Jump to content

Haplogroup I-M253

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by AnomieBOT (talk | contribs) at 23:22, 4 May 2016 (Rescuing orphaned refs ("biorxiv.org" from rev 690008918)). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup I-M253
Possible time of origin11-21,000[1] or 28-33,000 years ago[2]
Possible place of originEurope
AncestorI-M170
Defining mutationsM253, M307, P30, P40

In human genetics, Haplogroup I-M253 is a Y chromosome haplogroup which occurs at greatest frequency in Fenno-Scandia. The mutations identified with Haplogroup I-M253 (Y-DNA) are M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs). It is a subclade of Haplogroup I. Before a reclassification in 2008,[3] the group was known as Haplogroup I1a.

The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland and more than 50 percent in the province of Satakunta,[4] and around 38 percent in Sweden as a whole, with a peak of 52 percent in Västra Götaland County in central Sweden.[5]

Origins

Haplogroup I-M253 arose from haplogroup I-M170, which appears ancient in Europe. The haplogroup was previously[year needed] thought to have originated 15,000 years ago in Iberia, but as of 2010 it was estimated to have originated between 4,000 - 5,000 years ago, in Chalcolithic Europe.[6] A new study in 2015 estimated the origin as between 3,470 to 5,070 years ago or between 3,180 to 3,760 years ago, using two different techniques.[7] It is suggested that it initially dispersed from the area that is now Denmark.[8] A 2014 study in Hungary uncovered remains of nine individuals from the Linear Pottery culture, one of whom was found to have carried the M253 SNP which defines Haplogroup I1. This culture is thought to have been present between 6,500 to 7,500 years ago.[9]

Subclades

Note: The systematic subclade names have changed several times in recent years,[year needed] and are likely to change again, as new markers which clarify the sequence of branchings of the tree are discovered.[10]

  • I-M253 (M253,[11] M307.2/P203.2,[12] L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187, L840, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111.[10]
    • I-DF29 (DF29/S438)
      • I-CTS6364 (CTS6364/Z2336)
        • I-L22 (L22/S142)
          • I-P109 (P109)
          • I-L205 (L205)
          • I-L300 (L300/S241)
          • I-Z74 (Z74)
            • I-L287 (L287)
              • I-L258 (L258/S335)
            • I-L813 (L813)
        • I-M227 (M227)
      • I-PF49 (PF49)
      • I-Z58 (S244/Z58)
        • I-Z59 (S246/Z59)
          • I-Z60(S337/Z60, S439/Z61, Z62)
            • I-Z140 (Z140, Z141)
              • I-L338 (L338)
              • I-F2642 (F2642)
            • I-Z73 (Z73)
              • I-L1302 (L1302)
            • I-L573 (L573)
            • I-L803 (L803)
          • I-Z382 (Z382)
        • I-Z138 (S296/Z138, Z139)
          • I-Z2541 (Z2541)
      • I-Z63 (S243/Z63)
        • I-BY151 (BY151)
          • I-BY351 (BY351)
              • I-CTS10345 (CTS10345)
                • I-Y10994 (Y10994)
              • I-Y7075 (Y7075)
          • I-S2078 (S2078)
            • I-S2077 (S2077)
              • I-Y2245 (Y2245/PR683)
                • I-L1237 (L1237)
                  • I-FGC9550 (FGC9550)
                • I-S10360 (S10360)
                  • I-S15301 (S15301)
                • I-Y7234 (Y7234)
          • I-Y8331 (Y8331/BY62)
        • I-Y13952 (Y13952)
    • I-Z131 (Z131)

Distribution by population

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking period or modern times. It is found in all places invaded by the ancient Germanic peoples and the Vikings. In the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as United States, Australia and Canada.

Population Sample size I I-M253 (M253) I-M227 (M227) Source
Austria 43 9.3 2.3 0 Underhill et al. 2007
Belarusians: Vitbsk 100 15 1 0 Underhill et al. 2007
Belarusians: Brest 97 20.6 1 0 Underhill et al. 2007
Bosnia 100 42 2 0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0 Karachanak et al. 2013
Czech Republic 47 31.9 8.5 0 Underhill et al. 2007
Czech 53 17.0 1.9 0 Rootsi et al. 2004
Denmark 122 39.3 32.8 0 Underhill et al. 2007
England 104 19.2 15.4 0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 - 11.9 - Lappalainen et al. 2008
Finland (west) 230 - 40 - Lappalainen et al. 2008
Finland (east) 306 - 19 - Lappalainen et al. 2008
France 58 17.2 8.6 1.7 Underhill et al. 2007
France 12 16.7 16.7 0 Cann et al. 2002
France (Low Normandy) 42 21.4 11.9 0 Rootsi et al. 2004
Germany 125 24 15.2 0 Underhill et al. 2007
Greece 171 15.8 2.3 0 Underhill et al. 2007
Hungary 113 25.7 13.3 0 Rootsi et al. 2004
Ireland 100 11 6 0 Underhill et al. 2007
Latvia 113 - 3.5 - Lappalainen et al. 2008
Lithuania 164 - 4.9 - Lappalainen et al. 2008
Netherlands 93 20.4 14 0 Underhill et al. 2007
Russians 16 25 12.5 0 Cann et al. 2002
Russia: Pskov 130 16.9 5.4 0 Underhill et al. 2007
Russia: Kostroma 53 26.4 11.3 0 Underhill et al. 2007
Russia: Smolensk 103 12.6 1.9 0 Underhill et al. 2007
Russia: Voronez 96 19.8 3.1 0 Underhill et al. 2007
Russia: Arkhangelsk 145 15.8 7.6 0 Underhill et al. 2007
Russia: Cossac 89 24.7 4.5 0 Underhill et al. 2007
Russia: Karelians 140 10 8.6 0 Underhill et al. 2007
Russia: Karelians 132 - 15.2 - Lappalainen et al. 2008
Russia: Vepsa 39 5.1 2.6 0 Underhill et al. 2007
Slovakia 70 14.3 4.3 0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0 Underhill et al. 2007
Sweden 160 - 35.6 - Lappalainen et al. 2008
Swiss 144 7.6 5.6 0 Rootsi et al. 2004
Turkey 523 5.4 1.1 0 Underhill et al. 2007
Ukrainians: Lvov 101 23.8 4.9 0 Underhill et al. 2007
Ukrainians: Ivanovo-Frankov 56 21.4 1.8 0 Underhill et al. 2007
Ukrainians: Hmelnitz 176 26.2 6.1 0 Underhill et al. 2007
Ukrainians: Cherkasso 114 28.1 4.3 0 Underhill et al. 2007
Ukrainians: Belgorod 56 26.8 5.3 0 Underhill et al. 2007

