Haplogroup Q-M242: Difference between revisions

From Wikipedia, the free encyclopedia
Browse history interactively
← Previous editNext edit →
Content deleted Content added
VisualWikitext
→‎References: Adding Bibliography that uses internally consistent citation methods
Line 184: Line 184:
===Citations===
===Citations===
{{reflist|2}}
{{reflist|2}}

=== Bibliography ===
:{{Cite journal | doi =10.1086/499411 }}
:{{Cite journal | doi =10.1111/j.1469-1809.2006.00343.x }}
:{{Cite journal | doi =10.1134/S102279540705011 }}
:{{Cite journal | doi =1 0.1007/s00439-003-1073-7 }}
:{{Cite journal | doi =10.1002/humu.20077 }}
:{{Cite journal | doi =10.1007/s004390000406 }}
:{{Cite journal | doi =10.1007/s00439-003-1031-4 }}
:{{Cite journal | doi =10.1007/s00439-006-0213-2 }}
:{{Cite journal | doi =10.1007/s10038-005-0322-0 }}
:{{Cite journal | doi =10.1016/j.ajhg.2008.01.020 }}
:{{Cite journal | doi =10.1016/j.ajhg.2008.01.020 }}
:{{Cite journal | doi =10.1038/ejhg.2009.6 }}
:{{Cite journal | doi =10.1038/nature02878 }}
:{{Cite journal | doi =10.1038/nature08835 }}
:{{Cite journal | doi =10.1038/sj.ejhg.5201726 }}
:{{Cite journal | doi =10.1038/sj.ejhg.5201934 }}
:{{Cite journal | doi =10.1073/pnas.171305098 }}
:{{Cite journal | doi =10.1086/377588 }}
:{{Cite journal | doi =10.1086/516757 }}
:{{Cite journal | doi =10.1093/molbev/msh009 }}
:{{Cite journal | doi =10.1159/000093774 }}
:{{Cite journal | doi =10.1186/1471-2148-7-232 }}
:{{Cite journal | doi =10.1186/1471-2156-10-59 }}
:{{Cite book | isbn =812971469 }}
:{{Cite book | isbn =9780549809661 }}


== External links ==
== External links ==

Revision as of 01:07, 14 February 2010

Haplogroup Q
Possible time of origin17,000 to 22,000 years ago[1][2]
Possible place of originUral or Siberia[3]
AncestorP
DescendantsQ-P36.2
Defining mutationsM242

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q one of two branchs of haplogroup P (M45). Haplogroup Q is believed to have arisen in Central Asia approximately 15,000 to 20,000 years ago. This haplogroup has many diverse haplotypes despite its low frequency among most populations outside of the Americas. There also are over a dozen subclades that have been sampled and identified in modern populations.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in the ISOGG 2008 tree because it is a value for an STR. This low frequency value been found as a novel Q lineage (Q5) in indian populations.[4]

The 2008 ISOGG Tree

Alternative Trees

This is Thomas Krahn's Proposed Tree for haplogroup Q:

  • P
    • M242
      • P36.2
        • MEH2
          • M120/N14, M265
          • M25, M143
          • M346, L56, L57, L232
            • L53, L54, L55, L213
              • M3
                • M19
                • M194
                • M199, P106, P292
              • L191
            • M323
          • P89
        • M378, L214, L215
          • L245

