Jump to content

Haplogroup J (Y-DNA)

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by 71.193.247.134 (talk) at 01:09, 13 July 2011 (→‎Haplotypes). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup J
Possible time of origin50,000-30,000 years BP
Possible place of originSouthwest Asia, Arabian Peninsula
AncestorIJ
DescendantsJ1, J2
Defining mutations12f2.1, L134, M304, P209, S6/L60, S34, S35

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup.

Origins

Haplogroup J is believed to have arisen roughly 30,000 years ago in Southwest Asia (Arabia Felix) (31,700±12,800 years ago according to Semino et al.. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J have mutations in common deriving from Haplogroup IJ (S2, S22). Haplogroup IJ and haplogroup K derive from Haplogroup IJK (L15/S137, L16/S138), and only at this level of classification does haplogroup IJK join with Haplogroup G and Haplogroup H as immediate descendants of Haplogroup F. J is defined by the 12f2.1 genetic marker, or the equivalent M304 marker. The main current subgroups J1 and J2, which now comprise between them almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.

Distribution

Haplogroup J is found in greatest concentration in Southwestern Arabian Peninsula. Outside of this region, haplogroup J has a presence in North Africa. It also has a moderate presence in Southern Europe (especially in central and southern Italy, Malta, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2 (J-M172). Haplogroup J is also found in the North East Africa, particularly in the form of its subclade J1 (J-M267). Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy. In Northern India, 28.7% of the Shia Muslim population belongs to haplogroup J.[1]

Haplogroup J* includes all of J except for J1 and J2. J* is rarely found outside of the island of Socotra, where it is quite frequent at 71.4%[2]. Haplogroup J* also has been found with lower frequency in Oman,[3] Ashkenazi Jews,[4] Pakistan,[5] Saudi Arabia,[6] Greece,[3] the Czech Republic,[3][7] and several Turkic peoples.[8][9][10]

The following gives a summary of most of the studies which specifically tested for J1 and J2, showing its distribution in Europe, North Africa, the Middle East and Central Asia.

Country/Region Sampling N J1 J2 Total J Study
Algeria Oran 102 22.5 4.9 27.4 Robino et al. (2008)
Caucasus Chechen 330 20.9 56.7 77.6 Balanovsky et al.(2011)
Caucasus Ingush 143 2.8 88.8 91.6 Balanovsky et al.(2011)
Cyprus 164 9.6 12.9 22.5 El-Sibai et al. (2009)[11]
Egypt 124 19.8 7.6 27.4 El-Sibai et al. (2009)
Greece Crete/Heraklion 104 1.9 44.2 46.1 Martinez et al. (2007)
Greece Crete 143 3.5 35 38.5 El-Sibai et al. (2009)
Greece 154 1.9 18.1 20 El-Sibai et al. (2009)
Iran 92 3.2 25 28.2 El-Sibai et al. (2009)
Iraq 117 33.1 25.1 58.2 El-Sibai et al. (2009)
Palestine Akka 101 39.2 18.6 57.8 El-Sibai et al. (2009)
Italy 699 2 20 22 Capelli et al. (2007)
Italy Central Marche 59 5.1 35.6 40.7 Capelli et al. (2007)
Italy West Calabria 57 3.5 35.1 38.6 Capelli et al. (2007)
Italy Sicily 212 5.2 22.6 27.8 El-Sibai et al. (2009)
Italy Sardinia 81 4.9 9.9 14.8 El-Sibai et al. (2009)
Jordan 273 35.5 14.6 50.1 El-Sibai et al. (2009)
Kuwait 42 33.3 9.5 42.8 El-Sibai et al. (2009)
Lebanon 951 18.9 29.4 48.3 El-Sibai et al. (2009)
Malta 90 7.8 21.1 28.9 El-Sibai et al. (2009)
Morocco 316 1 0.2 1.2 El-Sibai et al. (2009)
Morocco Residents in Italy 51 19.6 0 19.6 Onofri et al. (2008)
Portugal Portugal 303 4.3 6.9 11.2 El-Sibai et al. (2009)
Qatar Qatar 72 58.3 8.3 66.6 El-Sibai et al. (2009)
Spain Cadiz 28 3.6 14.3 17.9 El-Sibai et al. (2009)
Spain Cantabria 70 2.9 2.9 5.8 El-Sibai et al. (2009)
Spain Castille 21 0 9.5 9.5 El-Sibai et al. (2009)
Spain Cordoba 27 0 14.7 14.7 El-Sibai et al. (2009)
Spain Galicia 19 5.3 0 5.3 El-Sibai et al. (2009)
Spain Huelva 22 0 13.7 13.7 El-Sibai et al. (2009)
Spain Ibiza 54 0 3.7 3.7 El-Sibai et al. (2009)
Spain Leon 60 1.7 5 6.7 El-Sibai et al. (2009)
Spain Malaga 26 0 15.4 15.4 El-Sibai et al. (2009)
Spain Mallorca 62 1.6 8 9.7 El-Sibai et al. (2009)
Spain Sevilla 155 3.2 7.8 11 El-Sibai et al. (2009)
Spain Valencia 31 2.7 5.5 8.2 El-Sibai et al. (2009)
Syria 554 33.6 20.8 54.4 El-Sibai et al. (2009)
Tunisia 62 0 8 8 El-Sibai et al. (2009)
Tunisia 52 34.6 3.8 38.4 Onofri et al. (2008)
Tunisia Tunis 148 32.4 3.4 35.8 Arredi et al. (2004)
Turkey 523 9.1 24.2 33.3 El-Sibai et al. (2009)
UAE 164 34.7 10.3 45 El-Sibai et al. (2009)
Yemen 62 72.5 9.6 82.1 El-Sibai et al. (2009)

