Jump to content

Haplogroup R1b

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by 67.128.30.103 (talk) at 01:54, 21 May 2009 (Yes this is still a common belief). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup R1b
Possible time of originless than 18,500 years BP[1]
Possible place of originEurasia
AncestorR1
Defining mutationsM343
Highest frequenciesPeople of Atlantic Europe (Welsh 89%, Basque 88%, Irish 81%, Northern Portuguese 81%, Catalan 79%, Scottish 77%, English 75%, other Spanish 70%, Dutch 70%, Belgians 63%, Southern Portuguese 60%, Bashkirs 47%, Italian 40%, German 39%, etc.)
Haplogroup R1b Distribution

In human genetics, Haplogroup R1b is the most frequently occurring Y-chromosome haplogroup in Western Europe.

More specifically, its frequency is highest in Atlantic Europe and, due to European emigration, in North America, South America, and Australia. In southern England, the frequency of R1b is about 70%, and in parts of north and western England, northern Spain, Portugal, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%. R1b is the most frequent haplogroup in Germany and it is also found among Italians, particularly in northern Italy.

R1b is also present at lower frequencies throughout Eastern Europe, Anatolia and parts of North Africa and appears in an isolated pocket of Sub-Saharan Africa.

Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004.[2] From 2002 to 2005, R1b was defined by the presence of SNP P25. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[3]

Origins

In 2008 T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP.[4]

R1b* (that is R1b with no subsequent mutations) is extremely rare. Examples have been found in Europe and Western Asia, for example two in a sample from Turkey.[5] However it is possible that some or all examples represent a reversion of marker P25 from R1b1*.[6] Most examples of R1b fall into its much more recent subclades.

It is widely believed that R1b originated in western Europe where it reaches its highest frequencies. However research now shows that R1b's variance increases as one moves east, leading to the view that R1b originated further east.[7] Some geneticists now believe that R1b arose in Central Asia[8] or Southwest Asia.[9]

Subclades

R1b is a descendant of Haplogroup R1. Systematic descent-based names of the subclades have been changing rapidly with the discovery of new SNPs clarifying and augmenting the descent tree. The identifiers below are those from the November 2008 revision of the ISOGG tree. In light of recent discoveries, the chart needs to be updated, since R-L44 (R1b1b2a1a4) should be R-L48, which in turn includes R-L47 (with its R-L44, R-L45, R-L46 branches).

Template:Y-DNA R1b

R1b1

R1b1 is defined by the presence of SNP marker P25.

R1b1* is found in Northern Cameroon in west central Africa at a very high frequency, where it is considered to represent an early back-migration from Asia.[10] R1* (which seems likely also to be R1b1, though not tested for M343 and P25) was also reported in the Bantu of southern Cameroon, and in Oman, Egypt, and the Hutu of Rwanda. Again the authors of the study felt that their data suggested an ancient back migration from Asia to Africa.[11] Another example of R1b1* was discovered in Guinea-Bissau.[12] Further examples have been found among speakers of a variety of different languages in Sudan.[13]

R1b1a

R1b1a is defined by the presence of SNP marker M18. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[14] It has been found only at low frequencies in samples from Sardinia[15] and Lebanon.[16]

R1b1b

R1b1b is defined by the presence of SNP marker P297. In 2008 this polymorphism was recognised to combine M73 and M269 into one R1b1b cluster.[17]

R1b1b1

R1b1b1 is defined by the presence of SNP marker M73. It has been found in SE Europe and SW Asia[18] and at generally low frequencies throughout central Eurasia.

R1b1b2

R-M269
Long-hand: R1b1b2 (formerly R1b1c [citation needed], R1b3)
Defining SNP: M269
Parent Clade: R-P297
Subclades: R-P311

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1b2 subclade.

This subgroup, previously believed to have existed before the last Ice Age [19], is now seen as much younger. A revised estimate for R1b1b2 arising is around 5,000 to 8,000 years ago.[20]

In earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then From 2003 to 2005 what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c. [citation needed]

R1b1b2 frequency reaches 10% in Algerian Arabs.[21]. R1b1b2-M269 has been found at a frequency of 15.2% in a sample of 33 individuals from northern Iran, and 6.0% in a sample of 117 people from southern Iran.[22]

R1b1b2a1a1

R-U106
Long-hand: R1b1b2a1a/R1b1b2g/R1b1c9
Defining SNP: U106/S21/M405
Parent Clade: P310/S129
Subclades: U198/S29/M405, S26/L1/DYS439(null), L48/S162 (comprising L44, L45, L46, L47), L5, L6, P89.2, P107

This subclade is defined by the presence of the marker U106, also known as S21 and M405. It appears to represent over 25% of R1b.

