Jump to content

Haplogroup Q-M242: Difference between revisions

From Wikipedia, the free encyclopedia
Browse history interactively
← Previous editNext edit →
Content deleted Content added
VisualWikitext
edit
Nusdlog1 (talk | contribs)
105 edits
No edit summary
Line 149: Line 149:
The 12,6 thousand year old [[Clovis culture]] individual on the territory of [[Montana]] belonged to Q-L54*(xM3).<ref>M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.</ref><ref>Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.</ref>
The 12,6 thousand year old [[Clovis culture]] individual on the territory of [[Montana]] belonged to Q-L54*(xM3).<ref>M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.</ref><ref>Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.</ref>


Over the past decade, Chinese archaeologists have published several reviews regarding the results of excavations in Xinjiang. Particularly interesting are in the cemetery Heigouliang, Xinjiang (Black Gouliang cemetery), east of Barkol basin, near the city of [[Hami City|Hami]]. By typing results of DNA samples during the excavation of one of the tombs it was determined that of the 12 men there were: Q1a - 6, Q1b(1) (M378) - 4, Q-2 (unable to determine subclade).
Over the past decade, Chinese archaeologists have published several reviews regarding the results of excavations in Xinjiang. Particularly interesting are in the cemetery Heigouliang, Xinjiang (Black Gouliang cemetery, also known as the summer palace of Xiongnu king), east of Barkol basin, near the city of [[Hami City|Hami]]. By typing results of DNA samples during the excavation of one of the tombs it was determined that of the 12 men there were: Q1a*(xQ-M120, xQ-M25, xQ-M3) - 6, Q1b(1) (M378) - 4, Q*(xQ1a, xQ1b)-2 (unable to determine subclade).
Hosts of the tombs were representatives of Y-haplogroup Q1b(1)- M378 exclusively (while Y-DNA Q1a represents sacrificial victims). They date from the time of early (Western) Han (2nd-1st Century BC). Summarizing the data from available evidences, it is concluded that the tomb belongs to the representatives of the Xiongnu/Hunnu aristocracy.<ref>Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families. LL. Kang et al., 2013</ref><ref>Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008</ref><ref>Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Li Hongjie, Jilin University-China, 2012</ref>
All Y-haplogroup Q1b(1)- M378 are hosts of the tombs, while half of Y-DNA Q1a* represents hosts and half sacrificial victims). They date from the time of early (Western) Han (2nd-1st Century BC). Summarizing the data from available evidences, it is concluded that the tomb belongs to the representatives of the Xiongnu/Hunnu aristocracy.<ref>Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families. LL. Kang et al., 2013</ref><ref>Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008</ref><ref>Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Li Hongjie, Jilin University-China, 2012</ref>


==See also==
==See also==

Revision as of 16:35, 9 January 2015

Haplogroup Q
Possible time of origin17,000 to 22,000 years ago[1][2]
Possible place of originCentral Asia,[3] the Indian Subcontinent,[4] Siberia[5]
AncestorP
DescendantsQ-P36.2 (P36.2)
Defining mutationsM242
Highest frequenciesKets, Selkups, and indigenous peoples of the Americas

Haplogroup Q-M242 is a Y-chromosome DNA haplogroup.

Origins

Haplogroup Q-M242 is one of the two branches of haplogroup P-M45. Haplogroup Q-M242 is believed to have arisen in North Asia approximately 17,000 to 22,000 years ago.[6] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of the M242, P36.2, and MEH2 SNPs as defining mutations.

This haplogroup has many diverse haplotypes. There also are over a dozen subclades that have been sampled and identified in modern populations.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center Draft tree

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q-M242. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[7]

  • P
    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1

The Y-Chromosome Consortium tree

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[6] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[8] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • P-M45
    • Q-M242 M242
      • Q-P36.2 P36.2
        • Q-MEH2 MEH2 (Q1a)
            • Q-M120 M120, N14, M265 (Q1a1a1)
            • Q-M25 M25, M143 (Q1a1b)
          • Q-M346 L56, L57, M346 (Q1a2)
            • Q-P89.1 P89.1 (Unknown one singleton probably part of Q1a2)
        • Q-L275 L275 (Q1b)
          • Q-M378 L214, L215, M378 (Q1b1)

The 2011 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation(s), according to the 2011 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • Q M242
    • Q-P36.2 P36.2, L232, L273, L274
      • Q-MEH2 MEH2
        • Q-M120 M120, M265/N14
        • Q-M25 M25, M143
        • Q-M346 L56, L57, M346, L528
      • Q-L275 L275, L314
        • Q-M378 M378/Page100, L214, L215/Page82

Phylogenetic variants

The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR DYS435 with a value of 8--> 9 [4] with in haplogroup Q M242 and the trend is to include only binary markers in phylogenetic trees. However, interestingly analysis of STR based haplotypes from Sharma 2007 indicates that the DYS435=9 variant, using online haplogroup prediction tool (like http://www.hprg.com), did not indicate an earlier established sub clade of Y-haplogroup Q.

