Jump to content

Haplogroup R2

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by DeprecatedFixerBot (talk | contribs) at 15:44, 14 May 2018 (Removed deprecated parameter(s) from Template:Columns-list using DeprecatedFixerBot. Questions? See Template:Div col#Usage of "cols" parameter or msg TSD! (please mention that this is task #2!))). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup R2
Possible time of origin27,000 BP[1]
Possible place of originSouth Asia or Central Asia[1]
AncestorHaplogroup R
DescendantsR2a (M124);
R2b (FGC21706)
Defining mutationsM479

Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).

R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels in North Pakistan. However, it also appears to have long been present at low levels in the Caucasus, Iran, Anatolia and Europe.

It has two primary branches: R2a (M124) and R2b (R-FGC21706)

Structure

  • R (M207/Page37/UTY2)
    • R1 (M173/P241/Page29)
    • R2 (M479/PF6107, L266/PF6108, L722, L726)
      • R2a (M124, F820/Page4, L381, P249)
        • R2a1 (L263)
        • R2a2 (P267/PF6109)
      • R2b (FGC21706, FGC50198, FGC50325, FGC50333, SK2163, SK2164, SK2165, SK2166)
        • R2b1 (FGC50339)


Source: ISOGG 2017.[1]

Geographical distribution

Frequency of R2(xR2a) (M479+, M124-)
Count Sample size Frequency (%)
Lisbon, Portugal 1 100 1.0[citation needed]
Seville, Andalusia, Spain 1 127 0.8[citation needed]
Bashkirs, Bashkortostan, Russia 1 39 2.6[citation needed]
Northern Italy 1 124 0.8[citation needed]
South Ossetia 1 23 4.3[citation needed]
Burusho, Gilgit-Baltistan, Pakistan 7 19 36.8[2]
North Pakistan 6 85 7.1[citation needed]

Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).

In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)

In 2013, R2(xR2a) was found in five out of 19 males from the Burusho minority of North Pakistan.[2]

R2a (R-M124)

Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249,[1] and is mainly found in South Asia, with lower frequencies in Central Asia and the Caucasus.[citation needed]

R2b (R-FGC21706)

Phylogenetic tree

M479

R2*

M124

 R2a

 FGC21706

 R2b

Description of the SNP M479

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

Notes

See also

Y-DNA R-M207 subclades

Y-DNA backbone tree