Haplogroup G (Y-DNA)

From Wikipedia, the free encyclopedia
Jump to: navigation, search
Haplogroup G

Haplogrupo G (ADN-Y).PNG

Possible time of origin 14,000-30,000 years BP[1]
Possible place of origin South Asia or Southwest Asia
Ancestor F
Descendants G1, G2 and their subgroups
Defining mutations L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33

In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. It is a branch of Haplogroup F (M89). Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World in Europe, Caucasus, South Asia, western and central Asia, and northern Africa.

Contents

[edit] Origins

Various estimated dates and locations have been proposed for the origin of Haplogroup G. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic[2] Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago.[3] Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago.[4]

The majority of all the male skeletons from the European Neolithic period that have so far yielded Y-DNA belong to haplogtoup G2a. There are only a few samples from this period because of the difficulty extracting nuclear DNA. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site for farmers in northeastern Spain and were dated by radiocarbon dating to about 7000 years ago.[5] At the Neolithic cemetery of Derenburg Meerenstieg II, north central Germany, with burial artifacts belonging to the Linear Pottery culture, known in German as Linearbandkeramik (LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[6] G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago.[7] The fourth site also from the same period is the Ötztal of the Italian Alps where the mummified remains of Ötzi the Iceman were discovered. Preliminary word is that the Iceman belongs to haplogroup G2a2b.[8] (earlier called G2a4) The latter is a rare group today in Europe, and the authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers.

The only more recent haplogroup G skeletons were two haplogroup G2a men found in a high-status burial at Ergolding in present-day Bavaria, southern Germany, of the Merovingian dynasty period.[9]

[edit] Genetic Findings

[edit] M201 SNP Mutation

The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001.[10] The technical specifications of M201 are given as: refSNPid is rs2032636.....Y chromosome location of 13536923....forward primer is tatgcatttgttgagtatatgtc.....reverse primer is gttctgaatgaaagttcaaacg.....the mutation involves a change from G to T.

[edit] Equivalent SNP Mutations

A number of SNPs have been identified with seemingly the same coverage in the population as M201. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In order to determine if one of these alternative SNPs represents a subgroup of M201, the alternative SNPs must be tested in G persons who are negative for the known subgroups of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201.

The following SNPs are so far are identified as M201 equivents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. P257 was first reported in 2008.[11] L240 was identified in 2009.[12] The "U" SNPs were identified in 2006 but not published until 2009.[13]

In addition, there are multiple other SNPs thought to have the same coverage as M201. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. No labs have yet assigned them shorthand names.

[edit] Subgroup Tree Listing

.............corresponding SNP IDs listed in parentheses

G*

  • G1 (M285, M342)
    • G1* -
      • G1a (P20.1, P20.2, P20.3)
        • G1a*
          • G1a1 (L201^, L202^, L203^)
      • G1b (P76)
      • G1c (L830^, L831^, L832^, L834^, L835^)
  • G2 (P287)
    • G2* -
    • G2a (P15, U5, L31/S149, L149^)
      • G2a* -
        • G2a1 (P16.1, P16.2)
          • G2a1* -
            • G2a1a (P18.1, P18.2, P18.3)
        • G2a2 (L223^)
          • G2a2* -
            • G2a2a (M286)
            • G2a2b (L91)
            • G2a2c (L293^)
        • G2a3 (L30/S126, L32/S148)
          • G2a3* -
            • G2a3a (M406)
              • G2a3a* -
                • G2a3a1 (L14/S130/U16, L90/S133)
                • G2a3a2 (L645^)
            • G2a3b (L141.1^)
              • G2a3b* -
                • G2a3b1 (P303/S135)
                  • G2a3b1* -
                    • G2a3b1a (L140^)
                      • G2a3b1a*
                        • G2a3b1a1 (U1)
                          • G2a3b1a1*
                            • G2a3b1a1a (L13/S131/U13, L78)
                        • G2a3b1a2 (L497)^
                          • G2a3b1a2*
                            • G2a3b1a2a (L43/S147)
                              • G2a3b1a2a*
                                • G2a3b1a2a1 (L42/S146)
                          • G2a3b1a3 (L640^)
                          • G2a3b1a4 (L660^, L662^)
                    • G2a3b1b (L694^)
                • G2a3b2 (L177.1^, L177.2^, L177.3^)
    • G2b (M287)
    • G2c (M377, L72, L183^)
      • G2c* -
        • G2c1 (M283)

The ^ indicates newly identified in 2009-12. The * indicates negativity for subgroups of that category

The seven most commonly occurring subgroups of haplogroup G in existing data with their corresponding SNPs in parentheses are: G1 (M285), G2a1 (P16) G2a3a (M406), G2a3b1a (L140), G2a3b1a2 (L497), G2a3b1a1a (L13/S131/U13) and G2c (M377).

