Wikipedia:Reference desk/Computing

Welcome to the computing section
of the Wikipedia reference desk.

skip to bottom

Select a section:

• Computing
• Entertainment
• Humanities
• Language
• Mathematics
• Science
• Miscellaneous
• Archives

Want a faster answer?

Main page: Help searching Wikipedia

   

How can I get my question answered?

• Select the section of the desk that best fits the general topic of your question (see the navigation column to the right).
• Post your question to only one section, providing a short header that gives the topic of your question.
• Type '~~~~' (that is, four tilde characters) at the end – this signs and dates your contribution so we know who wrote what and when.
• Don't post personal contact information – it will be removed. Any answers will be provided here.
• Please be as specific as possible, and include all relevant context – the usefulness of answers may depend on the context.
• Note:
  • We don't answer (and may remove) questions that require medical diagnosis or legal advice.
  • We don't answer requests for opinions, predictions or debate.
  • We don't do your homework for you, though we'll help you past the stuck point.
  • We don't conduct original research or provide a free source of ideas, but we'll help you find information you need.

Ready? Ask a new question!

How do I answer a question?

Main page: Wikipedia:Reference desk/Guidelines

• The best answers address the question directly, and back up facts with wikilinks and links to sources. Do not edit others' comments and do not give any medical or legal advice.

See also:

• Teahouse
• Help desk
• Village pump
• Help manual

April 23

Bash - deleting recursively

• OK, so I have a lot of folders on my Ubuntu machine that have files in them that I don't want. Namely, desktop.ini and thumbs.db (thanks Windows). However, I really really don't want to surf through every folder on my machine. What is the bash (i.e., terminal) command for deleting a file recursively? When I do rm thumbs.db -r, it simply responds with m: cannot remove `thumbs.db': No such file or directory. Magog the Ogre (talk) 05:52, 23 April 2011 (UTC)

find -name desktop.ini -exec rm {} \; (but I just woke up, so test it on a copy first) -- Finlay McWalter ☻ Talk 08:23, 23 April 2011 (UTC)

find needs a path to search. If you really want to delete every desktop.ini and thumbs.db on your entire system (or, at least, on every file system presently mounted read-write), try something like this:

sudo find / \( -iname 'desktop.ini' -o -iname 'thumbs.db' \) -delete

(With -iname meaning "case-insensitive name"; it will nuke any files named Desktop.ini or THUMBS.DB or any other case-variations as well. If you don't want that, use -name instead of -iname.) --Link ^(t•c•m) 08:57, 23 April 2011 (UTC)

Doesn't actually require a path, though I would definitely find the omission of one to almost certainly serve as a bad example. ¦ Reisio (talk) 15:26, 24 April 2011 (UTC)

Great! It worked beautifully. Now maybe you can help me with another problem I've had after unloading some archives: a folder within a folder. A lot of my directories are duplicated, so for example, I have /media/backup/pics/pics/IMG01.jpg or /media/backup/pics/Mypics/IMG01.jpg (you can see the first pics folder is unnecessary). Is there a way to move all the files to the parent directory and delete the subfolder when the only contents of the parent directory to begin with were just one folder (i.e., /media/backup/pics only content is the pics or Mypics directory). Magog the Ogre (talk) 18:47, 23 April 2011 (UTC)

I think that's most easily handled by a Python script:

import os
for r,d,f in os.walk("."):
  if not f and len(d)==1:
    e=os.path.join(os.path.dirname(r),"_empty")
    os.rename(r,e)
    os.rename(os.path.join(e,d[0]),r) # turn .../a/b/ into .../a/
    os.rmdir(e)
    del d[0]                    # don't recurse

Save that and run it (with python filename.py) in a directory containing all the "trivial" directories you want collapsed. As the comment says, it preserves the name of the containing directory rather than the contained directory; this is equivalent for most purposes to what you said ("move all the files to the parent directory and delete the subfolder"). Note that once it finds a shortening to do, it doesn't search the contents of that directory further (so if you had skinny/skinny2/directory/many-files, it would only delete skinny2/ from the path); you can always run it more than once. No warranty, of course, but since this only calls os.rmdir(), which can only remove empty directories, it should be pretty safe. --Tardis (talk) 17:58, 24 April 2011 (UTC)

Thank you; is there a way to maintain the name of the subdirectory? I don't know any python. Magog the Ogre (talk) 19:15, 24 April 2011 (UTC)

This will do that:

import os
for r,d,f in os.walk("."):
  if not f and len(d)==1:
    u=os.path.dirname(r)
    e=os.path.join(u,"_empty")
    os.rename(r,e)
    os.rename(os.path.join(e,d[0]),os.path.join(u,d[0])) # turn .../a/b/ into .../b/
    os.rmdir(e)
    del d[0]                    # don't recurse

Note that it will fail if you have, say, .../skinnyA/dir/files and .../skinnyB/dir/files since they can't both become .../dir. --Tardis (talk) 18:36, 25 April 2011 (UTC)

Wordprocessing - universal archiving standard?

