Base pair
In molecular biology and genetics, the linking between two nitrogenous bases on opposite complementary DNA or certain types of RNA strands that are connected via hydrogen bonds is called a base pair (often abbreviated bp). In the canonical Watson-Crick DNA base pairing, adenine (A) forms a base pair with thymine (T) and guanine (G) forms a base pair with cytosine (C). In RNA, thymine is replaced by uracil (U). Alternate hydrogen bonding patterns, such as the wobble base pair and Hoogsteen base pair, also occur—in particular, in RNA—giving rise to complex and functional tertiary structures. Pairing is the mechanism by which codons on messenger RNA molecules are recognized by anticodons on transfer RNA during protein translation. Some DNA- or RNA-binding enzymes can recognize specific base pairing patterns that identify particular regulatory regions of genes.
The size of an individual gene or an organism's entire genome is often measured in base pairs because DNA is usually double-stranded. Hence, the number of total base pairs is equal to the number of nucleotides in one of the strands (with the exception of non-coding single-stranded regions of telomeres). The haploid human genome (23 chromosomes) is estimated to be about 3.2 billion base pairs long and to contain 20,000–25,000 distinct genes.[1] A kilobase (kb) is a unit of measurement in molecular biology equal to 1000 base pairs of DNA or RNA.[2]
Contents |
[edit] Hydrogen bonding and stability
Hydrogen bonding is the chemical interaction that underlies the base-pairing rules described above. Appropriate geometrical correspondence of hydrogen bond donors and acceptors allows only the "right" pairs to form stably. DNA with high GC-content is more stable than DNA with low GC-content, but, contrary to popular belief, the hydrogen bonds do not stabilize the DNA significantly, and stabilization is mainly due to stacking interactions.[3]
The larger nucleobases, adenine and guanine, are members of a class of double-ringed chemical structures called purines; the bigger or smaller nucleobases, cytosine and thymine (and uracil), are members of a class of single-ringed chemical structures called pyrimidines. Purines are complementary only with pyrimidines: pyrimidine-pyrimidine pairings are energetically unfavorable because the molecules are too far apart for hydrogen bonding to be established; purine-purine pairings are energetically unfavorable because the molecules are too close, leading to overlap repulsion. The only other possible pairings are GT and AC; these pairings are mismatches because the pattern of hydrogen donors and acceptors do not correspond. The GU pairing, with two hydrogen bonds, does occur fairly often in RNA (see wobble base pair).
Paired DNA and RNA molecules are comparatively stable at room temperature but the two nucleotide strands will separate above a melting point that is determined by the length of the molecules, the extent of mispairing (if any), and the GC content. Higher GC content results in higher melting temperatures; it is, therefore, unsurprising that the genomes of extremophile organisms such as Thermus thermophilus are particularly GC-rich. On the converse, regions of a genome that need to separate frequently — for example, the promoter regions for often-transcribed genes — are comparatively GC-poor (for example, see TATA box). GC content and melting temperature must also be taken into account when designing primers for PCR reactions.
[edit] Base stacking
Base stacking interactions in DNA and RNA are due to dispersion attraction, short-range exchange repulsion, and electrostatic interactions, which also contribute to stability.[4] Again, GC stacking interactions with adjacent bases tend to be more favorable. (Note, however, that a GC stacking interaction with the next base pair is geometrically different from a CG interaction.) Base stacking effects are especially important in the secondary structure and tertiary structure of RNA; for example, RNA stem-loop structures are stabilized by base stacking in the loop region.
[edit] Base analogs and intercalators
Chemical analogs of nucleotides can take the place of proper nucleotides and establish non-canonical base-pairing, leading to errors (mostly point mutations) in DNA replication and DNA transcription. This is due to their isosteric chemistry. One common mutagenic base analog is 5-bromouracil, which resembles thymine but can base-pair to guanine in its enol form.
Other chemicals, known as DNA intercalators, fit into the gap between adjacent bases on a single strand and induce frameshift mutations by "masquerading" as a base, causing the DNA replication machinery to skip or insert additional nucleotides at the intercalated site. Most intercalators are large polyaromatic compounds and are known or suspected carcinogens. Examples include ethidium bromide and acridine.
[edit] Examples
The following DNA sequences illustrate pair double-stranded patterns. By convention, the top strand is written from the 5' end to the 3' end; thus, the bottom strand is written 3' to 5'.
- A base-paired DNA sequence:
ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC
- The corresponding RNA sequence, in which uracil is substituted for thymine where uracil takes its place in the RNA strand:
AUCGAUUGAGCUCUAGCGUAGCUAACUCGAGAUCGC
[edit] Length measurements
The following abbreviations are commonly used to describe the length of a D/RNA molecule:
- bp = base pair(s)—one bp corresponds to approximately 3.4 Å of length along the strand
- kb (= kbp) = kilo base pairs = 1,000 bp
- Mb = mega base pairs = 1,000,000 bp
- Gb = giga base pairs = 1,000,000,000 bp.
In case of single stranded DNA/RNA units of nucleotides are used, abbreviated nt (or knt, Mnt, Gnt), as they are not paired. For distinction between units of computer storage and bases kbp, Mbp, Gbp, etc. may be used for base pairs. The length of 16S rDNA for bacteria is 1542 base pairs in length.
The Centimorgan is also often used to imply distance along a chromosome, but the number of base pairs it corresponds to varies widely. In the Human genome, the centimorgan is about 1 million base pairs.[5][6]
[edit] See also
[edit] Notes
- ^ International Human Genome Sequencing Consortium (2004). "Finishing the euchromatic sequence of the human genome". Nature 431 (7011): 931–45. doi:10.1038/nature03001. PMID 15496913. http://www.nature.com/nature/journal/v431/n7011/full/nature03001.html.
- ^ Andrew F. Cockburn, Mary Jane Newkirk, Richard A. Firtel, Cell, Volume 9, Issue 4, Part 1, December 1976, Pages 605-613, ISSN 0092-8674, DOI: 10.1016/0092-8674(76)90043-X.
- ^ Peter Yakovchuk, Ekaterina Protozanova and Maxim D. Frank-Kamenetskii. Base-stacking and base-pairing contributions into thermal stability of the DNA double helix. Nucleic Acids Research 2006 34(2):564-574.
- ^ Jiří Šponer, Jerzy Leszczyński, and Pavel Hobza (1996). "Nature of Nucleic Acid−Base Stacking: Nonempirical ab Initio and Empirical Potential Characterization of 10 Stacked Base Dimers. Comparison of Stacked and H-Bonded Base Pairs". Journal of Physical Chemistry 100 (13): 5590–5596. doi:10.1021/jp953306e.
- ^ NIH ORDR - Glossary - C
- ^ Matthew P Scott, Paul Matsudaira, Harvey Lodish, James Darnell, Lawrence Zipursky, Chris A Kaiser, Arnold Berk, Monty Krieger (2004). Molecular Cell Biology, Fifth Edition. San Francisco: W. H. Freeman. pp. 396. ISBN 0-7167-4366-3. ""...in humans 1 centimorgan on average represents a distance of about 7.5x105 base pairs.""
[edit] References
- Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. See esp. ch. 6 and 9.
[edit] External links
- DAN—webserver version of the EMBOSS tool for calculating melting temperatures