Haplogroup Q-M242: Difference between revisions
Saqqaq. |
→Subgroups: put ref in template |
||
Line 51: | Line 51: | ||
***Q1* |
***Q1* |
||
***Q1a (MEH2) |
***Q1a (MEH2) |
||
****Q1a* ''A 4000-year-old [[Saqqaq_culture|Saqqaq]] individual belonged to this haplogroup.''<ref>http://www.nature.com/nature/journal/v463/n7282/full/nature08835.html</ref> |
****Q1a* - ''A 4000-year-old [[Saqqaq_culture|Saqqaq]] individual belonged to this haplogroup.''<ref>{{cite web|title=Ancient human genome sequence of an extinct Palaeo-Eskimo|url=http://www.nature.com/nature/journal/v463/n7282/full/nature08835.html|publisher= Nature Publishing Group|pages= 463, 757-762|year=2010|doi=10.1038/nature08835|accessdate=2010-02-11}}</ref> |
||
****Q1a1 (M120, M265/N14) ''Found with low frequency among [[Han Chinese]],<ref name="BoWen2004">{{cite journal |author=Wen B, Li H, Lu D, ''et al'' |title=Genetic evidence supports demic diffusion of Han culture |journal=Nature |volume=431 |issue=7006 |pages=302–5 |year=2004 |month=September |pmid=15372031 |doi=10.1038/nature02878 |url=http://www.nature.com/nature/journal/v431/n7006/abs/nature02878.html |quote=[http://www.nature.com/nature/journal/v431/n7006/extref/nature02878-s2.doc Supplementary Table 2: NRY haplogroup distribution in Han populations]}}</ref><ref name = "BingSuHimalaya" /> [[Dungan people|Dungan]]s,<ref name = "Wells2001" /> [[Hazara people|Hazaras]],<ref name = "Sengupta2006">Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," ''The American Journal of Human Genetics'', Volume 78, Issue 2, 202-221, 1 February 2006.</ref> [[Japanese people|Japanese]],<ref name = "Nonaka2007">I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," ''Annals of Human Genetics'' Volume 71 Issue 4, Pages 480 - 495 (July 2007).</ref> [[Koreans]],<ref name = "Wells2001">{{cite journal |author=Wells RS, Yuldasheva N, Ruzibakiev R, ''et al'' |title=The Eurasian heartland: a continental perspective on Y-chromosome diversity |journal=Proc. Natl. Acad. Sci. U.S.A. |volume=98 |issue=18 |pages=10244–9 |year=2001 |month=August |pmid=11526236 |pmc=56946 |doi=10.1073/pnas.171305098 |quote=[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=56946&rendertype=table&id=T1 Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region]}}</ref> and [[Tibetans]]''<ref name = "BingSuHimalaya" /><ref name="Gayden2007">{{cite journal |author=Gayden T, Cadenas AM, Regueiro M, ''et al'' |title=The Himalayas as a directional barrier to gene flow |journal=Am. J. Hum. Genet. |volume=80 |issue=5 |pages=884–94 |year=2007 |month=May |pmid=17436243 |pmc=1852741 |doi=10.1086/516757 }}</ref> |
****Q1a1 (M120, M265/N14) ''Found with low frequency among [[Han Chinese]],<ref name="BoWen2004">{{cite journal |author=Wen B, Li H, Lu D, ''et al'' |title=Genetic evidence supports demic diffusion of Han culture |journal=Nature |volume=431 |issue=7006 |pages=302–5 |year=2004 |month=September |pmid=15372031 |doi=10.1038/nature02878 |url=http://www.nature.com/nature/journal/v431/n7006/abs/nature02878.html |quote=[http://www.nature.com/nature/journal/v431/n7006/extref/nature02878-s2.doc Supplementary Table 2: NRY haplogroup distribution in Han populations]}}</ref><ref name = "BingSuHimalaya" /> [[Dungan people|Dungan]]s,<ref name = "Wells2001" /> [[Hazara people|Hazaras]],<ref name = "Sengupta2006">Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," ''The American Journal of Human Genetics'', Volume 78, Issue 2, 202-221, 1 February 2006.</ref> [[Japanese people|Japanese]],<ref name = "Nonaka2007">I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," ''Annals of Human Genetics'' Volume 71 Issue 4, Pages 480 - 495 (July 2007).</ref> [[Koreans]],<ref name = "Wells2001">{{cite journal |author=Wells RS, Yuldasheva N, Ruzibakiev R, ''et al'' |title=The Eurasian heartland: a continental perspective on Y-chromosome diversity |journal=Proc. Natl. Acad. Sci. U.S.A. |volume=98 |issue=18 |pages=10244–9 |year=2001 |month=August |pmid=11526236 |pmc=56946 |doi=10.1073/pnas.171305098 |quote=[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=56946&rendertype=table&id=T1 Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region]}}</ref> and [[Tibetans]]''<ref name = "BingSuHimalaya" /><ref name="Gayden2007">{{cite journal |author=Gayden T, Cadenas AM, Regueiro M, ''et al'' |title=The Himalayas as a directional barrier to gene flow |journal=Am. J. Hum. Genet. |volume=80 |issue=5 |pages=884–94 |year=2007 |month=May |pmid=17436243 |pmc=1852741 |doi=10.1086/516757 }}</ref> |
||