Subclades

J1

Main article: Haplogroup J1 (Y-DNA)

ISOGG states that J1 originated in the Middle East. It is found in parts of the Near East, and North Africa, with a sparse distribution in the southern Mediterranean flank of Europe, and in Ethiopia. But not all studies agree on the point of origin. The Levant has been proposed but a 2010 study concluded that the haplogroup had a more Northern origin. The origin of J1c3 is likely in the more northerly populations and then spreads southward into the Arabian Peninsula. The high YSTR variance of J1c3 in Turks and Syrians supports the inference of an origin of J1c3 in nearby eastern Anatolia. Moreover, the network analysis of J1c3 haplotypes shows that some of the populations with low diversity, such as Bedouins from Israel, Qatar, Sudan and UAE, are tightly clustered near high-frequency haplotypes suggesting founder effects with star burst expansion in the Arabian Desert. " [12] Haplogroup J1, defined by the 267 marker is most frequent in the Arabian Peninsula Yemen(76%)[13], Saudi (64%) [14], Qatar (58%)[15], and Dagestan (56%)[8]. J1 is generally frequent amongst Arab Bedouins (62%[16]. It is also very common among others such as those of the southern Levant, i.e. Palestinians(38.4%), Ashkenazi Jews (20%) [17], North Sudan (45%, Khartoum 74%)[18] , Algeria (35%)[17], Iraq (33%)[17], Tunisia (31%)[19], Syria (30%), Egypt (20%)[20], and the Sinai Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic speaking countries with mainly non-Arabic speaking countries, such as Turkey (9%), Iran (11%) [1][9]. It is also highly frequent among Jews, especially the Kohanim line (46%) [1] [21] .

J2

Main article: Haplogroup J2 (Y-DNA)

Haplogroup J2 is found in the highest concentrations in the Caucasus and the Fertile Crescent and is found throughout the Mediterranean (including the Italian, Anatolian and Iberian peninsulas and North Africa)[22].

The highest ever reported concentration of J2 was 72% in Northeastern Georgia.[23]. Other high reports include Ingush 32% [23], Cypriots 30-37% (Capelli 2005), Lebanese 30% (Wells et al. 2001), Iraqis 29.7% (Sanchez et al. 2005), Syrians 22.5%[citation needed], Kurds 24%-28%, Iranians 23%[24], Ashkenazi Jews 24%, Palestinian Arabs 16.8%-25%, Sephardic Jews 29%[2] and North Indian Shia Muslims 18% [1], Chechens 26%, Balkars 24%, Yaghnobis 32%, Armenians 21-24%, and Azerbaijanis 24%-48%.