[edit] Characteristics of Haplogroup G Subgroups

The International Society of Genetic Genealogy (ISOGG)[14] maintains the most up-to-date consensus version of haplogroup categories. These classifications are based on shared SNP mutations. The discovery of new SNPs can result in assignment of new names to haplogroup categories. There were only a few G categories until 2008 when major revisions to categories were made. Even more G SNPs were identified in 2009 to 2011 leading to more changes. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation.

Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Categories have alternating letters and numbers. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional subgrouping. The identification of a new SNP can necessitate renaming of one or more categories.

[edit] G1 (M285+ or M342+) and its subgroups

Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1.

Subgroups of G1a, G1a1, G1b, G1c exist.

The highest reported concentration of G1 and its subgroups in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west.

There are distinctive Ashkenazi Jewish and Kazakh subgroups based on STR marker value combinations.

[edit] G2 (P287+)

Men who belong to this group but are negative for all G2 subgroups represent a small number of haplogroup G men. P287 was identified at the University of Arizona and became widely known in late 2007. Its identification caused considerable renaming of G categories.

[edit] G2a (P15+)

Haplogroup G men who belong to this group, but are negative for all G2a subgroups, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of Arizona and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany.[9]

There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.

[edit] G2a1 (P16+) and its subgroup

Haplogroup G2a1 and its one subgroup G2a1a represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. G2a1 is found only in tiny numbers elsewhere. Almost all G2a1 persons have a value of 10 at STR marker DYS392. They also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.

The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subgroup based on available samples.

The presence of the SNP P18 mutation characterizes G2a1's only subgroup, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.

Ashkenazi Jewish G2a1 men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.

[edit] G2a2 (L223+) and its subgroups

This group is charactized by having the L223 mutation. L223 is found on the Y chromosome at rs13304806 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematical as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. It was then learned that three subgroups as follows belong under L223:

The G2a2a subgroup (M286) is tiny. Samples indicating British Isles and Turkish ancestry have been identified. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A.

The L91 SNP that characterizes the G2a2b group was identified in spring 2009 at Family Tree DNA. G2a2b would seem to encompass a significant group of G persons. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subgroups. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.

The L293 SNP that characterizes the G2a2c subgroup was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C.

[edit] G2a3 (L30+, S126+, U8+)

Men who belong to this group but are negative for all its subgroups represent a small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK).[6]

[edit] G2a3a (M406+) and its subgroups

G2a3a and its several subgroups seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 50% of haplogroup G samples. G2a3a is more common in southern Europe than northern Europe. In Europe—except in Italy—G2a3a constitutes less than 20% of G samples. G2a3a so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran.

A relatively high percentage of G2a3a persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a3a persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a3a.

G2a3a has one known subgroup. G2a3a1 is relatively common among G2a3a persons.

[edit] G2a3b (L141+)

The SNP that defines this group was identified only in mid-2009 at Family Tree DNA, handicapping the ability to describe the features of this group. Initial testing seems to indicate this is a significant G group. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141+ persons who do not belong to any L141 subgroup so far have the value of 11 at STR marker DYS490 — a finding rare in other G categories. The mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion.[15]

[edit] G2a3b1 (P303+ or S135+) and its subgroups

The G2a3b1 definable subgroups are heavily concentrated throughout Europe west of the Black Sea and Russia where G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India.

The largest G2a3b1 subgroup based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The L497 SNP (G2a3b1a2) encompasses these men. There are additional subgroups of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities.

The next largest G2a3b1 subgroup is characterized by the presence of the L13/S13 SNP (G2a3b1a1a). This subgroup is most common in north central Europe.

New testing in 2010 indicated that a substantial G2a3b1 subgroup characterized by having the U1 mutation (G2a3b1a1) exists primarily in the Caucasus Mountains region.