Distribution

Haplogroup Q-M242 may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, North Africa, East Asia, South Asia, West Asia, and in Europe.

The Americas

Further information: Indigenous Amerindian genetics and Y-DNA haplogroups in Indigenous peoples of the Americas

Several branches of haplogroup Q-M242 are part of the pre-Columbian male lineages in the predominant Y-chromosome haplogroup in indigenous peoples of the Americas. They were part of groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups had few founders, but they must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In Canada, two other lineages have been found. These are Q-P89.1 and Q-NWT01. They may not be from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of shifts in a small founder population over time. However, Q-M242 came to dominate the paternal lineages in the Americas. Indeed, haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of South America[9] and detected in Na-Dené speakers at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.[10]

However, a 4000-year-old Saqqaq individual belonging to Q-MEH2 haplogroup has been documented.[11]

Asia

Q-M242 origininated in Asia, and is widely distributed there.[2] It has been reported that Q-M242 is found in the Altai people,[12] India,[13] Tibet,[14] Pakistan,[13] China,[15][16] Vietnam,[17] Mongolia,[18] Tuvans,[19] and Uyghurs.[18] It was found in 9 out of 49 specimens (18%) in a Y-Haplogroup study of Pashtuns in Kabul the Capital of Afghanistan.[20]

North Asia

To the east, haplogroup Q-M242 has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians.[12] It is found in 16% of Tuvans.[19]

The highest frequencies of Q-M242 in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.

Q-M346 is found among the Khanty.[21]

East Asia

The frequency of Q-M242 in northern China is about 4%, with many Chinese samples of haplogroup Q-M242 belonging to the subclade Q-M120.[15][16] In a study published in 2011, researchers have reported finding haplogroup Q-M242 in 3.3% (12/361) of a sample of unrelated Han Chinese male volunteers at Fudan University in Shanghai with origins that can be traced back from all over China, though with a majority coming from East China.[22] Haplogroup Q-M242 is found in approximately 3% of males in Tibet[14] and Mongolia.[18] It is also found in 3% of Uyghurs.[18] Suclade Q1b-M378 exists troughout all Mongolia with examples in Japan.[23]

South Asia

Some examples of Q-M242 (negative for tested subclades) have been reported in the Indian subcontinent in low frequency.[4] The same studies have found Q-M346* (negative for known subclades) restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q-M242 to the Indian subcontinent followed by an autochthonous differentiation to Q-M346. However, these are from studies where all current branches of the Q-M242 tree have not been tested.

The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.

Southwest Asia

Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q-M242 in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q-M242 belong primarily to the subclade Q-M25.[24]

In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[25] or 3.4% (6/176).[26]

Approximately 2.5% of males in Saudi Arabia belong to haplogroup Q.[27]

According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q.[28] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.

Haplogroup Q-M242 has also been found in Algerians, Arabians, Syrians, Lebanese[29] and the United Arab Emirates.,[30]

Approximately 2% of males in Turkey belong to haplogroup Q.[31] In a study by Gokcumen it was found that among Turks that belong to the Afshar tribe haplogroup Q-M242 is seen with a prevalence of 13%.[32] Further, the Q-M25 subclade has been found in Turkey[31]

Europe

The frequency of haplogroup Q-M242 in Norway and Sweden is about 3%. It is believed that almost all of these are either Q-L527 or Q-L804. Around 2.5% of Slovak males are in haplogroup Q-M242.

Subclade distribution

aDNA

The 12,6 thousand year old Clovis culture individual on the territory of Montana belonged to Q-L54*(xM3).[46][47]

Over the past decade, Chinese archaeologists have published several reviews regarding the results of excavations in Xinjiang. Particularly interesting are in the cemetery Heigouliang, Xinjiang (Black Gouliang cemetery, also known as the summer palace of Xiongnu king), east of Barkol basin, near the city of Hami. By typing results of DNA samples during the excavation of one of the tombs it was determined that of the 12 men there were: Q1a*(xQ-M120, xQ-M25, xQ-M3) - 6, Q1b(1) (M378) - 4, Q*(xQ1a, xQ1b)-2 (unable to determine subclade). All Y-haplogroup Q1b(1)- M378 are hosts of the tombs, while half of Y-DNA Q1a* represents hosts and half sacrificial victims). They date from the time of early (Western) Han (2nd-1st Century BC). Summarizing the data from available evidences, it is concluded that the tomb belongs to the representatives of the Xiongnu/Hunnu aristocracy.[48][49][50]