In Europe, the subclade (including its own subclades) has a distribution running north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in Spain, Italy (3.5%), the Balkan and Turkey.[23]

The age of U106 is around 3,100-3,900 years old.

The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al. (2007) [6].

Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.

Downstream of U106 are U198/S29/M467, P107, P89.2, L1/S26/DYS439(null), L5, L6, L48/S162 (with L47 and its L44, L45, L46 subgroups).

R1b1b2a1a1a

This subclade is defined by the presence of the marker U198, also known as S29 and M467. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[23] The age of U198 is around 2-3,000 years.

R1b1b2a1a1c

This subclade is defined by the presence of the marker L1/S26/DYS439(null). It occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry, is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or null439.[24].

R1b1b2a1a1d

This subclade is defined by the presence of the marker L48/S162 and is also known as R1b1b2a1a4 (by Family Tree DNA - FTDNA). It is the largest subclade of R1b1b2a1a1. As of May 15, 2009, based on FTDNA tests of samples from 256 people, L48 was detected in 146, or 57.0% of those tested. From among those with L48+ results, 90% have DYS390 of 23 or less, while 10% a value of 24 or more. Among those tested L48-, 16% have DYS390 of 23 or less, while 84% a value of 24 or more. Therefore, there seems to be a correlation between values of 23 or lower for DYS390 and L48+, among those tested U106+.[25] The age of L48 is around 2,900-3,100 years old.

R1b1b2a1a1d has a subclade R1b1b2a1a1d1 (defined by the marker L47), which in turn, seems to be including subclades R1b1b2a1a1d1* (defined by the marker L47 and not by markers L44, L45, L46) and R1b1b2a1a1d1a defined by the marker L44. As of May 15, 2009, based on FTDNA tests of samples from 49 people in the R1b-U106 project who are L48+, 11 (or 22.4%) were found L47+, so far showing a possible "Anglo-Saxon" (or Anglo-Norman, Scottish-Norman, "Ashkenazim-Norman"[26]) cluster, strictly based on the surnames and ancestral origins (England, Scotland, Wales and Belarus Ashkenazim) of those tested positive. As well, due to the genetic distances among the members so far L47+, the age of this cluster is probably quite old, perhaps 2,700-2,900 years. It is possible that L47 emerged not too long after the L48 "parent" cluster. Preliminary data would strongly suggest that the L48 SNP occurred only a short period of time after the U106 SNP occurred, likely 200 years or less. With limited data for L46+ haplotypes at this point, it would appear that the L47 SNP occurred only a short period of time after the L48 SNP occurred, likely 200 years or less. However, more results and proper statistical analysis will be required. So far, these are only observations based on a few initial results. For the R1b1b2a1a1d1a defined by marker L44, as of May 15, 2009, based on FTDNA tests of samples from the R1b-U106 project, there were 37 test results for L44, with 6 positive (16.2%) and 31 negative. Downstream of L44, L46 has 37 test results, with 6 positive (16.2%) and 31 negative. As well, it is possible that L45 could be downstream of L44 and upstream of 46, but FTDNA has not started testing L45 yet. The age of L46 could be around 1,500 years before present (YBP).

R1b1b2a1a2

R-P312
Long-hand: R1b1b2a1a2
Defining SNP: P312 (also called S116, rs34276300)
Parent Clade: R-P310
Subclades: R-M153, R-M167, R-U152, R-L21

The P312 SNP appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of this SNP relative to the above list.

R1b1b2a1a2b

This subclade is defined by the presence of the marker R-M153. It has been found mostly in Basques and Gascons, among whom it represents a sizeable fraction of the Y-DNA pool[27][28][29], though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001[30]) it was described as H102 and included 7 Basques and one Andalusian.

R1b1b2a1a2c

This subclade is defined by the presence of the marker R-M167/SRY2627. The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[31]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000 Rosser[32] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001 Bosch described this marker as H103, in 5 Basques and 5 Catalans.[33] Further regional studies have located it in significant amounts in Asturias, Cantabria and Galicia, as well as again among Basques.[34] Cases in the Azores and Latin America have also been reported. In 2008 two research papers by López-Parra[29] and Adams,[28] respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men.

R1b1b2a1a2d

This subclade is defined by the presence of the marker R-U152 also called S28. Its discovery was announced in 2005 by EthnoAncestry and subsequently identified independently by Sims et al. (2007).[35] Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. It is found from Greece westward to the Bay of Biscay in France, but the percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152.