The final major subgroup is characterized in a high percentage of cases by the values of 9 at marker DYS568 and 20,21 at marker YCA. This latter DYS568=9 subgroup contains a further large subgroup consisting overwhelmingly of Ashkenazi Jews.

The highest percentage of G2a3b1 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast.

[edit] G2a3b2 (L177+)

This G2a3b2 group is certainly smaller in numbers of men included than G2a3b1, but only a small amount of testing has occurred for the L177 mutations. So far the men positive for this have listed Irish, English, Dutch and Turkish (Armenian surname) ancestry. Several L177 subgroups based on shared STR marker oddities exist.

The number of STR marker values separating men in this group suggest G2a3b2 is a relatively old group despite the small number of men involved.[16] The mutations involved are complicated and difficult to interpret. The L177.1 component is found at Y chromosome position 23397163; L177.2 at 25030912; L177.3 at 25750264.[17] This SNP was first identified at Family Tree DNA in 2009.

[edit] G2b (M287+)

The M287 SNP that characterizes this group was published in 2004 and involved a single Turkish man. So far additional G2b samples have not surfaced in the major commercial labs, and there has been discussion as to whether this category should be retained without evidence this SNP has coverage beyond the family of the original test subject.

[edit] G2c (M377+) and its subgroup

A clade of closely related Ashkenazi Jews represent virtually all G2c persons, with just three other G2c haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. The extreme rarity of G2c in northern Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G2c haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G2c is somewhat closer, but not identical. It remains to be seen if testing will reveal G2c haplotypes in other populations — this is some indication that G2c occurs at low levels in the Near East. Early reports that Ashkenazi G men were all G1 are now proven incorrect. There are also Jewish genetic clades within G2 and G1 whose members are not closely related to the G2c men. All G2c men tested so far have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G2c constituted 3.7% in one study.[18]

[edit] Geographical Distribution

Knowing the distribution of haplogroup G in general is not as useful as that of the distribution of its subgroups. The subgroups likely spread to new areas of the world in different time periods and to different locations. All available G samples derive from studies or collections that do not meet criteria for random sampling, and conclusions based on them are only rough approximations of what is seen in populations.

In Europe west of the Black Sea Haplogroup G is found at about 5% of the population on average throughout most of the continent.[19] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. There are seeming pockets of unusual concentrations within Europe. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. In western Austria, in the Tirol (Tyrol) the G percentage can reach 8% or more. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[20] and reached 21% in the town of Tempio in another study. In the Greek island of Crete, approximately 7%[21] to 11%[22] of males belong to haplogroup G. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males.[23] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G.

In Russia, the Ukraine and central Asia, the G percentage is around 1% or less. The northern slope of the Caucasus Mountains represents a major exception where concentrations in the Kabardinian and Ossetian populations are noted. In Digora, North Ossetia the highest known concentration of G in a single town in the world is reached where 74% of the tested men were G.[24] The Madyars of central Kazakhstan, a Kazakh sub-ethnic group, were found to be 87% G1. Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.

In Turkey, the southern Caucasus region and Iran, haplogroup G reaches the highest percentage of a regional population worldwide. Among Turkish males 11% of the population is G.[4] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among the Bakhtiari, Gilaki and Mazandarani, it is closer to 5% among the Iranian Arabs and in some large cities.[25] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 18% from Azerbaijan and 11% from Armenia appear to be G samples.

In southern Asia, haplogroup G is found in concentrations of approximately 18%[26] to 20%[27] of Kalash, approximately 16% of Brahui,[27] and approximately 11.5% of sampled Pashtun,[26] but in only about 3% of the general Pakistani population.[26] The many groups in India and Bangla Desh have not been well studied. About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia.[28]

In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas.[29][30] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[31]

In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%.[32][33][34] Three percent of North African Berbers were found to be haplogroup G.[35] Two percent of Arab Moroccans and 8% of Berber Moroccans were likewise found to be G.[36]

In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans except where intermarriage with non-native persons has occurred.

Around 10% of Jewish males are Haplogroup G.

[edit] Famous members

Joseph Stalin, from a genetic test on his grandson (his son Vasily's son; Alexander Burdonsky), shows his Y-DNA haplogroup to be G2a1a [1]

DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 14 23 15 9 15 16 11 12 11 11 10 28 17 9 9 11 11 25 16 21 28 13 13 14 14

King Louis XVI of France from a genetic test on blood in a cloth purported to have been collected at his beheading and maintained in an ornate gourd decorated with French Revolution themes. Confirmation of this genetic profile requires testing of a known relative. The sample was tested at two laboratories with the same results.[37] The sample is most consistent with G2a3b1a samples and contains unusually high, rare values for markers DYS385B and DYS458 within this G subgroup.

