Jump to content

Haplogroup J (Y-DNA)

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by Sasha l~enwiki (talk | contribs) at 00:21, 1 November 2008 (→‎Distribution). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup J
File:Haplogroup IJ (Y-DNA).jpg
Possible time of origin30,000 years BP
Possible place of originMiddle East
AncestorIJ
Defining mutationsM304
File:J Y-DNA percentage.jpg
Haplogroup J Distribution

‎

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.

Origins

Haplogroup J is believed to have arisen 31,700 years ago (plus or minus 12,800 years) in the Near East (Semino et al. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J are descendants of Haplogroup IJ (S2, S22). Along with haplogroups G, H and K, haplogroup IJ is in turn derived from Haplogroup F. The main current subgroups J1 and J2, which now account between them for almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.

Haplogroup J is found in greatest concentration in the Middle East & Caucasus. Outside of these regions, haplogroup J has a moderate presence in Southern Europe (especially in central and southern Italy, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2-M172. Haplogroup J is also found in North Africa and the Horn of Africa, particularly in the form of its subclade J1-M267. Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy.

Subclades

The subclades of Haplogroup J with their defining mutation, according to the 2006 ISOGG tree:

  • J (12f2.1, M304, S6, S34, S35)
    • J*
    • J1 (M267) Typical of populations of the Arabian peninsula, Dagestan, Mesopotamia, the Levant and Semitic-speaking populations of North Africa and Northeast Africa, with a moderate distribution throughout Southwest Asia
      • J1*
      • J1a (M62)
      • J1b (M365)
      • J1c (M367, M368)
      • J1d (M369)
      • J1e (M390)
    • J2 (M172) Typical of populations of Near East, Southeast Europe and the Caucasus, with a moderate distribution throughout Southwest Asia, Central Asia, South Asia, and North Africa
      • J2*
      • J2a (M410)
        • J2a*
        • J2a1 (DYS413≤18)
          • J2a1*
          • J2a1a (M47, M322)
          • J2a1b (M67 (S51))
            • J2a1b*
            • J2a1b1 (M92, M260)
              • J2a1b1*
              • J2a1b1a (M327)
            • J2a1b2 (M163, M166)
          • J2a1c (M68)
          • J2a1d (M137)
          • J2a1e (M158)
          • J2a1f (M289)
          • J2a1g (M318)
          • J2a1h (M319)
          • J2a1i (M339)
          • J2a1j (M419)
          • J2a1k (DYS445≤7)
        • J2a2 (M340)
      • J2b (M12, M314, M221)
        • J2b*
        • J2b1 (M102) Mainly found in the Balkans, Greece, and Italy (possibly from Ancient Greeks)
          • J2b1*
          • J2b1a (M241)
            • J2b1a*
            • J2b1a1 (M99)
            • J2b1a2 (M280)
            • J2b1a3 (M321)
          • J2b1b (M205)

It is subdivided into two subclades: haplogroup J2, defined by the M172 marker, and haplogroup J1, defined by the M267 marker.

J1

Main article: Haplogroup J1 (Y-DNA)

Haplogroup J1 appears at high frequencies among populations of the Arabian Peninsula, Southern Levant, North Africa, and Dagestan. J1 was spread by two temporally distinct migratory episodes, the most recent one probably associated with the diffusion of Muslims from Arabia since the 6th century CE.

Haplogroup J1 is most frequent in the Arabian Peninsula (Yemen 85%, Hadramawt - Yemen 72%, Qatar 58% (Cadenas et al. 2008)) and Dagestan (Dargins 91%, Avars 67%, Chamalins 67%, Lezgins 58%, Tabassarans 49%, Andis 37%, Bagvalins 21% (Yunusbaev et al. 2006)).