R1b1b2a1a2e

This subclade is defined by the presence of the marker S68 which was reported by in 2007. It has been seen in an individual from Scotland and another from Sweden. This subclade is unlikely to be found in much more than 2% of the R1b population[36]

R1b1b2a1a2f

This subclade is defined by the presence of the marker L21. Early results suggest that it is common in the British Isles, appears in France, Germany and Scandinavia, but is rare in Iberian or Italian ancestry.

R1b1b2a1a2f2

This subclade is defined by the presence of the marker M222. It is particularly associated with the Irish and Scots. In this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as it is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.[37]

R1b1c

R1b1c is defined by the presence of SNP marker M335. This haplogroup was created by the 2008 reorganisation of nomenclature and should not be confused with R1b1b2, which was previously R1b1c. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[38]

The M335 marker was first published in 2004, when one example was discovered in Turkey, which was classified at that time as R1b4.[39].

Distribution

R1b reaches its highest frequency in Atlantic Europe. Results from studies with small sample sizes should be treated with caution until more thorough testing is completed.

Europe

In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Portugal, Spain, France, Wales, Scotland, and Ireland the frequency of R1b is greater than 90%.

It is found in Basques: 88.1%,[40] Catalans: 79.2%,[40], other Spanish: 70%,[41], Belgians: 63.0%,[42] Portuguese 60%,[43], Italians (continental Italy): 40%,[44] Germans: 39%,[45] Norwegians: 25.9%,[46] Sicilians: 24.5%,[47] Maltese: 21.9%,[48] Swedes: 20%,[46] Sardinians: 19%.[49]

In North-eastern Europe, it is found in Czechs & Slovaks: 35.6%,[40] Poles: 11.6%[50]-16.4%,[40] Latvians: 15%,[51] Hungarians: 13.3%,[51] Estonians: 9%,[51] Lithuanians: 5%,[51] Belarusians: 4.2%,[52] Russians: 2.8%[53]-21.3%,[54] Ukrainians: 2.0%[40]-18.9%,[55] Sami: 3.9%.[54]

In the Balkans, it is found in Greeks: 13.5%[56]-22.8%,[40] Albanians: 17.6%,[40] Romanians: 13%,[55] Slovenes: 21%,[51] Bulgarians: 17.0%,[42] Croats (mainland): 15.7%,[57] Serbs: 10.6%,[57] Herzegovinians: 3.6%,9.0% in Cypriots[42], [57] Bosnians: 1.4%.[57]

Caucasus

In the Caucasus it is found in 32.4% of Armenians.[58]

North Africa

Asia

  • Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b2 in Bashkirs, although the genetic diversity is low, suggesting a founder effect.[74]
  • In South Asia, the frequency of R1b is about 7.4% in Pakistan (including 4.5% R1b1b1-M73 and 2.8% R1b1b2-M269), while it is almost not found in India (0.55% R1b1b2-M269)[79]. Haplogroup R1b1b2-M269 has been found in approximately 11% of a sample of Newars in Nepal.[80]

Haplotypes

Atlantic Modal Haplotype

Main article: Atlantic Modal Haplotype

An average haplotype for R1b1b2, sometimes called the Atlantic Modal Haplotype, or haplotype 15, reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 33% in Portugal while the highest value is to be found among Spanish Basques.

Haplotype 35

Main article: Haplotype 35

There also exists a haplotype of R1b characterized by DYS393=12 which is known in the literature as Haplotype 35 (ht35), or the Armenian Modal Haplotype as opposed to the Atlantic Modal Haplotype which is known as haplotype 15. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maxim instead of in Iberia. They can be found in extremely high numbers in Anatolia and Armenia with smaller numbers throughout the Middle East, in Central Asia, in Jewish populations, in South Eastern Europe, and the Caucasus. They are also present in Britain and areas of Western Europe in places that were found to have a high concentration of Haplogroup J, another Near Eastern Haplotype, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see http://freepages.genealogy.rootsweb.com/~gallgaedhil/haplo_r1b_ht35.htm .