****Q1a2 (M25, M143) ''Found with low to moderate frequency in [[Iran]],<ref name = "Regueiro2006" /> [[Lebanon]],<ref name = "ZallouaLebanon">Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," ''American Journal of Human Genetics'' 82, 873–882, April 2008.</ref> and [[Turkey]]<ref name="Cinnioglu2004" />'' |
****Q1a2 (M25, M143) ''Found with low to moderate frequency in [[Iran]],<ref name = "Regueiro2006" /> [[Lebanon]],<ref name = "ZallouaLebanon">Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," ''American Journal of Human Genetics'' 82, 873–882, April 2008.</ref> and [[Turkey]]<ref name="Cinnioglu2004" />'' |
Revision as of 18:19, 11 February 2010
Haplogroup Q | |
---|---|
Possible time of origin | 17,000 to 22,000 years ago[1][2] |
Possible place of origin | Ural or Siberia[3] |
Ancestor | P |
Descendants | Q1 |
Defining mutations | M242 |
Highest frequencies | Indigenous Americans, Kets, and Selkups |
In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.
Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.
This haplogroup contains many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[2] This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.
Distribution
In the Old World, the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the northwest, the Iranian plateau in the south, and Chukotka in the east, northeastern Europe and central Asia being bound by this triangle. Haplogroup Q also has been detected in Yemenite Jews, Algerians, Arabians, Syrians, Lebanese, Turks, Indians, Sri Lankans, Nepalese, Tibetans, Vietnamese, Balinese, Han Chinese, Koreans, and Japanese. The frequency of Q in Norway and northern China is about 4%, with Chinese samples of haplogroup Q belonging almost exclusively to the subclade Q1a1-M120.[4][5] 3% of Hungarian males are in haplogroup Q; it is believed this was a modal haplogroup of either the Huns, ancient Magyars or both. In Iran, the frequency runs between approximately 2.6% in the south and 9.1% in the north; Iranian samples of haplogroup Q belong almost exclusively to the subclade Q1a2-M25.[6] In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)[7] or 3.4% (6/176).[8] Haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians,[9] 16% of Tuvans,[10] and 3% of Uyghurs,[11] all of which are Turkic peoples inhabiting parts of Central Asia and southern Siberia. Haplogroup Q is found in approximately 3% of males in Tibet[12] and Mongolia,[11] approximately 2.5% of males in Saudi Arabia,[13] and approximately 2% of males in Turkey,[14] Lebanon,[15] and the United Arab Emirates.[16] Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.
In a most recent study Gokcumen finds that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.[17]
According to Behar et al. [18] 5% of Ashkenazi males belong to haplogroup Q, making it clear that the Khazar theory (that a significant percentage of Khazar Royal Ashinas Turks converted to Judaism) is genetically verifiable and that an important percentage of today's Ashkenazi Jewish males have a Turkic background and since haplogroup Q is accepted to be a Turkic marker. [19]
Subclade Q1a3a (Q3)
A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 20,000 to 15,000 years ago.[2] This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).[2]
Discovery of ancestral Q in the Indian subcontinent
A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent, though in low frequency.[20] A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent. However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) .[20] Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration,[20] Q5 may be positioned as Q1a7.
Technical specification of mutation
The technical details of M242 are:
- Nucleotide change: C to T
- Position (base pair): 180
- Total size (base pairs): 366
- Forward 5′→ 3′: aactcttgataaaccgtgctg
- Reverse 5′→ 3′: tccaatctcaattcatgcctc
Subgroups
The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in the ISOGG 2008 tree because it is a value for an STR. This low frequency value been found as a novel Q lineage (Q5) in indian populations.[20]
The 2008 ISOGG tree
- Q (M242)
- Q*
- Q1 (P36.2)
- Q1*
- Q1a (MEH2)
- Q1a* - A 4000-year-old Saqqaq individual belonged to this haplogroup.[21]
- Q1a1 (M120, M265/N14) Found with low frequency among Han Chinese,[4][5] Dungans,[22] Hazaras,[8] Japanese,[23] Koreans,[22] and Tibetans[5][12]
- Q1a2 (M25, M143) Found with low to moderate frequency in Iran,[6] Lebanon,[24] and Turkey[14]
- Q1a3 (M346)
- Q1a3* Found with low frequency in India,[8] Khanty,[25] Pakistan,[8] Saudi Arabia,[13] Tibetans,[12] and the United Arab Emirates[16]
- Q1a3a (M3) Typical of indigenous peoples of the Americas[3]
- Q1a3a*
- Q1a3a1 (M19) Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu[26]
- Q1a3a2 (M194)
- Q1a3a3 (M199, P106, P292)
- Q1a4 (P48)
- Q1a5 (P89)
- Q1a6 (M323) Found in a significant minority of Yemenite Jews[27]
- Q1b (M378) Found in 5% of Ashkenazi Jews and with low frequency in Pakistan among samples of Hazaras and Sindhis[8][28]
See also
- Populations
- Genetics
References
- ^ Fagundes, Nelson J.R. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. Retrieved 2009-11-19.
Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
{{cite journal}}
: Unknown parameter|coauthors=
ignored (|author=
suggested) (help) - ^ a b c d Zegura SL, Karafet TM, Zhivotovsky LA, Hammer MF (2004). "High-resolution SNPs and microsatellite haplotypes point to a single, recent entry of Native American Y chromosomes into the Americas" (PDF). Mol. Biol. Evol. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.
{{cite journal}}
: Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21.
Haplogroups are defined by unique mutation events such as single nucleotide polymorphisms, or SNPs. These SNPs mark the branch of a haplogroup, and indicate that all descendents of that haplogroup at one time shared a common ancestor. The Y-DNA SNP mutations were passed from father to son over thousands of years. Over time, additional SNPs occur within a haplogroup, leading to new lineages. These new lineages are considered subclades of the haplogroup. Each time a new mutation occurs, there is a new branch in the haplogroup, and therefore a new subclade. Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present
Cite error: The named reference "Genebase" was defined multiple times with different content (see the help page). - ^ a b Wen B, Li H, Lu D; et al. (2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031.
Supplementary Table 2: NRY haplogroup distribution in Han populations
{{cite journal}}
: Explicit use of et al. in:|author=
(help); External link in
(help); Unknown parameter|quote=
|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b c Bing Su, Chunjie Xiao, Ranjan Deka et al., "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas," Human Genetics (2000) 107 : 582–590. DOI 10.1007/s004390000406
- ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.
{{cite journal}}
: CS1 maint: multiple names: authors list (link) - ^ Sadaf Firasat, Shagufta Khaliq, Aisha Mohyuddin, Myrto Papaioannou, Chris Tyler-Smith, Peter A Underhill and Qasim Ayub: "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan." European Journal of Human Genetics (2007) Vol. 15, p. 121–126.
- ^ a b c d e Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
- ^ V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
- ^ Brigitte Pakendorf, Innokentij N. Novgorodov, Vladimir L. Osakovskij et al., "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts," Human Genetics (2006) 120:334–353 DOI 10.1007/s00439-006-0213-2
- ^ a b Hammer et al., "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes," © The Japan Society of Human Genetics, Springer-Verlag (2005)
- ^ a b c Gayden T, Cadenas AM, Regueiro M; et al. (2007). "The Himalayas as a directional barrier to gene flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b Khaled K. Abu-Amero, Ali Hellani, Ana M. Gonzalez et al., "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions," BMC Genetics 2009, 10:59 doi:10.1186/1471-2156-10-59
- ^ a b Cinnioğlu C, King R, Kivisild T; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ Zalloua PA, Xue Y, Khalife J; et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
{{cite journal}}
: Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ http://proquest.umi.com/pqdlink?Ver=1&Exp=05-24-2014&FMT=7&DID=1601911211&RQT=309&attempt=1
- ^ http://www.springerlink.com/content/xvj2jwclptvrvmer/
- ^ http://www.springerlink.com/content/xvj2jwclptvrvmer
- ^ a b c d Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.
{{cite journal}}
: CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link) - ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
- ^ a b Wells RS, Yuldasheva N, Ruzibakiev R; et al. (2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236.
Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region
{{cite journal}}
: Explicit use of et al. in:|author=
(help); External link in
(help); Unknown parameter|quote=
|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," Annals of Human Genetics Volume 71 Issue 4, Pages 480 - 495 (July 2007).
- ^ Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
- ^ Mirabal S, Regueiro M, Cadenas AM; et al. (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. doi:10.1038/ejhg.2009.6. PMID 19259129.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ Bortolini MC, Salzano FM, Thomas MG; et al. (2003). "Y-chromosome evidence for differing ancient demographic histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ Peidong Shen, Tal Lavi, Toomas Kivisild, Vivian Chou, Deniz Sengun, Dov Gefel, Issac Shpirer, Eilon Woolf, Jossi Hillel, Marcus W. Feldman, and Peter J. Oefner, "Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation," Human Mutation 24:248-260 (2004). Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
- ^ http://www.familytreedna.com/public/AshinaRoyalDynasty/default.aspx?section=results
- ^ The Journey of Man: A Genetic Odyssey (Digitised online by Google books). Random House. ISBN 0812971469. Retrieved 2009-11-21.
{{cite book}}
:|first=
missing|last=
(help)