Haplogroup R2

Haplogroup R2
Haplogroup R2
	File:R2, Y-DNA haplogroup.jpg
Possible time of origin	28,200 ybp
Possible place of origin	South Asia
Ancestor	Haplogroup R
Descendants	Haplogroup R2a
Defining mutations	M479
Highest frequencies	South Asia

Haplogroup R2, or haplogroup R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It has been concentrated geographically in South Asia since prehistoric times.

Subclades

Haplogroup R2

Haplogroup R2a

Paragroup R-M479*

Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.

Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.

Frequency of Paragroup R-M479* (M479+, M124-)
	Count	Sample size	R-M479* Frequency
Portugal, Lisbon	1	100	0.010
Andalusia, Sevilla	1	127	0.008
Bashkirs (Bashkortostan, Russia)	1	39	0.026
Italy North	1	124	0.008
Ossetian South (South Caucasus)	1	23	0.043
Pakistan North	6	85	0.071

Haplogroup R-M124

Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.

Position on the ISOGG tree and related SNPs

Haplogroup R2 is a subgroup of Haplogroup R (M207):

R-M207 (M207)
- R-M306 (M306)
- R-M173 (M173)
- R-M479 (M479)
  - R-M124 (M124, P249, P267, L266)
    - R-L295 (L295)
    - R-L263 (L263)
    - R-L1069 (L1069)

Description of the M479 SNP

Common Name Marker	M479
YCC Haplogroup	R-M479
Nucleotide change	C to T
Amplicon size (bp) reference sequence	323
Polymorphism position from 5' end	107
Restriction enzyme variant	HphI
RefSNP ID	-
Y-position	19294055
Primer forward 5'-3'	gatactttatcaggcttacttc
Primer reverse 5'-3'	aaccaaatctctcagaatcg

Notes

External links

[vanOven2014-1] Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809. S2CID 23291764.

[ISOGG2015-2] International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)

[A0-T-3] Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4).

[A1-4] Haplogroup A1 is also known as A1'2'3'4.

[F-Y27277-5] F-Y27277, sometimes known as F2'4, is both the parent clade of F2 and F4 and a child of F-M89.

[LT-6] Haplogroup LT (L298/P326) is also known as Haplogroup K1.

[K2-7] Between 2002 and 2008, Haplogroup T-M184 was known as "Haplogroup K2". That name has since been re-assigned to K-M526, the sibling of Haplogroup LT.

[K2b-8] Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.

[K2b1-9] Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.

[P-10] Haplogroup P (P295) is also klnown as K2b2.

[K-M2313-11] K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. See: Poznik op. cit.; YFull YTree v5.08, 2017, "K-M2335", and; PhyloTree, 2017, "Details of the Y-SNP markers included in the minimal Y tree" (Access date of these pages: 9 December 2017)

[S-12] Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)

[M-13] Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)

[χ 1]

[χ 2]

[χ 3]

[χ 4]

[χ 5]

[χ 6]

[χ 7]

[χ 8]

[χ 9]

[χ 10]

[χ 11]

[χ 12]

[χ 13]