Mutation

The technical details of M343 (rs9786184) are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5'? 3': tttaacctcctccagctctgca
Reverse 5'? 3': acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

See also

Template:Y-DNA R

References

  1. ^ Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree
  2. ^ Cinnioglu, Cengiz (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–148. doi:10.1007/s00439-003-1031-4. {{cite journal}}: |access-date= requires |url= (help); Unknown parameter |coauthors= ignored (|author= suggested) (help); Unknown parameter |month= ignored (help)
  3. ^ Y Chromosome Consortium (2002-01-18). "YCC NRY Tree 2002". Retrieved 2007-12-13. {{cite web}}: Check date values in: |date= (help)
  4. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
  5. ^ Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4.
  6. ^ S.M. Adams et al., The case of the unreliable SNP: recurrent back-mutation of Y-chromosomal marker P25 through gene conversion, Forensic Science Int vol. 159, no, 1 (2006 May 25), pp. 14-20.
  7. ^ B. Arredi, E. S. Poloni and C. Tyler-Smith, The peopling of Europe, in M. Crawford (ed.), Anthropological Genetics: Theory, methods and applications (2007), p. 394.
  8. ^ "Variations of R1b Ydna in Europe: Distribution and Origins".
  9. ^ International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009
  10. ^ Fulvio Cruciani et al., A Back Migration from Asia to Sub-Saharan Africa is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes, Am. J. Hum. Genet, 70:1197–1214, 2002, pp. 13-14. Note that it was reported here as R1*-M173 but the following study makes the subclade clear; [http://hammerlab.biosci.arizona.edu/publications/Wood_2005_EUR.pdf Elizabeth T. Wood et al., Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes, European Journal of Human Genetics (2005) 13, pp. 867–876.
  11. ^ [1] The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations - J. R. Luis et al., Am. J. Hum. Genet. 74:000–000, 2004.
  12. ^ A. Rosa et al., Y-chromosomal diversity in the population of Guinea-Bissau: a multiethnic perspective, BMC Evolutionary Biology 2007, 7:124 doi:10.1186/1471-2148-7-124
  13. ^ Hisham Y. Hassan et al., Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History, American Journal of Physical Anthropology, vol. 137 (2008), no. 3, pp. 316-323.
  14. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
  15. ^ D. Contu et al., Y-Chromosome Based Evidence for Pre-Neolithic Origin of the Genetically Homogeneous but Diverse Sardinian Population: Inference for Association Scans, PLoS ONE, Issue 1 (January 2008), pp.1-8.
  16. ^ Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
  17. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
  18. ^ [2] Dennis Wright - The Irish Type III Website
  19. ^ Ornella Semino et al., The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective, Science', vol. 290 (2000), no. 5494, pp. 1155 - 1159.
  20. ^ Arredi, Poloni and Tyler-Smith (2007). "The Peopling of Europe". Michael Crawford, Anthropological Genetics, pp. 380-408.
  21. ^ 11/102, "Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample"., Robino et al. 2008
  22. ^ [M. Regueiro et al. (2006), "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration"]
  23. ^ a b [3] Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405, The Croatian Medical Journal, Vol. 48, No. 4. (August 2007), pp. 450-459
  24. ^ Family Tree DNA: Null 439
  25. ^ results
  26. ^ See the "Ivanhoe" clan migration map
  27. ^ McEwan's Genealogy Page: "R1b1c4 aka M153"
  28. ^ a b Susan M. Adams et al., The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula. AJHG, 2008
  29. ^ a b A.M. López-parra et al., In search of the Pre- and Post-Neolithic Genetic Substrates in Iberia: Evidence from Y-Chromosome in Pyrenean Populations. Annals of Human Genetics 2008
  30. ^ Bosch et al., High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  31. ^ M.E. Hurles et al., Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism, 1999
  32. ^ Z.H. Rosser et al., Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language, 2000
  33. ^ Bosch et al. High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula, 2001
  34. ^ McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"
  35. ^ McEwan Genealogy Page S28
  36. ^ EthnoAncestry
  37. ^ New York Times: Percentage of men in Ireland who are believed to descend from King Niall of the Nine hostages
  38. ^ Tatiana M. Karafet et al., New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree, Genome Research, 2008
  39. ^ Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4.
  40. ^ a b c d e f g Ornella Semino, A. Silvana Santachiara-Benerecetti, Francesco Falaschi, L. Luca Cavalli-Sforza and Peter A. Underhill, "Ethiopians and Khoisan Share the Deepest Clades of the Human Y-Chromosome Phylogeny," The American Journal of Human Genetics, Volume 70, Issue 1, 265-268, 1 January 2002.