Consistent with its Middle Eastern extent, J2 also includes the Cohen Modal Haplotype.

Tree

Below are the subclades of Haplogroup J with their defining mutation, according to the ISOGG tree (as of March 2010). Note that the descent-based identifiers may be subject to change, as new SNPs are discovered that augment and further refine the tree.

J 12f2.1, M304, P209, S6, S34, S35

  • J* -
  • J1 M267
    • J1* -
    • J1a M62
    • J1b M365
    • J1c L136
      • J1c1 M390
      • J1c2 P56
      • J1c3 P58
        • J1c3* -
        • J1c3a M367, M368
        • J1c3b M369
        • J1c3c L92, L93
        • J1c3d L147
          • J1c3d* -
          • J1c3d1 L222
            • J1c3d1* -
              • J1c3d1a L65.2/S159.2
  • J2 M172
  • J2* -
    • J2a M410
      • J2a* -
      • J2a1 (not currently in use by ISOGG)
      • J2a2 M340
      • J2a3 P279
      • J2a4 DYS413≤18, L26/S57, L27
        • J2a4* -
        • J2a4a M47, M322
        • J2a4b M67/S51
          • J2a4b* -
          • J2a4b1 M92, M260
            • J2a4b1* -
            • J2a4b1a M327
          • J2a4b2 M163, M166
        • J2a4c M68
        • J2a4d M319
        • J2a4e M339
        • J2a4f M419
        • J2a4g P81
        • J2a4h L24
          • J2a4h* -
          • J2a4h1 L25
            • J2a4h1* -
            • J2a4h1a DYS445≤7
              • J2a4h1a* -
              • J2a4h1a1 L70
                • J2a4h1a1 -
                • J2a4h1a1a M137
                • J2a4h1a1b M289 (location under DYS445≤7 uncertain)
                • J2a4h1a1c M318
          • J2a4h2 M158 (location under L24 uncertain)
    • J2b M12, M102, M221, M314
      • J2b* -
      • J2b1 M205
      • J2b2 M241
        • J2b2* -
        • J2b2a M99
        • J2b2b M280
        • J2b2c M321
        • J2b2d P84
        • J2b2e DYS455≤9

Mutation

The technical details of M304 are:

Nucleotide change: A to C
Position (base pair): 421
Total size (base pairs): 527
Forward 5′→ 3′: caaagtgctgggattacagg
Reverse 5′→ 3′: cttctagcttcatctgcattgt

Haplotypes

===Modal===


DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 12 23 14 10 14 17 11 16 11 13 11 30 17 8 9 11 11 26 14 20 28 13 14 15 16

Ysearch TKCSC

User IDLast NameOrigin3
9
3
3
9
2
4
5
9
a
4
5
5
4
5
4
Y
C
A
I
I
b
4
3
8
5
3
1
3
9
5
S
1
a
3
9
5
S
1
b
5
9
0
6
4
1
4
7
2
5
1
1
5
9
4
4
5
0
TKCSCTestUnknown 121181111221011151681089108



Famous

Main article: Famous haplogroup members

Matt Lauer belongs to Y-DNA haplogroup J.[25]

