Haplogroup I-M253

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by E-960 (talk | contribs) at 21:07, 31 October 2017 (Pls see talk page, the map makes unverified claims that make no sense when referenced to European history after WWII.). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup I1 (M253)
Possible time of origin3,170–5,070 BP[1][2] (previously 11,000 BP[3] to 33,000 BP[4])
Possible place of originNorthern Europe
AncestorI* (M170)
DescendantsI1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Defining mutationsM253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[5] It is a primary branch of Haplogroup I-M170 (I*).

The haplogroup reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[6] In terms of national averages, I-M253 is found in 35–38 per cent of Swedish males,[7] 32.8% of Danish males,[8] about 31.5% of Norwegian males,[9] and about 28% of Finnish males.[10]

Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.

Before a reclassification in 2008,[11] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).

Origins

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[1] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[2] It is suggested that it initially dispersed from the area that is now Denmark.[8]

A 2014 study in Hungary uncovered remains of nine individuals from the Linear Pottery culture, one of whom was found to have carried the M253 SNP which defines Haplogroup I1. This culture is thought to have been present between 6,500 and 7,500 years ago.[12]

Structure

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [5]

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • I-M227; I1a1a
      • I-L22 (L22/S142); I1a1b
        • I-P109; I1a1b1
        • I-L205 (L205.1/L939.1/S239.1); I1a1b2
        • I-Z74; I1a1b3
        • I-L300 (L300/S241); I1a1b4
          • I-L287
            • I-L258 (L258/S335)
          • I-L813
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Geographical distribution

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking period or modern times. It is found in all places invaded by the ancient Germanic peoples and the Vikings.

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia and Canada.

Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
Denmark 122 39.3 32.8 0.0 Underhill et al. 2007
England 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finland (national) 28.0 Lappalainen et al. 2006
Finland: West 230 40 Lappalainen et al. 2008
Finland: East 306 19 Lappalainen et al. 2008
Finland: Satakunta region 50+ Lappalainen et al. 20089
France 58 17.2 8.6 1.7 Underhill et al. 2007
France 12 16.7 16.7 0.0 Cann et al. 2002
France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
Germany 125 24 15.2 0.0 Underhill et al. 2007
Greece 171 15.8 2.3 0.0 Underhill et al. 2007
Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
Ireland 100 11 6.0 0.0 Underhill et al. 2007
Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
Latvia 113 3.5 Lappalainen et al. 2008
Lithuania 164 4.9 Lappalainen et al. 2008
Netherlands 93 20.4 14 0.0 Underhill et al. 2007
Norway 2826 31.5 Eupedia 2017 [better source needed]
Russia (national) 16 25 12.5 0.0 Cann et al. 2002
Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
Russia: Karelians 132 15.2 Lappalainen et al. 2008
Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Sweden (national) 160 35.6 Lappalainen et al. 2008
Sweden (national) 38.0 Lappalainen et al. 2009
Sweden: Västra Götaland 52 Lappalainen et al. 2009
Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
Ukraine: Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
Ukraine: Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ukraine: Cherkasso 114 28.1 4.3 0.0 Underhill et al. 2007
Ukraine: Belgorod 56 26.8 5.3 0.0 Underhill et al. 2007

Sweden

Denmark

Norway

Finland

Britain

See also: Prehistoric Britain
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[13] The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[14] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253

Main article: List of haplogroups of historical and famous figures

Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[15]

Birger Jarl, 'Duke of Sweden' of the Goths House of Bjalbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be also I-M253.

Markers

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[16]

Type: SNP
Source: M (Peter Underhill of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
ISOGG HG: I1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Nucleotide alleles change (mutation): C to T

Name: M307[17]

Type: SNP
Source: M (Peter Underhill)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: TTATTGGCATTTCAGGAAGTG
Primer R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Nucleotide alleles change (mutation): G to A

Name: P30[18]

Type: SNP
Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGTGGGCTGTTTGAAAAAGA
Primer R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40[19]

Type: SNP
Source: PS (Michael Hammer and James F. Wilson)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGAGAAAAGGTGAGAAACC
Primer R: GGACAAGGGGCAGATT
YCC HG: I1
Nucleotide alleles change (mutation): C to T
Region: ARSDP

See also

References

  1. ^ a b Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  2. ^ a b "TMRCAs of major haplogroups in Europe estimated using two methods. Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group". www.nature.com. Retrieved 2015-05-19.
  3. ^ Rootsi, Siiri; et al. (2004). "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323.
  4. ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
  5. ^ a b ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
  6. ^ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). "Migration Waves to the Baltic Sea Region". Annals of Human Genetics. 72 (3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359.
  7. ^ Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J.; Lahermo, P. (2009). "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656.
  8. ^ a b Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  9. ^ Eupedia, "Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage" (31 January 2017) .
  10. ^ Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp. 207–15.
  11. ^ Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  12. ^ "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". bioRxiv 008664. {{cite bioRxiv}}: Check |biorxiv= value (help)
  13. ^ Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
  14. ^ Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H.; Underhill, Peter A.; Bradshaw, Paul; Shaha, Alom; Thomas, Mark G.; Bradman, Neal; Goldstein, David B.; et al. (2003). "A Y Chromosome Census of the British Isles" (PDF). Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. {{cite journal}}: Explicit use of et al. in: |first9= (help); Unknown parameter |displayauthors= ignored (|display-authors= suggested) (help)
  15. ^ "Founding Father DNA". isogg.org.
  16. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
  17. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
  18. ^ P30[permanent dead link]
  19. ^ P40[permanent dead link]

External links

Haplogroup I databases
General Y-DNA databases

There are several public access databases featuring I-M253, including:

  1. http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  2. http://www.semargl.me/
  3. http://www.ysearch.org/
  4. http://www.yhrd.org/
  5. http://www.yfull.com/tree/I1/
Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_I-M253&oldid=808094823"