  41. ^ 582/1002, The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula, Adams et al. 2008
  42. ^ a b c Rosser et al. (2000)
  43. ^ 395/657, Micro-Phylogeographic and Demographic of Portuguese Male Lineages, Beleza et al. 2005
  44. ^ 280/699, Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter, Capelli et al. 2007
  45. ^ 473/1215, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  46. ^ a b [4] Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland - Agnar Helgason et al., 2000, Am. J. Hum. Genet. 67:697–717, 2000
  47. ^ 57/232, Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome, Gaetano et al. 2008
  48. ^ American Journal of Human Genetics doi: :10.1016/j.ajhg.2008.10.012, Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean, Pierre A. Zalloua et al.
  49. ^ 174/930, Y-Chromosome Based Evidence for Pre-Neolithic Origin of the Genetically Homogeneous but Diverse Sardinian Population: Inference for Association Scans, Contu et al. 2008
  50. ^ 106/913, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis, Kayser et al. 2005
  51. ^ a b c d e Oxford Journals [5]
  52. ^ Doron M. Behar, Mark G. Thomas, Karl Skorecki, Michael F. Hammer, Ekaterina Bulygina, Dror Rosengarten, Abigail L. Jones, Karen Held, Vivian Moses, David Goldstein, Neil Bradman, and Michael E. Weale, "Multiple Origins of Ashkenazi Levites: Y Chromosome Evidence for Both Near Eastern and European Ancestries," American Journal of Human Genetics 73:768–779, 2003.
  53. ^ Balanovsky
  54. ^ a b Tambets et al. (2004).
  55. ^ a b Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
  56. ^ R. J. King, S. S. Özcan, T. Carter, E. Kalfoğlu, S. Atasoy, C. Triantaphyllidis, A. Kouvatsi, A. A. Lin, C-E. T. Chow, L. A. Zhivotovsky, M. Michalodimitrakis, P. A. Underhill (2008), "Differential Y-chromosome Anatolian Influences on the Greek and Cretan Neolithic," Annals of Human Genetics 72 (2), 205–214 doi:10.1111/j.1469-1809.2007.00414.x
  57. ^ a b c d Pericic, M (2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443. {{cite journal}}: Unknown parameter |coauthors= ignored (|author= suggested) (help) Haplogroup frequency data in table 1
  58. ^ 238/734, Weale et al. (2004)
  59. ^ 13/32, Y-Chromosome Variation Among Sudanese:Restricted Gene Flow, Concordance With Language, Geography, and History, Hassan et al. 2008
  60. ^ 43/445, Hassan et al. 2008
  61. ^ 6/147, Luis et al. 2001
  62. ^ 11/102, Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample
  63. ^ 10/139 Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula , Adams et al. 2008
  64. ^ 3/54 Arredi et al. 2004
  65. ^ Combined Adams et al. 2008; Bosch et al. 2001 and Maria Brotilini et al. 2004
  66. ^ 76/523, Y-Chromosome Excavating Y-chromosome haplotype strata in Anatolia, Cinnioglu et al. 2004
  67. ^ 16/139, Zaheri et al. 2003,Y-chromosome and mtDNA polymorphisms in Iraq
  68. ^ Wells et al. (2001), Nebel et al. (2001), Nasidze et al. (2005), Cruciani et al. (2004)
  69. ^ Semino et al. (2000), Hammer et al. (2000), Di Giacomo et al. (2004), Cruciani et al. 2004
  70. ^ Nebel et al. (2001),Cruciani et al. (2004), Hammer et al. (2000)
  71. ^ Flores et al. (2005) Isolates in a corridor of migrations: a high-resolution analysis. of Y- chromosome variation in Jordan
  72. ^ Wells et al. (2001), Semino et al. (2000), Hammer et al. (2000), Semino et al. (2004), Zalloua et al. (2008) 47/935, Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events, Zalloua et al. 2008
  73. ^ 7/164, Cadenas et al. 2008
  74. ^ A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005
  75. ^ a b c R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
  76. ^ Tambets et al. (2004)
  77. ^ Ruixia Zhou, Daqun Yang, Hua Zhang, Weiping Yu, Lizhe An, Xilong Wang, Hong Li, Jiujin Xu, and Xiaodong Xie, "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape," Annals of Human Biology (2008), 35:2, 198 — 211.
  78. ^ Yali Xue, Tatiana Zerjal, Weidong Bao, Suling Zhu, Qunfang Shu, Jiujin Xu, Ruofu Du, Songbin ***, Pu Li, Matthew E. Hurles, Huanming Yang, Chris Tyler-Smith, "Male demography in East Asia: a north-south contrast in human population expansion times," Genetics 2006.
  79. ^ 8/176 R-M73 and 5/176 R-M269 for a total of 13/176 R1b in Pakistan and 4/728 R-M269 in India; Sanghamitra Sengupta et al., "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists", American Journal of Human Genetics, Volume 78, Issue 2, February 2006, Pages 202-221, doi:10.1086/499411.
  80. ^ Tenzin Gayden et al., "The Himalayas as a Directional Barrier to Gene Flow," American Journal of Human Genetics, Volume 80, Issue 5, 884-894, 1 May 2007.

Bibliography

External links

Maps

Projects

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_R1b&oldid=291309778"