Publicly accessible databases

There are several public access databases where I-M253 populations can be found:

  1. http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
  2. http://www.semargl.me/
  3. http://www.ysearch.org/
  4. http://www.yhrd.org/
  5. http://www.yfull.com/tree/I1/

Britain

See also: Prehistoric settlement of the British Isles
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[13] The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[14] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Famous figures

See also: List of haplogroups of historical and famous figures

Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[15]

Mutations

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[16]

Type: SNP
Source: M (Peter Underhill, Ph.D. of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
ISOGG HG: I1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Nucleotide alleles change (mutation): C to T

Name: M307[17]

Type: SNP
Source: M (Peter Underhill, Ph.D. of Stanford University)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: TTATTGGCATTTCAGGAAGTG
Primer R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Nucleotide alleles change (mutation): G to A

Name: P30[18]

Type: SNP
Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGTGGGCTGTTTGAAAAAGA
Primer R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40[19]

Type: SNP
Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGAGAAAAGGTGAGAAACC
Primer R: GGACAAGGGGCAGATT
YCC HG: I1
Nucleotide alleles change (mutation): C to T
Region: ARSDP

References

  1. ^ Rootsi, Siiri; et al. (2004). "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe" (PDF). American Journal of Human Genetics. 75: 128–137. doi:10.1086/422196. PMC 1181996. PMID 15162323.
  2. ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. pp. 33-42.
  3. ^ Karafet, Tatiana M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  4. ^ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). "Migration Waves to the Baltic Sea Region". Annals of Human Genetics. 72 (3): 337–348. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359.
  5. ^ Lappalainen, T.; Hannelius, U.; Salmela, E.; von Döbeln, U.; Lindgren, C. M.; Huoponen, K.; Savontaus, M.-L.; Kere, J.; Lahermo, P. (2009). "Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656.
  6. ^ Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  7. ^ "TMRCAs of major haplogroups in Europe estimated using two methods. : Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group". www.nature.com. Retrieved 2015-05-19.
  8. ^ Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  9. ^ "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". biorxiv.org.
  10. ^ a b Copyright 2015 ISOGG. "ISOGG 2015 Y-DNA Haplogroup I". isogg.org.{{cite web}}: CS1 maint: numeric names: authors list (link)
  11. ^ Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; Lin, Alice A.; Prince, Kristina; Oefner, Peter J.; Shen, Peidong; Semino, Ornella; Cavalli-Sforza, L. Luca; Underhill, Peter A.; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. PMID 14586639. {{cite journal}}: Explicit use of et al. in: |first9= (help); Unknown parameter |displayauthors= ignored (|display-authors= suggested) (help)
  12. ^ P, Shen et al., Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation, Human Mutations, vol. 24, no. 3 (Sep 2004), pp.248-60.
  13. ^ Weale, Michael E.; Weiss, Deborah A.; Jager, Rolf F.; Bradman, Neil; Thomas, Mark G. (2002). "Y chromosome Evidence for Anglo-Saxon Mass Migration". Molecular Biology and Evolution. 19 (7): 1008–1021. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
  14. ^ Capelli, Cristian; Redhead, Nicola; Abernethy, Julia K.; Gratrix, Fiona; Wilson, James F.; Moen, Torolf; Hervig, Tor; Richards, Martin; Stumpf, Michael P.H.; Underhill, Peter A.; Bradshaw, Paul; Shaha, Alom; Thomas, Mark G.; Bradman, Neal; Goldstein, David B.; et al. (2003). "A Y Chromosome Census of the British Isles" (PDF). Current Biology. 13 (11): 979–984. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. {{cite journal}}: Explicit use of et al. in: |first9= (help); Unknown parameter |displayauthors= ignored (|display-authors= suggested) (help)
  15. ^ "Founding Father DNA". isogg.org.
  16. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
  17. ^ snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
  18. ^ P30
  19. ^ P40

See also

Haplogroup I
I1

I1a

I1b

I1c

I1d

I1e

I2

I2a

I2b

I2*

Projects

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_I-M253&oldid=718677353"