Karyorelict nuclear code
The karyorelictid nuclear code (translation table 27) is a genetic code used by the nuclear genome of the Karyorelictea ciliate Parduczia sp.[1] This code, along with translation tables 28 and 31, is remarkable in that every one of the 64 possible codons can be a sense codon. Translation termination probably relies on context, specifically proximity to the poly(A) tail.[2]
The code (27)
AAs = FFLLSSSSYYQQCCWWLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (27) | Standard code (1) | |||
|---|---|---|---|---|---|---|
TAA
|
UAA
|
Gln (Q)
|
Ter (*)
| |||
TAG
|
UAG
|
Gln (Q)
|
Ter (*)
| |||
TGA
|
UGA
|
Ter (*)
|
or | Trp (W)
|
Ter (*)
| |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [1]
- ^ a b Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 18 November 2016.
- ^ Swart, Estienne Carl; Serra, Valentina; Petroni, Giulio; Nowacki, Mariusz (2016). "Genetic Codes with No Dedicated Stop Codon: Context-Dependent Translation Termination". Cell. 166 (3): 691–702. doi:10.1016/j.cell.2016.06.020. PMC 4967479. PMID 27426948.