Haplogroup R2 (Y-DNA)
| Haplogroup R2 | |
| Possible time of origin | 25,000 ybp |
| Possible place of origin | South Asia or Central Asia |
| Ancestor | R |
| Descendants | R2* and R2a |
|---|---|
| Defining mutations | M479 |
| Highest frequencies | n/a |
Haplogroup R2 is a Y-chromosome haplogroup characterized by genetic marker M479.
Contents |
[edit] Term history
The first reference to the newly discovered SNP, M479, was on 25 August 2010.[1] This SNP now defines Haplogroup R2, while the known M124 SNP now defines Haplogroup R2a. The 2010 Y-Chromosome Phylogenetic Tree was updated on 9 September 2010 to reflect this change.[2]
Note: Before the discovery of the M479 SNP, the M124 SNP used to define Haplogroup R2.
[edit] Subclades
| Haplogroup R2 |
|
||||||
[edit] Paragroup R2*
Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.
Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorised as belonging to Paragroup R2*. It should be noted that exclusive studies have not been done to determine frequency or presence of R2* and figures below are not indicative of R2* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.
| Count | Sample Size | R2* Fequency | |
|---|---|---|---|
| Portugal, Lisbon | 1 | 100 | 0.010 |
| Andalusia, Sevilla | 1 | 127 | 0.008 |
| Tatars (Bashkortostan, Russia) | 1 | 39 | 0.026 |
| Italy North | 1 | 124 | 0.008 |
| Osetins South (South Caucasus) | 1 | 23 | 0.043 |
| Pakistan North | 6 | 85 | 0.071 |
[edit] Haplogroup R2a
Haplogroup R2a is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.
[edit]
Haplogroup R2 is a subgroup of Haplogroup R (M207):
- R (M207)
- R*
- R1 (M306)
- R2 (M479)
- R2*
- R2a (M124, P249, P267, L266, PAGES00004, L381)
- R2a*
- R2a1 (L295)
- R2a2 (L263)
|
Evolutionary tree of Human Y-chromosome DNA (Y-DNA) haplogroups |
||||||||||||||||||||||||||||||||||||||||||||||||||
| most recent common Y-ancestor | ||||||||||||||||||||||||||||||||||||||||||||||||||
| A | ||||||||||||||||||||||||||||||||||||||||||||||||||
| A1b | A1a-T | |||||||||||||||||||||||||||||||||||||||||||||||||
| A1a | A2-T | |||||||||||||||||||||||||||||||||||||||||||||||||
| A2 | A3 | BT | ||||||||||||||||||||||||||||||||||||||||||||||||
| B | CT | |||||||||||||||||||||||||||||||||||||||||||||||||
| DE | CF | |||||||||||||||||||||||||||||||||||||||||||||||||
| D | E | C | F | |||||||||||||||||||||||||||||||||||||||||||||||
| G | H | IJK | ||||||||||||||||||||||||||||||||||||||||||||||||
| IJ | K | |||||||||||||||||||||||||||||||||||||||||||||||||
| I | J | LT | K(xLT) | |||||||||||||||||||||||||||||||||||||||||||||||
| L | T | M | NO | P | S | |||||||||||||||||||||||||||||||||||||||||||||
| O | N | Q | R | |||||||||||||||||||||||||||||||||||||||||||||||
[edit] Description of the M479 SNP
| Common Name Marker | M479 [1] |
|---|---|
| YCC Haplogroup | R2 |
| Nucleotide change | C to T |
| Amplicon size (bp) reference sequence | 323 |
| Polymorphism position from 5' end | 107 |
| Restriction enzyme variant | HphI |
| RefSNP ID | rs17250114 |
| Y-position | 19294055 |
| Primer forward 5'-3' | gatactttatcaggcttacttc |
| Primer reverse 5'-3' | aaccaaatctctcagaatcg |
[edit] Notes
- ^ a b c Myres et al. (2010), "A major Y-chromosome haplogroup R1b Holocene era founder effect in Central and Western Europe - 2010."
- ^ ISOGG (2010), "Y-DNA Haplogroup R and its Subclades - 2010."