Haplogroup and Subclade Defining SNPs

Academic Name RS ID Postion Change YCC 2008 rev ISOGG 2008 Parent Clade Publications Notes
P48 - 13006660-13006661 –>T Q1a4 Q1a4 MEH2 This is now considered a private SNP. The positive sample from Karafet 2008 was retested at the Family Tree DNA GRC and was found to be negative.
L57 rs34864948 14083496 A/G - - P36.2
L191 - 2947379 A>del - - {M346, L56, L57} The L191 SNP was found while testing a sample for M346 at the Family Tree DNA GRC. The lab does not have a second example or a public haplotype. L191 should then be considered private.
L213 rs34549365 8295033 C>G - - {M346, L56, L57}
L245 - 5735090 C>G - - {M378, L214, L215}
M346 - 2947156 C>G Q1a3 Q1a3 MEH2
L215 rs34601266 13399368 C>T - - P36.2
L55 rs35768544 17922729 G>A - - {M346, L56, L57}
L53 rs34724285 20101684 G>A - - {M346, L56, L57}
L54 rs34954951 21702170 G>A - - {M346, L56, L57}
L232 - 16025489 G>A - - M242 The SNP was found durring WTY testing at the Family Tree DNA GRC.
L56 rs34703625 8208869 G>A - - P36.2
P36.2 - 13006449 G>T Q1 Q1 M242
MEH2 rs4252209 4985637 G>T Q1a Q1a P36.2
L214 rs34694026 20365995 T>C - - P36.2
M3 rs3894 17605757 C>T Q1a3a Q1a3a {L53, L54, L55}
M194 rs2032677 13523944 T>C Q1a3a2 Q1a3a2 M3
P292 rs13447374 13540161 –>G Q1a3a3 Q1a3a3 M3
P106 - 13932316 G>A Q1a3a3 Q1a3a3 M3
M19 rs3910 20192619 T>A Q1a3a1 Q1a3a1 M3
M199 rs2032589 13540505-13540504 –>G Q1a3a3 Q1a3a3 M3
M323 rs13447377 20327106 C>T Q1a6 Q1a6 M346
P89.1 - 13359859 G>T Q1a5 Q1a5 MEH2 Limited research indicates that this may be a private SNP. The P89 mutation is also found in R1b.
M265, N14 rs3212294 13540044 C>A Q1a1 Q1a1 MEH2
M242 rs8179021 13527976 C>T Q Q P SNPs
M378 - 13536901 A>G Q1b Q1b P36.2
M25 - 20326052 G>C Q1a2 Q1a2 P36.2
M143 - 20349206 G>T Q1a2 Q1a2 P36.2
M120 - 20366782 T>C Q1a1 Q1a1 P36.2

Distribution

Haplogroup Q is found at low frequencies in Eurasia and Northern Africa including the Middle East. It is the dominate Y-chromosome haplogroup in the Americas. Haplogroup Q has been detected in Yemenite Jews, Algerians, Arabians, Syrians, Lebanese, Turks, Indians, Sri Lankans, Nepalese, Tibetans, Vietnamese, Balinese, Han Chinese, Koreans, and Japanese.

Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[2] The highest frequinces of Q in Eurasia are found amoung the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.

The frequency of Q in Norway and northern China is about 4%, with Chinese samples of haplogroup Q belonging almost exclusively to the subclade Q1a1-M120.[6][7] 3% of Hungarian males are in haplogroup Q. In Iran, the frequency runs between approximately 2.6% in the south and 9.1% in the north; Iranian samples of haplogroup Q belong primarily to the subclade Q-M25.[12] In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)[21] or 3.4% (6/176).[9] Haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians,[22] 16% of Tuvans,[23] and 3% of Uyghurs,[24] all of which are Turkic peoples inhabiting parts of Central Asia and southern Siberia. Haplogroup Q is found in approximately 3% of males in Tibet[11] and Mongolia,[24] approximately 2.5% of males in Saudi Arabia,[16] and approximately 2% of males in Turkey,[14] Lebanon,[25] the United Arab Emirates,[17] Indigenous peoples of the Americas at 9% and Na-Dené speakers at a rate of 25%.[26]

In a most recent study Gokcumen finds that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.[27]

According to Behar et al. [28] 5% of Ashkenazi males belong to haplogroup Q.

Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent, though in low frequency.[4] A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent. However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) .[4] Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration,[4] Q5 may be positioned as Q1a7.

Subclade Q1a3a (Q3)

Further information: Indigenous Amerindian genetics and Haplogroup Q1a3a (Y-DNA)

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 20,000 to 15,000 years ago.[2] This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).[2]

See also


  • Subclades
    • Q1a3a (The only Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas.[29])

