Jump to content

Haplogroup G-M377

From Wikipedia, the free encyclopedia
(Redirected from Haplogroup G2c (Y-DNA))
Haplogroup G-M377
Possible time of origin~8,700 years BP[1]
Possible place of originWest Asia
AncestorHaplogroup G2b (M3115)
Defining mutationsM377, L72
Highest frequenciesPashtuns, Sephardic Jews, Ashkenazi Jews, Mizrahi Jews, Palestinians, Lebanese, Syrians

Haplogroup G-M377 is a Y-chromosome haplogroup defined by the presence of the M377 mutation.[2] It is a subclade of Haplogroup G2b-M3115, which in turn is defined by the M3115 mutation.[3]

Haplogroup G-M377 has been observed among Pashtuns, an Iranic ethnic group, and at lower frequencies among all major Jewish groups, including Ashkenazi, Sephardi, and Mizrahi Jews, as well as among Palestinians, Lebanese, and Syrians.[4][5]

Origin

[edit]

G presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G-M377 has none of these obvious characteristics. Until the Second World War it was most common by far in Eastern Europe, a region where it arrived comparatively recently, but rare in other regions; including its likely area of origin. The distribution of G-M377 is sparse and dispersed, with almost no G-M377 haplotypes found in very large intervening regions. This pattern appears to be unique among Y haplogroups. The extreme rarity of G-M377 in northern Pakistan could indicate that G-M377 in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin.

Phylogenetic position

[edit]

G* (M201)

  • G1 (M285, M342)
  • G2 (P287)
    • G2a (P15, U5, L31/S149, L149)
    • G2b (M3115)
      • G2b1 (M377)
      • G2b2 (FGC3095)[6]

Haplogroup characteristics

[edit]

Distinguishing Y-STR alleles

[edit]

For the full listing of all the G2b Y-STR modal haplotype values, see the entry:
HRGEN in ySearch.org

All G2b samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic Y-STR, the result of a RecLOH event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2b.

G2b Y-STR distinguishing allele values
Y-STR Allele range Modals
DYS393 12-13 13
DYS390 23-24 23
DYS19 15-17 15
17
DYS391 10-12 10
11
DYS385* 13,15
13,16
13,17
14,16
13,16
DYS426 11
DYS388 12
DYS439 11-12 11
DYS392 11
DYS389 13,29
13,30
13,31
14,31
14,32
14,33
15,33
13,30
14,31
14,32
DYS459 8,9
DYS464 13,13,14,15
13,13,15,15
13,14,14,15
13,14,15,15
13,14,15,15
DYS607 15-17 16
DYS395S1a 16,16
DYS425 null
DYS413 21,22
DYS436 11
DYS481 19
DYS461 12

* In haplogroup G2b, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.

Primer sequence

[edit]
SNP
name
gene gene
location
Y position
M377 DDX3Y intron 10 15,536,827
Primer (5'→3')[2]
position
(bp)
SNP forward reverse length
(bp)
40 A→T tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326

Distribution

[edit]

Ashkenazi Jews

[edit]

A cluster of closely related Ashkenazi Jews represent majority confirmed G-M377 persons worldwide, both from private testing, and from academic studies. Of 211 known European G-M377, 8 are known to have non-Jewish patrilineal ancestors. G-M377 makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33).[7] In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes 4 and 6-15 are G-M377, 2,3,5 are G-M285, and the haplogroup of the first listed is unclear. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G-M377 and 14 Ashkenazi G-M285. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study.[8]

Western Germany

[edit]

G-M377 is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto. Jews were expelled in 1670 from Vienna and the Archduchy of Austria.[9] After Khmelnytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. A significant number of German Jewish G-M377 appear to represent a pre-1640s independent settlement; some however may be the result of a migration from Eastern Europe.

Sicily

[edit]

Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of the more than 2,000 known European G-M377, there are 4 Sicilians, including 3 members of one family with a tradition of Jewish patrilineal descent from the 16th century Sicily.

Syria and Lebanon

[edit]

There are a few individuals of Syrian and Lebanese descent that also share this haplogroup. These G-M377 haplotypes form a separate cluster that is very different from the Ashkenazi Jewish clade.[1]

Eastern Anatolia

[edit]

A confirmed G-M377 Y-STR haplotype[10] found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) Archived 2023-03-27 at the Wayback Machine which was found in Eastern Turkey, in the city of Kars, very close to Armenia.[11]

Armenia

[edit]

An Armenian from Syunik was found to have basal G-M377*[12]

Iran

[edit]

Haplogroup G-M377 was found in 1.6% (1/63) of Azerbaijanis from West Azerbaijan province in Iran in a 2012 study.