See also

Populations

3

Genetics

3

Y-DNA Q-M242 subclades

3

Y-DNA backbone tree

References

Citations

  1. ^ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  2. ^ a b c Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. Cite error: The named reference "Zegura" was defined multiple times with different content (see the help page).
  3. ^ Y-DNA Haplogroup Q and its Subclades - 2010
  4. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.{{cite journal}}: CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link)
  5. ^ a b "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21. Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present Cite error: The named reference "Genebase" was defined multiple times with different content (see the help page).
  6. ^ a b Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  7. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Retrieved 2012. {{cite web}}: Check date values in: |accessdate= (help)
  8. ^ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  9. ^ Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
  10. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30.
  11. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
  12. ^ a b V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  13. ^ a b c The Y Chromosome Consortium 2008
  14. ^ a b c d Gayden T, Cadenas AM, Regueiro M; et al. (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link)
  15. ^ a b c Wen B, Li H, Lu D; et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations {{cite journal}}: Explicit use of et al. in: |author= (help); External link in |quote= (help)CS1 maint: multiple names: authors list (link)
  16. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
  17. ^ a b Tatiana M. Karafet, Brian Hallmark, Murray P. Cox et al. (2010) "Major East–West Division Underlies Y Chromosome Stratification across Indonesia," Mol. Biol. Evol. 27(8) 1833–1844. doi:10.1093/molbev/msq063 PMID 20207712
  18. ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  19. ^ a b Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541. {{cite journal}}: Cite has empty unknown parameter: |author-name-separator= (help); Unknown parameter |author-separator= ignored (help)
  20. ^ a b Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF; et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE. 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link)
  21. ^ Mirabal S, Regueiro M, Cadenas AM; et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link)
  22. ^ Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics. 19: 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364. PMID 21505448. {{cite journal}}: Explicit use of et al. in: |last5= (help)
  23. ^ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano
  24. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  25. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
  26. ^ a b c d e Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230. PMID 16400607. {{cite journal}}: Explicit use of et al. in: |first9= (help)
  27. ^ a b Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10: 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609. {{cite journal}}: Cite has empty unknown parameter: |author-name-separator= (help); Unknown parameter |author-separator= ignored (help)CS1 maint: unflagged free DOI (link)
  28. ^ a b http://www.springerlink.com/content/xvj2jwclptvrvmer/
  29. ^ Zalloua PA, Xue Y, Khalife J; et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link)
  30. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  31. ^ a b c Cinnioğlu C, King R, Kivisild T; et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link)
  32. ^ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.
  33. ^ Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella; et al. (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE. 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981. {{cite journal}}: Explicit use of et al. in: |first1= (help)CS1 maint: unflagged free DOI (link)
  34. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
  35. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R; et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region {{cite journal}}: Explicit use of et al. in: |author= (help); External link in |quote= (help)CS1 maint: multiple names: authors list (link)
  36. ^ Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.
  37. ^ a b c d e f g Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLoS ONE. 8 (10): e76748. doi:10.1371/journal.pone.0076748. {{cite journal}}: Explicit use of et al. in: |last6= (help)CS1 maint: unflagged free DOI (link)
  38. ^ Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLoS ONE. 9 (8): e103772. doi:10.1371/journal.pone.0103772. {{cite journal}}: Explicit use of et al. in: |last5= (help)CS1 maint: unflagged free DOI (link)
  39. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui; et al. (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE. 6 (8): e24282. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623. {{cite journal}}: Explicit use of et al. in: |first5= (help)CS1 maint: unflagged free DOI (link)
  40. ^ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. {{cite journal}}: Cite has empty unknown parameter: |author-name-separator= (help); Unknown parameter |author-separator= ignored (help)
  41. ^ Bortolini MC, Salzano FM, Thomas MG; et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798. {{cite journal}}: Explicit use of et al. in: |author= (help)CS1 maint: multiple names: authors list (link)
  42. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  43. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
  44. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982. {{cite journal}}: Explicit use of et al. in: |first9= (help)
  45. ^ The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q Vincenza Battaglia, Viola Grugni, Ugo Alessandro Perego, Norman Angerhofer, J. Edgar Gomez-Palmieri, Scott Ray Woodward, Alessandro Achilli, Natalie Myres, Antonio Torroni, Ornella Semino
  46. ^ M. Rasmussen et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225–229.
  47. ^ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  48. ^ Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families. LL. Kang et al., 2013
  49. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  50. ^ Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Li Hongjie, Jilin University-China, 2012

Bibliography

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_Q-M242&oldid=641748852"