmid=9020135|doi-access=free}}</ref>
+RNA editing typically progresses from the 3' to the 5' end on the mRNA. The initial editing process begins when a gRNA forms an RNA duplex with a complementary mRNA sequence located just downstream of the editing site. This pairing recruits a number of [[ribonucleoprotein]] complexes that direct the cleavage of the first mismatched base adjacent to the gRNA-mRNA anchor. Following this, [[Uridylyltransferase]] inserts a 'U' at the 3' end, and RNA ligase then joins the two severed ends. The process repeats at the next upstream editing site in a similar manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of sequential editing is known as the enzyme cascade model.<ref name="Connell"/><ref name=":3" /><ref>{{Cite journal |last=Byrne |first=E. M. |last2=Connell |first2=G. J. |last3=Simpson |first3=L. |date=1996-12 |title=Guide RNA-directed uridine insertion RNA editing in vitro. |url=http://dx.doi.org/10.1002/j.1460-2075.1996.tb01065.x |journal=The EMBO Journal |volume=15 |issue=23 |pages=6758–6765 |doi=10.1002/j.1460-2075.1996.tb01065.x |issn=0261-4189}}</ref>
-===Function===
-The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of [[ribonucleoprotein]] complexes that direct the cleavage of the first mismatched base adjacent to the gRNA-mRNA anchor. [[Uridylyltransferase]] inserts 'U' at 3' terminal and RNA ligase is responsible for joining two cut ends. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of modification is termed as original enzyme cascade model.<ref name="Connell"/>
-In the case of "pan-edited" mRNAs,<ref>{{Cite journal|last=Maslov|first=Dmitri A.|date=October 2010|title=Complete set of mitochondrial pan-edited mRNAs in Leishmania mexicana amazonensis LV78|journal=Molecular and Biochemical Parasitology|volume=173|issue=2|pages=107–114|doi=10.1016/j.molbiopara.2010.05.013|issn=0166-6851|pmc=2913609|pmid=20546801}}</ref> the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A [[retroposition]] model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.
+In the case of "pan-edited" mRNAs,<ref name=":4">{{Cite journal|last=Maslov|first=Dmitri A.|date=October 2010|title=Complete set of mitochondrial pan-edited mRNAs in Leishmania mexicana amazonensis LV78|journal=Molecular and Biochemical Parasitology|volume=173|issue=2|pages=107–114|doi=10.1016/j.molbiopara.2010.05.013|issn=0166-6851|pmc=2913609|pmid=20546801}}</ref> the duplex unwinds and another gRNA forms a duplex with the edited mRNA sequence, initiating another round of editing. These overlapping gRNAs form an editing "domain". Some genes contain multiple editing domains.<ref>{{Cite journal |last=Maslov |first=Dmitri A. |last2=Simpson |first2=Larry |date=1992-08 |title=The polarity of editing within a multiple gRNA-mediated domain is due to formation of anchors for upstream gRNAs by downstream editing |url=https://linkinghub.elsevier.com/retrieve/pii/009286749290170H |journal=Cell |language=en |volume=70 |issue=3 |pages=459–467 |doi=10.1016/0092-8674(92)90170-H}}</ref> The extent of editing for any particular gene varies among trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A [[retroposition]] <ref>{{Citation |last=Brosius |first=Jürgen |title=The contribution of RNAs and retroposition to evolutionary novelties |date=2003 |work=Contemporary Issues in Genetics and Evolution |pages=99–116 |url=http://dx.doi.org/10.1007/978-94-010-0229-5_1 |access-date=2024-02-24 |place=Dordrecht |publisher=Springer Netherlands |isbn=978-94-010-3982-6}}</ref> model has been proposed to explain the partial, and in some cases, complete loss of editing through evolution. Although the loss of editing is typically lethal, such losses have been observed in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.<ref name=":4" />
-It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondria of the ancestor of the kintoplastid protist lineage, since it is present in the [[Bodonida|bodonids]] which are ancestral to the trypanosomatids, and may not be present in the [[euglenoid]]s, which branched from the same common ancestor as the kinetoplastids.