See also

References

  1. ^ a b c http://dienekes.blogspot.com/2009/10/middle-eastern-and-sub-saharan-lineages.html
  2. ^ Viktor Cerny et al. (2008),J*-12f2(xJ1-M267, J2-M172)(45/63)
  3. ^ a b c Di Giacomo F, Luca F, Popa LO; et al. (2004). "Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe" (PDF). Hum. Genet. 115 (5): 357–71. doi:10.1007/s00439-004-1168-9. PMID 15322918. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  4. ^ Shen P, Lavi T, Kivisild T; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-chromosome and mitochondrial DNA sequence variation". Hum. Mutat. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link) Haplogroup J-M304(xJ1-M267, J2-M172) in 1/20 Ashkenazi Jews.
  5. ^ Firasat et al. (2007), J*-12f2(xJ1-M267, J2-M172): 1.0% (1/97) "Burusho," 3.0% (19/638) "Pakistan"
  6. ^ Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 2009 (10): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609. {{cite journal}}: Cite has empty unknown parameter: |author-name-separator= (help); Unknown parameter |author-separator= ignored (help)CS1 maint: unflagged free DOI (link)
  7. ^ Luca F, Di Giacomo F, Benincasa T; et al. (2007). "Y-chromosomal variation in the Czech Republic". Am. J. Phys. Anthropol. 132 (1): 132–9. doi:10.1002/ajpa.20500. PMID 17078035. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  8. ^ a b Yunusbaev et al. 2006:Dargins (91%), Avars (67%), Chamalins (67%), Lezgins (58%), Tabassarans (49%), Andis (37%), Bagvalins (21.4%))stats combined Dagestan ethnic groups see Dagestan article
  9. ^ a b Cinnioğlu C, King R, Kivisild T; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia" (PDF). Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  10. ^ Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
  11. ^ El-Sibai et al. (2009) reported results from several studies : Di Giacomo et al. 2003, Al-Zahery et al. 2003, Flores et al.2004, Cinnioglu et al. 2004, Capelli et al. 2005, Goncalves et al. 2005, Zalloua et al. 2008, Cadenas et al. 2008
  12. ^ Chiaroni; King, RJ; Myres, NM; Henn, BM; Ducourneau, A; Mitchell, MJ; Boetsch, G; Sheikha, I; Lin, AA; et al. (2010). "The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations". European Journal of Human Genetics. 18 (3): 348–53. doi:10.1038/ejhg.2009.166. PMC 2987219. PMID 19826455. {{cite journal}}: Explicit use of et al. in: |author= (help)
  13. ^ *Alshamali et al. 2009 81% (84/104) *Malouf et al. 2008: 70% (28/40) *Cadenas et al. 2008: 45/62 = 72.6% J1-M267
  14. ^ Alshamali F, Pereira L, Budowle B, Poloni ES, Currat M (2009). "Local population structure in Arabian Peninsula revealed by Y-STR diversity". Hum. Hered. 68 (1): 45–54. doi:10.1159/000210448. PMID 19339785.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  15. ^ Cadenas et al. 2008 42/72 = 58.3% J1-M267
  16. ^ 21/32 Nebel et al. 2001
  17. ^ a b c Semino O, Magri C, Benuzzi G; et al. (2004). "Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area". Am. J. Hum. Genet. 74 (5): 1023–34. doi:10.1086/386295. PMC 1181965. PMID 15069642. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  18. ^ http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2987219/
  19. ^ combined (Semino et al. 2004 30%) & (Arredi et al. 2004 32%)
  20. ^ Luis JR, Rowold DJ, Regueiro M; et al. (2004). "The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations". Am. J. Hum. Genet. 74 (3): 532–44. doi:10.1086/382286. PMC 1182266. PMID 14973781. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  21. ^ Hammer, Michael F (2009-08-08). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Hum Genet. epub ahead of publication. Springer. {{cite journal}}: Unknown parameter |coauthors= ignored (|author= suggested) (help)
  22. ^ Di Giacomo F, Luca F, Anagnou N; et al. (2003). "Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects" (PDF). Mol. Phylogenet. Evol. 28 (3): 387–95. doi:10.1016/S1055-7903(03)00016-2. PMID 12927125. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  23. ^ a b I. Nasidze, E. Y. S. Ling, D. Quinque et al., "Mitochondrial DNA and Y-Chromosome Variation in the Caucasus," Annals of Human Genetics (2004) 68,205–221. http://www.eva.mpg.de/genetics/pdf/Caucasus_big_paper.pdf
  24. ^ Y haplogroup J in Iran by Alfred A. Aburto Jr.
  25. ^ Famous Haplogroups, ISOGG

External links

Phylogenetic tree and Distribution Maps of Y-DNA haplogroup J

Other

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_J_(Y-DNA)&oldid=439185882"