Afghanistan

[edit]

Study has found that Haplogroup G-M377 reaches 14.7% in Afghan Pashtuns from Baghlan (5/34), 7.5% in Pashtuns from Kunduz (4/53), 2.7% in Tajiks from Badakhshan (1/37) and 3.7% in Tajiks from Balkh (2/54).[13]

Pakistan

[edit]

There are just two other confirmed G-M377 samples that have been publicly reported in the academic literature so far, one Pashtun in the Khyber Pakhtunkhwa province of Pakistan and one Burusho in the Hunza Valley in Kashmir. These two G-M377 are Y-STR haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages.[2] Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G-M377, making it likely that this single G is G-M377 as well.[14] The Y Chromosome Haplotype Reference Database has several haplotypes from India and Pakistan that are very likely to be G-M377 [2].

Upcoming studies

[edit]

Two possible G-M377 Y-STR haplotype samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews[15] (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). However, recently advancements in haplogroup prediction have determined these haplotypes G-M377. These also belong to what was termed at the time "Haplogroup 2", (F*, G, and I)[16] and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G-M377. In this study, G-M377 was found among 3% of Kurdish Jews.[17] Other Y chromosome samples taken from an upcoming study of Sephardi and Near Eastern (Mizrahi) Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches any of the modal haplotypes for G-M377, however, all of these samples are being tested for M377.

Comparison of regional haplotypes

[edit]
Population and
Location
n Status DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS392 DYS389 DYS438 DYS461
= add 2 to DYSA7.2
Ashkenazi Jews

Poland–Lithuania
Western Germany Sicilians

300 confirmed 12
13
 
22
23
24
 
15
16
9
10
11
13,15
13,16
14,16
11 12  
11
12
11 13,30
13,31
13,32
13,33
14,31
14,32
14,33
15,33
10 12
Turkey
Kars
1 confirmed 13 23 16 10 11 12 11 11 13,29
Pashtuns 1 confirmed 13 23 16 11 13,16 11 12 11 11 13,30
Pashtuns 6 confirmed 13 23 17 10 11 12 11 11 13,30 12
Burusho
Hunza Valley
1 confirmed 13 23 17 11 11 12 11 11 13,30 12
Greek
Athens
1 unlikely 13 23 16 11 13,16 11 13,31
Syrians 2 unlikely 13 23 16 11 14,16
14,15
11 13,30
Iranian
Tehran
1 unlikely 13 23 17 10 13,16 11 13,29
Iraqi Jew 1 predicted G2b 13 23 15 11 11 12 11
Armenians
The Ani region
Nagorno-Karabakh
5 predicted G2b 13 23 15 10 11 12 11
Kurdish Jews 3 predicted G2b 13 23 15 10 11 12 11

Time to the Most Recent Common Ancestor (TMRCA)

[edit]

The time to the Most Recent Common Ancestor (TMRCA) for European G-M377, derived by generating a median-joining network[18] of over 25 haplotypes with 67 Y-STRs, yields a date of 955 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years.[19] The mutation rate used is based on that of family groups with known most recent common ancestors.[20] So far, this TMRCA includes all groups of European G-M377, including it seems from preliminary evidence, the Italians.

This late tMRCA date for all of G-M377 in Europe raises the question of when G-M377 first entered Europe. If G-M377 entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically specific distribution of G-M377 in Europe combined with the very late TMRCA raises the question of from where G-M377 could have entered Europe. Also, was the spread of G-M377 in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G-M377, with samples from each region matching some from other regions more closely than ones from the same region.

Possible history

[edit]

One very early G-M3115 sample, although it was derived as a negative for the SNP M377, was found in the remains of an individual dating back to 7000 BCE at Wezmeh Cave, a site near Eslamabad-e Gharb in the Kermanshah province in western Iran.[21] Specifically, it belonged to G-Y37100.[22]

Sicily

[edit]

It is estimated that Jews made up 6% or more of the population of Sicily in 1492.[23] Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. There was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580s. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.[23][24][25][26]

In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2b in Germany may be due to an earlier migration from France or Spain; as the presence of G2b2 ancestors in Germany appears to date from at least the early 1500s.

Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire.[27] After the Muslim conquest of Sicily in 831–902, large numbers of Jews settled on the island.[28] In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina.[29] In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there.[23][30][31] This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.

The preliminary conclusions from this evidence is that haplogroup G2b is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2b in Iberia and also so far among Spanish Jews indicates that G2b didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2b. We know that Greek and Mizrahi Jews arrived in Sicily as late as 1149, and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily. This is one way of explaining the very late presence of G2b in Europe, the likely presence of G2b among at least Kurdish Jews, if not other Mizrahi Jews as well.

Pashtuns and the Burushos

[edit]

The presence in these areas may be accounted for by several separate theories, each with their own time scale. It does seem very likely that G-M377 originated in the Near East, in Anatolia or Syria, and spread both eastward and westward from there.

One often stated idea is of a direct Israelite ancestry for the Pashtuns as a whole. These stories were disseminated in medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes, but this would depend on the frequency of G-M377 among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.

The Silk Road

[edit]
The Medieval Silk Road, which extended from Sicily to Samarkand, the Hunza Valley, and on to Kaifeng, China.

The rarity of G-M377 in northeast Pakistan could indicate that G-M377 in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G-M377 haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G-M377 based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G-M377 to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.[32]

A Northern Near Eastern / South Caucasian origin for G-M377 is much more likely. The Turkish G-M377 haplotype, and 5 of 6 other almost certain G-M377 Armenian haplotypes have ancestors from a small region in Kars Province of Turkey near the medieval capitals of Armenia. The rarity of G-M377, which is limited to this small area which only became important after the year 884 is most likely due to G-M377 arriving in the region after this time.

Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G-M377 could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora to Italy and then Central and Eastern Europe.

Famous people in haplogroup G-M377

[edit]

See also

[edit]