+It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It might have originated in the early mitochondria of the ancestor of the kintoplastid protist lineage, since it is present in the [[Bodonida|bodonids]] which are ancestral to the trypanosomatids,<ref>{{Cite journal |last=Deschamps |first=P. |last2=Lara |first2=E. |last3=Marande |first3=W. |last4=Lopez-Garcia |first4=P. |last5=Ekelund |first5=F. |last6=Moreira |first6=D. |date=2010-10-28 |title=Phylogenomic Analysis of Kinetoplastids Supports That Trypanosomatids Arose from within Bodonids |url=https://doi.org/10.1093/molbev/msq289 |journal=Molecular Biology and Evolution |volume=28 |issue=1 |pages=53–58 |doi=10.1093/molbev/msq289 |issn=0737-4038}}</ref> and may not be present in the [[euglenoid]]s, which branched from the same common ancestor as the kinetoplastids.
+=== Guide RNA sequences ===
 In the protozoan ''Leishmania tarentolae'', 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:
  mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
@@ Line 39: / Line 39: @@
 ==Guide RNA in Prokaryotes==
 ===CRISPR In Prokaryotes===
-The majority of prokaryotes, which encompass bacteria and archaea, use [[CRISPR]] (clustered regularly interspaced short palindromic repeats) with its associated Cas enzymes, as their adaptive immune system. When prokaryotes are infected by phages, and manage to fend off the attack, specific Cas enzymes will cut the phage DNA (or RNA) and integrate the parts in between the repeats of the CRISPR sequence. The stored segments can then be recognized in future virus attacks and Cas enzymes will use RNA copies of them, together with their associated CRISPR segments, as gRNA to identify the foreign sequences and render them harmless.[[File:Schematic Structure of the Cas9-sgRNA-DNA Ternary Complex.svg|thumb|519x519px|Schematic Structure of the Cas9-sgRNA-DNA Ternary Complex]]
+Prokaryotes as bacteria and archaea, use [[CRISPR]] (clustered regularly interspaced short palindromic repeats) and its associated Cas enzymes, as their adaptive immune system. When prokaryotes are infected by phages, and manage to fend off the attack, specific Cas enzymes cut the phage DNA (or RNA) and integrate the fragments into the CRISPR sequence interspaces. These stored segments are then recognized during future virus attacks, allowing Cas enzymes to use RNA copies of these segments, along with their associated CRISPR sequences, as gRNA to identify and neutralize the foreign sequences.<ref>{{Cite journal |last=Wiedenheft |first=Blake |last2=Sternberg |first2=Samuel H. |last3=Doudna |first3=Jennifer A. |date=2012-02 |title=RNA-guided genetic silencing systems in bacteria and archaea |url=https://www.nature.com/articles/nature10886 |journal=Nature |language=en |volume=482 |issue=7385 |pages=331–338 |doi=10.1038/nature10886 |issn=1476-4687}}</ref><ref>{{Cite journal |last=Bhaya |first=Devaki |last2=Davison |first2=Michelle |last3=Barrangou |first3=Rodolphe |date=2011 |title=CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation |url=https://pubmed.ncbi.nlm.nih.gov/22060043 |journal=Annual Review of Genetics |volume=45 |pages=273–297 |doi=10.1146/annurev-genet-110410-132430 |issn=1545-2948 |pmid=22060043}}</ref><ref>{{Cite journal |last=Terns |first=Michael P. |last2=Terns |first2=Rebecca M. |date=2011-06 |title=CRISPR-based adaptive immune systems |url=https://pubmed.ncbi.nlm.nih.gov/21531607 |journal=Current Opinion in Microbiology |volume=14 |issue=3 |pages=321–327 |doi=10.1016/j.mib.2011.03.005 |issn=1879-0364 |pmc=3119747 |pmid=21531607}}</ref>[[File:Schematic Structure of the Cas9-sgRNA-DNA Ternary Complex.svg|thumb|519x519px|Schematic Structure of the Cas9-sgRNA-DNA Ternary Complex]]
 ===Structure===
-Guide RNA targets the complementary sequences by simple Watson-Crick base pairing.<ref>{{Cite journal |last1=Stuart |first1=Kenneth D. |last2=Schnaufer |first2=Achim |last3=Ernst |first3=Nancy Lewis |last4=Panigrahi |first4=Aswini K. |date=February 2005 |title=Complex management: RNA editing in trypanosomes |url=https://doi.org/10.1016/j.tibs.2004.12.006 |journal=Trends in Biochemical Sciences |volume=30 |issue=2 |pages=97–105 |doi=10.1016/j.tibs.2004.12.006 |pmid=15691655 |issn=0968-0004}}</ref> In type II CRISPR/cas system, single guide RNA (sgRNA) directs the target specific regions. sgRNA is an artificially programmed combination of two RNA molecules as one RNA strand. One component of sgRNA, CRISPR RNA ([[CRISPR RNA|crRNA]]), binds to the target-specific DNA region and the other part, Trans-activating crRNA ([[Trans-activating crRNA|tracrRNA]]), is responsible for Cas9 endonuclease activity. Therefore, the tracrRNA and crRNA, are two key components and are joined by a tetraloop structure which results in formation of sgRNA. tracrRNA consist of base pairs resulting a [[Stem-loop|stem loop]] structure in itself and can be attached to the [[endonuclease]] enzyme. Transcription of CRISPR locus gives crRNA which have spacer flanked regions due to repeat sequences, consisting of 18-20 base pairs. crRNA identifies the specific complementary target region which is cleaved by Cas9 after its binding with crRNA and tracrRNA, which all together known as effector complex. With the modifications in the crRNA sequences of the guide RNA, the binding location can be changed and hence defining it as a user-defined program.