DYS 393 390 19 391 385A 385B 439 389I 392 389II 448 458 456 437 438 YGATAH4 DYS635
Alleles 14 22 15 10 13 18 12 12 11 30 21 21 15 15 10 12 21

Other notables purported to belong to haplogroup G include American historical figures Phillip Hamman and Linn Banks (U.S. Representative from Virginia), physicist John G. Cramer, actor James Franciscus, and former Chairman of the United States Federal Communications Commission (FCC) and Chairman of the Public Broadcasting Service, Newton Minow and Ötzi the Iceman.

[edit] See also

[edit] References

  1. ^ Learn about Y-DNA Haplogroup G Genebase.com
  2. ^ Atlas of the Human Journey: Haplogroup G (M201)
  3. ^ Semino O, Passarino G, Oefner PJ, et al. (November 2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective". Science 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453. http://www.sciencemag.org/cgi/pmidlookup?view=long&pmid=11073453. 
  4. ^ a b Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Proc Natl Acad Sci U S A. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  5. ^ Lacan M, Keyser C, Ricaut F-X, Brucato, N, et al. (November 2011). "Ancient DNA suggests the leading role played by men in the Neolithic disseminationtolia". Hum. Genet. 108 (45): 18255-9. doi:10.1073/pnas.1113061108. PMID 22042855. 
  6. ^ a b Haak, W. et al., Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities, PloS Biology, vol. 8, no.11 (November 2010): e1000536.
  7. ^ Marie Lacan, Christine Keyser, François-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubézy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route, Proceedings of the National Academy of Sciences of the USA, online May 31, 2011 before print.
  8. ^ Interview Dr. Eduard Egarter-Vigl, Head of Conservation and Assistant to research projects of the Archaeological Museum in Bozen. From the Docu-Movie: "Ötzi, ein Archäologiekrimi" [Ötzi, a Archaeology Crime] by Christine Sprachmann. TV-Broadcasted by 3sat 10th august 2011 and br-alpha 13th september 2011.
  9. ^ a b Vanek, D, "et al." (2009). "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material". Croatian Med J 50 (3): 286–95. doi:10.3325/cmj.2009.50.286. PMC 2702742. PMID 19480023. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2702742. 
  10. ^ Underhill, P., et al. (2001). "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations". Annals of Human Genetics 65 (Pt1): 43–62. doi:10.1046/j.1469-1809.2001.6510043.x. PMID 11415522. 
  11. ^ Karafat, T., et al. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–38. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2336805. 
  12. ^ |url=http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369
  13. ^ Sims, L.,et al. (2009). Batzer, Mark A.. ed. "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs". PLoS ONE 4 (6): 1–5. doi:10.1371/journal.pone.0005792. PMC 2686153. PMID 19495413. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2686153. 
  14. ^ |url=http://www.isogg.org/tree/index.html
  15. ^ http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_details/hs_chrY?ref=ChrY;start=2948607;end=2948607;name=L141;class=Sequence;feature_id=41210;db_id=ymap%3Adatabase
  16. ^ |url=https://sites.google.com/site/haplogroupgproject/project-roster
  17. ^ |url=http://ytree.ftdna.com/index.php?name=Draft&parent=20173662
  18. ^ Hammer, M. et al. (2009). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood.". Human Genetics 126 (5): 707–17. doi:10.1007/s00439-009-0727-5. PMC 2771134. PMID 19669163. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2771134. 
  19. ^ |url=https://sites.google.com/site/haplogroupgproject/geographical-distribution
  20. ^ Zei, G. et al. (2003). "From surnames to the history of Y chromosomes: the Sardinian population as a paradign.". Eur J of Human Genetics 11 (10): 802–07. doi:10.1038/sj.ejhg.5201040. PMID 14512971. 
  21. ^ Martinez L. et al. (April 2007). "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau". Eur. J. Hum. Genet. 15 (4): 485–93. doi:10.1038/sj.ejhg.5201769. PMID 17264870. 
