Haplogroup R-M479

From Wikipedia, the free encyclopedia
  (Redirected from Haplogroup R2 (Y-DNA))
Jump to: navigation, search
Haplogroup R-M479
Possible time of origin 12,000 ybp
Possible place of origin South Asia or Central Asia
Ancestor R-M207
Descendants R-M124
Defining mutations M479
Highest frequencies n/a

Haplogroup R-M479 is a Y-chromosome haplogroup characterized by genetic marker M479.


Haplogroup R-M479
Paragroup R-M479*

  Haplogroup R-M124


Paragroup R-M479*[edit]

Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.

Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.

Frequency of Paragroup R-M479* (M479+, M124-)
Count Sample size R-M479* Frequency
Portugal, Lisbon 1 100 0.010
Andalusia, Sevilla 1 127 0.008
Bashkirs (Bashkortostan, Russia) 1 39 0.026
Italy North 1 124 0.008
Ossetian South (South Caucasus) 1 23 0.043
Pakistan North 6 85 0.071

Haplogroup R-M124[edit]

Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.

Position on the ISOGG tree and related SNPs[edit]

Haplogroup R-M479 is a subgroup of Haplogroup R (M207):

  • R-M207 (M207)
    • R-M306 (M306)
    • R-M479 (M479)
      • R-M124 (M124, P249, P267, L266)
        • R-L295 (L295)
        • R-L263 (L263)
        • R-L1069 (L1069)

Description of the M479 SNP[edit]

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg


See also[edit]

Y-DNA R-M207 subclades[edit]

Y-DNA backbone tree[edit]

Evolutionary tree of human Y-chromosome DNA (Y-DNA) haplogroups
MRC Y-ancestor
A00 A0'1'2'3'4
A0 A1'2'3'4
A1 A2'3'4
I J LT(K1) K (K2)
L T MPS (K2b) X (K2a)
  1. ^ van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809. 

External links[edit]