J1 is generally frequent amongst Arabs of the southern Levant, i.e. Palestinian Arabs (38.4%) (Semino et al.) and Arab Bedouins (62% and 82% in Negev desert Bedouins). It is also very common among other Arabic-speaking populations, such as those of Algeria (35%), Syria (30%), Iraq (33%), the Sinai Peninsula, and the Arabian Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic countries with mainly non-Arabic countries, such as Turkey and Iran, yet it is found at low frequency among the populations of those countries, as well as in Cyprus, Sicily and the Iberian Peninsula. It entered Ethiopia with the spread of Semitic speakers (11% Eritrea & 9 % Ethiopia & Ethiopia-Amhara 33.3%). It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22; Algerians 35.0%, Tunisians 30.1%), where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. 2004). Researchers believe that marker DYS388=17 (Y DNA tests for STR - Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. 2004).

Haplogroup J1 is found almost exclusively among modern populations of the Southwest Asia, North Africa, and the Horn of Africa, essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages and Northeast Caucasian languages. The distribution of J1 outside of the Middle East may be associated with Arabs and Phoenicians who traded and conquered in Sicily, southern Italy, Spain, Azerbaijan, Turkey, and Pakistan, or with Jews, who have historical origins in the Middle East and speak (or historically spoke) a Semitic language, though typically Haplogroup J2 is more than twice as common among Jews. In Jewish populations overall, J1 constitutes 19.0% of the Ashkenazim results and 11.9% of the Sephardic results (Semino et al. 2004)(Behar et al. 2004). Haplogroup J1 with marker DYS388=13 is a distinctive type found in eastern Anatolia (Cinnioglu et al. 2004).

J2

Main article: Haplogroup J2 (Y-DNA)

Haplogroup J2 is found mainly in the Fertile Crescent, the Mediterranean (including Southern Europe and North Africa), the Iranian plateau and Central Asia[1]. More specifically it is found in Greece, Italy and the eastern coasts of the Iberian Peninsula[2], and more frequently in Iraqis 29.7% (Sanchez et al. 2005), Lebanese 29.7% (wells et al. 2001), Syrians 29%, Sephardic Jews 29%, Kurds 28.4% , Province of Kurdistan (28.4% of the population)[1], Saudi Arabia (18.9% of the northern and central-north region)[citation needed], in Jordan, in Israel[1], in Turkey [3], and in the southern Caucasus region [4]. According to Semino et al and the National Geographic Genographic Project, the frequency of haplogroup J2 generally declines as one moves away from the Northern fertile crescent. Haplogroup J2 is carried by 6% of Europeans and its frequency drops dramatically as one moves northward away from the Mediterranean.

J*(xJ1,J2)

There are also some haplogroup J Y-chromosomes that belong to neither J1 nor J2, and are said to be in paragroup J*(xJ1,J2). This means that haplogroup J* includes all of J except for J1 and J2. However, Y-chromosomes that belong to paragroup J* are extremely rare among human populations of the present day.

Mutation

The technical details of M304 are:

Nucleotide change: A to C
Position (base pair): 421
Total size (base pairs): 527
Forward 5′→ 3′: caaagtgctgggattacagg
Reverse 5′→ 3′: cttctagcttcatctgcattgt

Haplotypes

DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 12 23 14 10 14 17 11 16 11 13 11 30 17 8 9 11 11 26 14 20 28 13 14 15 16
See also: Y-chromosomal Aaron

Famous

Main article: Famous haplogroup members

Matt Lauer belonged to Y-DNA haplogroup J.[5]

See also

References

  1. ^ a b c O. Semino et al. (2004), Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area, American Journal of Human Genetics 74(5):1023-34.
  2. ^ F. Di Giacomo et al. (2003), Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects, Molecular Phylogenetics and Evolution 28(3):387-95.
  3. ^ C. Cinnioglu et al. (2004), Excavating Y-chromosome haplotype strata in Anatolia, Human Genetics 114(2):127-48.
  4. ^ I. Nasidze et al. (2003), Testing hypotheses of language replacement in the Caucasus: evidence from the Y-chromosome, Human Genetics 112(3):255-61.
  5. ^ [1], ISOGG
Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_J_(Y-DNA)&oldid=248915379"