References

[edit]
  1. ^ "G-M377 YTree". www.yfull.com. Retrieved 25 March 2023.
  2. ^ a b c Sengupta S, Zhivotovsky LA, King R, Mehdi SQ, Edmonds CA, Chow CE, Lin AA, Mitra M, Sil SK, Ramesh A, Usha Rani MV, Thakur CM, Cavalli-Sforza LL, Majumder PP, Underhill PA (Feb 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". American Journal of Human Genetics. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230. PMID 16400607.
  3. ^ "G-M3115 YTree". www.yfull.com. Retrieved 2024-01-11.
  4. ^ "The Genetic Atlas". thegeneticatlas.com.
  5. ^ Behar DM, et al. (July 2010). "The genome-wide structure of the Jewish people". Nature. 466 (7303): 238–42. Bibcode:2010Natur.466..238B. doi:10.1038/nature09103. PMID 20531471. S2CID 4307824.
  6. ^ "ISOGG 2019 Y-DNA Haplogroup Tree". isogg.org. Retrieved 2024-01-11.
  7. ^ Behar DM, Garrigan D, Kaplan ME, Mobasher Z, Rosengarten D, Karafet TM, Quintana-Murci L, Ostrer H, Skorecki K, Hammer MF (Mar 2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294. S2CID 10310338.
  8. ^ Hammer MF, Behar DM, Karafet TM, Mendez FL, Hallmark B, Erez T, Zhivotovsky LA, Rosset S, Skorecki K (Nov 2009). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Human Genetics. 126 (5): 707–17. doi:10.1007/s00439-009-0727-5. PMC 2771134. PMID 19669163.
  9. ^ Deutsch, Gotthard (1906). "Austria - From the Expulsion of 1420 to that of 1670". Jewish Encyclopedia. Retrieved 2007-09-16.
  10. ^ Underhill, Peter (2007-09-24). "Personal communication from the primary author".
  11. ^ Cinnioğlu C, King R, Kivisild T, Kalfoğlu E, Atasoy S, Cavalleri GL, Lillie AS, Roseman CC, Lin AA, Prince K, Oefner PJ, Shen P, Semino O, Cavalli-Sforza LL, Underhill PA (Jan 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. S2CID 10763736.
  12. ^ "G-M377 YTree". www.yfull.com. Retrieved 2024-01-11.
  13. ^ Di Cristofaro, Julie; Pennarun, Erwan; Mazières, Stéphane; Myres, Natalie M.; Lin, Alice A.; Temori, Shah Aga; Metspalu, Mait; Metspalu, Ene; Witzel, Michael; King, Roy J.; Underhill, Peter A.; Villems, Richard; Chiaroni, Jacques (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10) e76748. Bibcode:2013PLoSO...876748D. doi:10.1371/journal.pone.0076748. PMC 3799995. PMID 24204668.
  14. ^ Firasat S, Khaliq S, Mohyuddin A, Papaioannou M, Tyler-Smith C, Underhill PA, Ayub Q (Jan 2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–6. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
  15. ^ Rosenthal, Herman; J.G. Lipman (1906-05-01). "Kurdistan". In Isidore Singer, Ph.D. (ed.). Jewish Encyclopedia (1st ed.). New York, New York: Funk & Wagnall. pp. 585–586. Retrieved 2007-10-20.
  16. ^ Y Chromosome Consortium (2002). "YCC NRY Tree 2002 v2002.01.18". Retrieved 2007-09-16.{{cite web}}: CS1 maint: deprecated archival service (link)
  17. ^ Nebel A, Filon D, Brinkmann B, Majumder PP, Faerman M, Oppenheim A (Nov 2001). "The Y chromosome pool of Jews as part of the genetic landscape of the Middle East". American Journal of Human Genetics. 69 (5): 1095–112. doi:10.1086/324070. PMC 1274378. PMID 11573163.
  18. ^ Bandelt HJ, Forster P, Röhl A (Jan 1999). "Median-joining networks for inferring intraspecific phylogenies". Molecular Biology and Evolution. 16 (1): 37–48. doi:10.1093/oxfordjournals.molbev.a026036. PMID 10331250.
  19. ^ Kandell, Ted. "G2b tMRCA estimate (fast mutation STRs = 5) @ 81 years per rho = 1489". Retrieved 2007-10-03. [dead link]
  20. ^ Kandell, Ted (2007-09-29). "G2b Athey family median-joining network tMRCA estimate (fast mutating STRs = 5) @ 81 years per rho = 1641 (average birth year = 1947, known MRCA b. 1643)". Archived from the original on 2011-07-28. Retrieved 2007-10-03.
  21. ^ Broushaki, F.; et al. (2016). "Early Neolithic genomes from the eastern Fertile Crescent | Science". Science. 353 (6298): 499–503. doi:10.1126/science.aaf7943. PMC 5113750. PMID 27417496.
  22. ^ "G-Y37100 YTree".
  23. ^ a b c Talalay Dardashti, Schelly (2006-08-20). "Tracing the Tribe: At the ICJG: Jews in Italy". Retrieved 2007-09-19.
  24. ^ Singer, Isidore (1906). "Rapoport". Jewish Encyclopedia. Retrieved 2007-09-16.
  25. ^ Kayserling, Meyer; Gotthard Deutsch; M. Seligsohn; Peter Wiernik; N.T. London; Solomon Schechter; Henry Malter; Herman Rosenthal; Joseph Jacobs (1906). "Katzenellenbogen". Jewish Encyclopedia. Retrieved 2007-09-16.
  26. ^ Colletta, John Phillip (2003). Finding Italian Roots: The Complete Guide for Americans. Genealogical Publishing. pp. 146–148. ISBN 978-0-8063-1741-0.
  27. ^ Neil, Bronwen (2000-11-25). "Roman Emperors - DIR Leo II". Retrieved 2007-09-23.
  28. ^ Cracco Ruggini, Lellia (1984). "Christianization in Sicily (IIIrd - VIIth Century)" (PDF). Gerión: 226. Archived from the original (PDF) on 2011-06-09. Retrieved 2007-09-23.
  29. ^ Dieli, Art (2005-12-13). "Italia Judaica". Retrieved 2007-09-23.
  30. ^ Martino, Giuseppe (2005-10-11). "The Jews of Messina" (in Italian and English). Retrieved 2007-09-19.
  31. ^ Dieli, Art (2005-11-29). "Jewish Names in Sicily". Retrieved 2007-09-19.
  32. ^ Shirazi, S.A.J. (2006-07-11). "Guest Post: Adventures up the Silk Road: All Things Pakistan". Retrieved 2007-09-23.
[edit]

Sites

[edit]

Maps

[edit]

Mailing Lists

[edit]