Haplogroup J (Y-DNA)

From Wikipedia, the free encyclopedia

Jump to: navigation, search
Haplogroup J

Time of origin 25,000-30,000 years BP
Place of origin Southwest Asia
Ancestor IJ
Descendants J1, J2
Defining mutations M304

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.

Contents

[edit] Origins

Haplogroup J is believed to have arisen roughly 30,000 years ago in Southwest Asia (31,700±12,800 years ago according to Semino et al.. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J have mutations in common deriving from Haplogroup IJ (S2, S22). Haplogroup IJ and haplogroup K derive from Haplogroup IJK (L15/S137, L16/S138), and only at this level of classification does haplogroup IJK join with Haplogroup G and Haplogroup H as immediate descendants of Haplogroup F. The main current subgroups J1 and J2, which now comprise between them almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.

Haplogroup J is found in greatest concentration in Southwest Asia. Outside of these regions, haplogroup J has a moderate presence in Southern Europe (especially in central and southern Italy, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2-M172. Haplogroup J is also found in North Africa and the Horn of Africa, particularly in the form of its subclade J1-M267. Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy.

[edit] Subclades

Below are the subclades of Haplogroup J with their defining mutation, according to the ISOGG tree (as of February 2009). Note that the descent-based identifiers may be subject to change, as new SNPs are discovered that augment and further refine the tree.

  • J (12f2.1, M304, S6, S34, S35)
    • J* Common in Socotra
    • J1 (M267) Found frequently in the Arabian Peninsula, Dagestan, Mesopotamia, the Levant and Semitic-speaking populations of North Africa and Northeast Africa, with a moderate distribution throughout Southwest Asia
      • J1*
      • J1a (M62)
      • J1b (M365)
      • J1c (M390) - formerly J1e
      • J1d (P56)
      • J1e (P58)
        • J1e1 (M367, M368) - formerly J1c
        • J1e2 (M369) - formerly J1d
    • J2 (M172) Found frequently in populations of the Fertile Crescent, Anatolia, Southeast Europe, and the Caucasus, with a moderate distribution throughout Southwest Asia, Central Asia, South Asia, and North Africa
      • J2*
      • J2a (M410)
        • J2a*
        • J2a1 (L26/S57, L27)
          • J2a1*
          • J2a1a (M47, M322)
          • J2a1b (M67 (S51))
            • J2a1b*
            • J2a1b1 (M92, M260)
              • J2a1b1*
              • J2a1b1a (M327)
            • J2a1b2 (M163, M166)
          • J2a1c (M68)
          • J2a1d (M158) - formerly J2a1e
          • J2a1e (M319) - formerly J2a1h
          • J2a1f (M339) - formerly J2a1i
          • J2a1g (M419) - formerly J2a1j
          • J2a1i (P81) (location beneath DYS413≤18, S57 not certain)
          • J2a1j (P279) (location beneath DYS413≤18, S57 not certain)
          • J2a1k (L24, L25)
            • J2a1k1 (DYS 445 < 7) - formerly J2a1h
              • J2a1k1a (M137) - formerly J2a1d
              • J2a1k1b (M289) - formerly J2a1f
              • J2a1k1c (M318) - formerly J2a1g
        • J2a2 (M340)
      • J2b (M12, M314, M221, M102) Mainly found in the Balkans, Greece, Italy, and South Asia (possibly from Ancient Greeks)
          • J2b1 (M205) - formerly J2b1b
          • J2b2 (M241) - formerly J2b1a
            • J2b2*
            • J2b2a (M99) - formerly J2b1a1
            • J2b2b (M280) - formerly J2b1a2
            • J2b2c (M321) - formerly J2b1a3
            • J2b2d (P84)
            • J2b2e (DYS455≤9)

[edit] J1

Main article: Haplogroup J1 (Y-DNA)

Haplogroup J1, defined by the 267 marker is most frequent in the Arabian Peninsula Yemen(76%)[1], Saudi (64%) [2], Qatar (58%)[3], and Dagestan (56%)[4]. J1 is generally frequent amongst Arab Bedouins (62%[5]. It is also very common among other Arabs such as those of the southern Levant, i.e. Palestinian Arabs (38.4%) [6], in Algeria (35%)[7], Iraq (68%), Tunisia (31%)[8], Syria (30%), Lebanon (19%) [9], Egypt (20%)[10], and the Sinai Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic speaking countries with mainly non-Arabic speaking countries, such as Turkey (9%) and Iran (9.5%) [11].