  22. ^ King R, et al. (March 2008). "Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic". Ann. Hum. Genet. 72 (Pt 2): 205–14. doi:10.1111/j.1469-1809.2007.00414.x. PMID 18269686. 
  23. ^ Battaglia V. et al. (2009). "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe". Eur J of Human Genetics 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMC 2947100. PMID 19107149. http://www.unipv.eu/on-line/Home/AreaStampa/documento2986.html. 
  24. ^ Nasidze, I, et al (2003). "Testing Hypotheses of Language Replacement in the Caucasus: Evidence from the Y Chromosome". Human Genetics 112 (3): 255–61. doi:10.1007/s00439-002-0874-4. PMID 12596050. http://www.familytreedna.com/pdf/Nasidze_2003.pdf. 
  25. ^ Nasidze, I. et al. (2008). "Close Genetic Relationship Between Semitic-speaking and Indo-European-speaking Groups in Iran". Annals of Human Genetics 72 (Pt 2): 241–52. doi:10.1111/j.1469-1809.2007.00413.x. PMID 18205892. 
  26. ^ a b c Firasat, F., et al. (2006). "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan". Eur J of Human Genetics 15 (1): 121–26. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675. http://www.nature.com/ejhg/journal/v15/n1/full/5201726a.html. 
  27. ^ a b Sengupta S. et al. (February 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". Am. J. Hum. Genet. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230. PMID 16400607. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)62353-2. 
  28. ^ Hammer, M. et al. (2006). "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes". Journal of Human Genetics 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082. 
  29. ^ Flores, C. et al. (2005). "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan". Journal of Human Genetics 50 (9): 435–41. doi:10.1007/s10038-005-0274-4. PMID 16142507. http://wysinger.homestead.com/jordan.pdf. 
  30. ^ Cadenas, A. et al. (2008). "Chromosome Diversity Characterizes the Gulf of Oman". Eur Journal of Genetics 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816. 
  31. ^ Shlush, L. et al. (2008). Gemmell, Neil John. ed. "The Druze: A Population Genetic Refugium of the Near East". PLoS ONE 3 (5): e2105. doi:10.1371/journal.pone.0002105. PMC 2324201. PMID 18461126. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2324201. 
  32. ^ Elizabeth T Wood, Daryn A Stover, Christopher Ehret et al., "Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes," European Journal of Human Genetics (2005) 13, 867–876. (cf. Appendix A: Y Chromosome Haplotype Frequencies)
  33. ^ Luis, J. et al. (2004). "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations". Amer J of Human Genetics 74 (3): 532–44. doi:10.1086/382286. PMC 1182266. PMID 14973781. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1182266. 
  34. ^ El-Sibai,M. et al.; Platt, DE; Haber, M; Xue, Y; Youhanna, SC; Wells, RS; Izaabel, H; Sanyoura, MF et al (2009). "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast". Annals of Human Genetics 73 (Pt6): 561–81. doi:10.1111/j.1469-1809.2009.00538.x. PMID 19686289. 
  35. ^ Alsonso, S. et al. (2005). "The place of the Basques in the European Y-chromosome diversity landscape". Eur J of Human Genetics 13 (12): 1293–1302. doi:10.1038/sj.ejhg.5201482. PMID 16094307. http://www.nature.com/ejhg/journal/v13/n12/pdf/5201482a.pdf. 
  36. ^ Cruciani, F. et al. (2002). "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes". Eur J of Human Genetics 70 (5): 1197–1214. doi:10.1086/340257. PMC 447595. PMID 11910562. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=447595. 
  37. ^ Lalueza-Doz, C, Gigli, E., Dini, C., et al. (October 2010). "Genetic Analysis of the presumptive blood from Louis XVI, king of France". Forensic Science International: Genetics 30: E Pub ahead of print. doi:10.1016/j.fsigen.2010.09.007. PMID 20940110. 

[edit] External links


Evolutionary tree of Human Y-chromosome DNA (Y-DNA) haplogroups

most recent common Y-ancestor
A
A1b A1a-T
A1a A2-T
A2 A3 BT
B CT
DE CF
D E C F
G H IJK
IJ K
I J LT K(xLT)
L T M NO P S
O N Q R

Y-DNA by populations · Famous Y-DNA haplotypes

Personal tools
Namespaces
Variants
Actions
Navigation
Interaction
Toolbox
Print/export
Languages