+Guide RNA targets the complementary sequences by simple Watson-Crick base pairing.<ref>{{Cite journal |last1=Stuart |first1=Kenneth D. |last2=Schnaufer |first2=Achim |last3=Ernst |first3=Nancy Lewis |last4=Panigrahi |first4=Aswini K. |date=February 2005 |title=Complex management: RNA editing in trypanosomes |url=https://doi.org/10.1016/j.tibs.2004.12.006 |journal=Trends in Biochemical Sciences |volume=30 |issue=2 |pages=97–105 |doi=10.1016/j.tibs.2004.12.006 |pmid=15691655 |issn=0968-0004}}</ref> In the type II CRISPR/cas system, the sgRNA directs the Cas-enzyme to target specific regions in the genome for targeted DNA cleavage. The sgRNA is an artificially  engineered combination of two RNA molecules: CRISPR RNA ([[CRISPR RNA|crRNA]]) and trans-activating crRNA ([[Trans-activating crRNA|tracrRNA]]). The crRNA component is responsible for binding to the target-specific DNA region, while the tracrRNA component is responsible for the activation of the Cas9 endonuclease activity. These two components are linked by a short tetraloop structure, resulting in the formation of the sgRNA. The tracrRNA consist of base pairs that form a stem-loop structure, enabling its attachment to the [[endonuclease]] enzyme. The transcription of the CRISPR locus generates crRNA, which contains spacer regions flanked by repeat sequences, typically 18-20 base pairs in length. This crRNA guides the Cas9 endonuclease to the complementary target region on the DNA, where it cleaves the DNA, forming what is known as the effector complex. Modifications in the crRNA sequence within the sgRNA can alter the binding location, allowing for precise targeting of different DNA regions, effectively making it a programmable system for genome editing.<ref>{{Cite journal |last=Jiang |first=Fuguo |last2=Doudna |first2=Jennifer A. |date=2017-05-22 |title=CRISPR–Cas9 Structures and Mechanisms |url=https://www.annualreviews.org/doi/10.1146/annurev-biophys-062215-010822 |journal=Annual Review of Biophysics |language=en |volume=46 |issue=1 |pages=505–529 |doi=10.1146/annurev-biophys-062215-010822 |issn=1936-122X}}</ref><ref>{{Cite journal |last=Chylinski |first=Krzysztof |last2=Makarova |first2=Kira S. |last3=Charpentier |first3=Emmanuelle |last4=Koonin |first4=Eugene V. |date=2014-04-11 |title=Classification and evolution of type II CRISPR-Cas systems |url=https://doi.org/10.1093/nar/gku241 |journal=Nucleic Acids Research |volume=42 |issue=10 |pages=6091–6105 |doi=10.1093/nar/gku241 |issn=1362-4962 |pmc=PMC4041416 |pmid=24728998}}</ref><ref>{{Cite journal |last=Chylinski |first=Krzysztof |last2=Le Rhun |first2=Anaïs |last3=Charpentier |first3=Emmanuelle |date=2013-05 |title=The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems |url=http://www.tandfonline.com/doi/full/10.4161/rna.24321 |journal=RNA Biology |language=en |volume=10 |issue=5 |pages=726–737 |doi=10.4161/rna.24321 |issn=1547-6286 |pmc=PMC3737331 |pmid=23563642}}</ref>
 ==Applications==