[edit] J2

Main article: Haplogroup J2 (Y-DNA)

Haplogroup J2 is found in the highest concentrations in the Fertile Crescent and is found throughout the Mediterranean (including Southern Europe and North Africa), the Balkan peninsula, the Caucasus, the Iranian plateau and into Central Asia[12]. More specifically it is found in Iraq, Syria, Lebanon, Palestine, Turkey, Azerbaijan, Israel, Greece, Italy, the Balkans and the eastern coasts of the Iberian Peninsula[13], and most frequently in Lebanese 30% (Wells et al. 2001), Iraqis 29.7% (Sanchez et al. 2005), Syrians 29%, Sephardic Jews 29%, Kurds 28.4%, Iranians 24%[14].

[edit] J*

Haplogroup J* includes all of J except for J1 and J2. J* is rarely found outside of the island of Socotra, where it is quite frequent at 71.4%[15]. Haplogroup J* has also been found with lower frequency in Oman,[16] Ashkenazi Jews,[17] Pakistan[18], Greece,[16] the Czech Republic,[16] and several Turkic peoples.[4][11][19]

[edit] Mutation

The technical details of M304 are:

Nucleotide change: A to C
Position (base pair): 421
Total size (base pairs): 527
Forward 5′→ 3′: caaagtgctgggattacagg
Reverse 5′→ 3′: cttctagcttcatctgcattgt

[edit] Haplotypes

[edit] Modal

DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 12 23 14 10 14 17 11 16 11 13 11 30 17 8 9 11 11 26 14 20 28 13 14 15 16
See also: Y-chromosomal Aaron

[edit] Famous

Main article: Famous haplogroup members

Matt Lauer belongs to Y-DNA haplogroup J.[20]

[edit] See also

[edit] References

  1. ^ *Alshamali et al. 2009 81% (84/104) *Malouf et al. 2008: 70% (28/40) *Cadenas et al. 2008: 45/62 = 72.6% J1-M267
  2. ^ Local Population Structure in Arabian Peninsula Revealed by Y-STR Diversity, Alshamali et al. 2009
  3. ^ Cadenas et al. 2008 42/72 = 58.3% J1-M267
  4. ^ a b Yunusbaev et al. 2006:Dargins (91%), Avars (67%), Chamalins (67%), Lezgins (58%), Tabassarans (49%), Andis (37%), Bagvalins (21.4%))stats combined Dagestan ethnic groups see Dagestan article
  5. ^ 21/32 Nebel et al. 2001
  6. ^ Semino et al. 2004
  7. ^ Semino et al. 2005
  8. ^ combined (Semino et al. 2004 30%) & (Arredi et al. 2004 32%)
  9. ^ (Zalloua et al. 2008 20%) Wells et al. 2001: 32.0% E-M96, 30.0% J1-M267, 30.0% J2-M172, 2.0% L-M20, 6.0% R1-M173. (Zalloua et al. 2008) 184 out of 914, Y-chromosomal diversity in Lebanon is structured by recent historical events,Zalloua et al. 2008
  10. ^ The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations, J. R. Luis et al. 2004
  11. ^ a b Cinnioglu et al. (2004), Excavating Y-chromosome haplotype strata in Anatolia
  12. ^ O. Semino et al. (2004), Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area, American Journal of Human Genetics 74(5):1023-34.
  13. ^ F. Di Giacomo et al. (2003), Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects, Molecular Phylogenetics and Evolution 28(3):387-95.
  14. ^ Y haplogroup J in Iran by Alfred A. Aburto Jr.
  15. ^ Viktor Cerny et al. (2008),J*-12f2(xJ1-M267, J2-M172)(45/63)
  16. ^ a b c F. Di Giacomo et al. (2004), "Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe," Human Genetics 115: 357–371.
  17. ^ Peidong Shen, Tal Lavi, Toomas Kivisild, Vivian Chou, Deniz Sengun, Dov Gefel, Issac Shpirer, Eilon Woolf, Jossi Hillel, Marcus W. Feldman, and Peter J. Oefner, "Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation," Human Mutation 24:248-260 (2004). Haplogroup J-M304(xJ1-M267, J2-M172) in 1/20 Ashkenazi Jews.
  18. ^ Firasat et al. (2007), J*-12f2(xJ1-M267, J2-M172): 1.0% (1/97) "Burusho," 3.0% (19/638) "Pakistan"
  19. ^ Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
  20. ^ [1], ISOGG

[edit] External links

[edit] Phylogenetic tree and Distribution Maps of Y-DNA haplogroup J

[edit] Other


Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)
most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L M NOP S T
|
NO P
| |
N O Q R
Retrieved from "http://en.wikipedia.org/wiki/Haplogroup_J_(Y-DNA)"
Personal tools