References

Citations

  1. ^ Fagundes, Nelson J.R. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages {{cite journal}}: Unknown parameter |coauthors= ignored (|author= suggested) (help)
  2. ^ a b c d Zegura SL, Karafet TM, Zhivotovsky LA, Hammer MF (2004). "High-resolution SNPs and microsatellite haplotypes point to a single, recent entry of Native American Y chromosomes into the Americas" (PDF). Mol. Biol. Evol. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. {{cite journal}}: Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link) Cite error: The named reference "Zegura" was defined multiple times with different content (see the help page).
  3. ^ a b "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21. Haplogroups are defined by unique mutation events such as single nucleotide polymorphisms, or SNPs. These SNPs mark the branch of a haplogroup, and indicate that all descendents of that haplogroup at one time shared a common ancestor. The Y-DNA SNP mutations were passed from father to son over thousands of years. Over time, additional SNPs occur within a haplogroup, leading to new lineages. These new lineages are considered subclades of the haplogroup. Each time a new mutation occurs, there is a new branch in the haplogroup, and therefore a new subclade. Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present Cite error: The named reference "Genebase" was defined multiple times with different content (see the help page).
  4. ^ a b c d Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.{{cite journal}}: CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link)
  5. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
  6. ^ a b Wen B, Li H, Lu D; et al. (2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations {{cite journal}}: Explicit use of et al. in: |author= (help); External link in |quote= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  7. ^ a b c Bing Su, Chunjie Xiao, Ranjan Deka et al., "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas," Human Genetics (2000) 107 : 582–590. DOI 10.1007/s004390000406
  8. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R; et al. (2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region {{cite journal}}: Explicit use of et al. in: |author= (help); External link in |quote= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  9. ^ a b c d e Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
  10. ^ I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," Annals of Human Genetics Volume 71 Issue 4, Pages 480 - 495 (July 2007).
  11. ^ a b c Gayden T, Cadenas AM, Regueiro M; et al. (2007). "The Himalayas as a directional barrier to gene flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  12. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  13. ^ Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
  14. ^ a b Cinnioğlu C, King R, Kivisild T; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  15. ^ Mirabal S, Regueiro M, Cadenas AM; et al. (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. doi:10.1038/ejhg.2009.6. PMID 19259129. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  16. ^ a b Khaled K. Abu-Amero, Ali Hellani, Ana M. Gonzalez et al., "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions," BMC Genetics 2009, 10:59 doi:10.1186/1471-2156-10-59
  17. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816. {{cite journal}}: Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  18. ^ Bortolini MC, Salzano FM, Thomas MG; et al. (2003). "Y-chromosome evidence for differing ancient demographic histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  19. ^ Peidong Shen, Tal Lavi, Toomas Kivisild, Vivian Chou, Deniz Sengun, Dov Gefel, Issac Shpirer, Eilon Woolf, Jossi Hillel, Marcus W. Feldman, and Peter J. Oefner, "Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation," Human Mutation 24:248-260 (2004). Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
  20. ^ http://www.familytreedna.com/public/AshinaRoyalDynasty/default.aspx?section=results
  21. ^ Sadaf Firasat, Shagufta Khaliq, Aisha Mohyuddin, Myrto Papaioannou, Chris Tyler-Smith, Peter A Underhill and Qasim Ayub: "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan." European Journal of Human Genetics (2007) Vol. 15, p. 121–126.
  22. ^ V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  23. ^ Brigitte Pakendorf, Innokentij N. Novgorodov, Vladimir L. Osakovskij et al., "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts," Human Genetics (2006) 120:334–353 DOI 10.1007/s00439-006-0213-2
  24. ^ a b Hammer et al., "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes," © The Japan Society of Human Genetics, Springer-Verlag (2005)
  25. ^ Zalloua PA, Xue Y, Khalife J; et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  26. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30.
  27. ^ http://proquest.umi.com/pqdlink?Ver=1&Exp=05-24-2014&FMT=7&DID=1601911211&RQT=309&attempt=1
  28. ^ http://www.springerlink.com/content/xvj2jwclptvrvmer/
  29. ^ The Journey of Man: A Genetic Odyssey (Digitised online by Google books). Random House. ISBN 0812971469. Retrieved 2009-11-21. {{cite book}}: |first= missing |last= (help)

Bibliography

. doi:10.1086/499411. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1111/j.1469-1809.2006.00343.x. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1134/S102279540705011. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:1 0.1007/s00439-003-1073-7. {{cite journal}}: Check |doi= value (help); Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1002/humu.20077. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1007/s004390000406. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1007/s00439-003-1031-4. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1007/s00439-006-0213-2. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1007/s10038-005-0322-0. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1016/j.ajhg.2008.01.020. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1016/j.ajhg.2008.01.020. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1038/ejhg.2009.6. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1038/nature02878. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1038/nature08835. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1038/sj.ejhg.5201726. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1038/sj.ejhg.5201934. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1073/pnas.171305098. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1086/377588. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1086/516757. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1093/molbev/msh009. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1159/000093774. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)
. doi:10.1186/1471-2148-7-232. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)CS1 maint: unflagged free DOI (link)
. doi:10.1186/1471-2156-10-59. {{cite journal}}: Cite journal requires |journal= (help); Missing or empty |title= (help)CS1 maint: unflagged free DOI (link)
. ISBN 812971469. {{cite book}}: Check |isbn= value: length (help); Missing or empty |title= (help)
. ISBN 9780549809661. {{cite book}}: Missing or empty |title= (help)

External links

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_Q-M242&oldid=343873704"