I'm using Abiword (version 2.8.6) which by default saves documents as .abw. I'm beginning to worry that in future years, when I use some other wordprocessor with some other operating system, then I won't be able to open these old documents. Abiword can also save documents as .doc .rtf .latex .odt .sxw .docx among others.

What would be the best bet, apart from .txt, for long-term storage? Something that could be read in different operating systems by different wordprocessors. Thanks 92.24.182.118 (talk) 17:21, 23 April 2011 (UTC)

.rtf is Rich Text Format. .doc and .docx are Microsoft Word formats. .odt and .sxw are OpenOffice.org formats, with .sxw being an older, obsolete format, I think. .latex is presumably LaTeX.

.rtf is the most widely supported, and it is human-readable, so try that first. You may find that it doesn't preserve fancier features of the document, in which case I would try .doc or .docx, since MS Word's huge market share creates a strong incentive to support those formats well. .odt is an open format used by an open-source product, but so is .abw, so I'm not sure there's an advantage there. LaTeX will probably remain fairly stable for decades to come, so you will be able to print your documents, if you don't mind doing it with LaTeX. -- BenRG (talk) 18:02, 23 April 2011 (UTC)

It is difficult to guess (which is essentially what you're having to do) which formats will and won't be supported by future programs. I was caught out myself a while back, when I discovered that OpenOffice wouldn't (natively) open decade-old StarOffice documents. As you can't know, and as storage is cheap, I'd recommend a rather paranoid solution: store the .abw you actually use, and .doc, .odt, .rtf and maybe some others as well, and a PDF to boot (so at least, in the future, you can print a document, even if it's difficult to edit). If the appearance is important (e.g. if it's more than just essays or letters) I'd also archive off the TTF/OTF files for the fonts used in the documents. -- Finlay McWalter ☻ Talk 18:15, 23 April 2011 (UTC)

It's worth noting that .docx is an open standard and is essentially just XML (albeit zipped). The combination of huge market share with open and non-binary formatting, with the ability to support rather complicated documents, makes it seem to me like the best future-friendly choice. --Mr.98 (talk) 19:03, 23 April 2011 (UTC)

Office Open XML's status as an open standard is tenuous at best; it is largely a documentation of Microsoft's existing implementation (including bug-compatibility with ancient versions of Excel at least) that is unreasonably difficult for any other entity to support properly. It exists solely to let Microsoft say that Office uses open standards (as required by an increasing number of government bodies); we have an entire article on its standardization process and its irregularities. (In particular, many countries suddenly requested principal voting status just before the final polling, and then vanished once they had cast the vote they had been paid to makecared about.) --Tardis (talk) 17:28, 24 April 2011 (UTC)

Thanks. Reading the Abiword article more closely, it suggests .abw is XML. Do other editors exist to read XML? Thanks. 92.29.117.87 (talk) 20:45, 23 April 2011 (UTC)

Sure, tons. But being able to read XML doesn't mean you can do anything worthwhile with the document it encodes. XML is just a way of writing a complex document in a manner that's perhaps a bit easier for another program to parse than if it was an obscure binary format. But there's XML for pictures, XML for formulas, XML for molecules, XML for genes, XML for maps, etc. To really do anything useful with an XML document (like render a printed document) you have to understand what is encoded. To understand the Office Open XML (which is docx etc.; don't let the name make you think this is the format for the OpenOffice.org program) you need to read a specification that's 7,000 pages long (over and above the underlying XML specification). Hopefully (surely) Abiword's XML-based format isn't as insanely vast as that, but a word processor document is of necessity a complicated thing, requiring a detailed specification and an impressive feat of engineering to implement. -- Finlay McWalter ☻ Talk 21:15, 23 April 2011 (UTC)

None are going anywhere anytime soon, and if you use a plain text format, it will always be quite easy to make a converter even if all software on the planet disappears in a freak accident. I'd go with , still, though. :p ¦ Reisio (talk) 19:25, 24 April 2011 (UTC)

Archiving Hotmail with Thunderbird

I installed Thunderbird only so that I could archive my thousands of Hotmail emails to my HD. But Thunderbird appears to save the archived emails to some file which only it can read. Is there any way of saving the emails in a more accessable way please? As it happens, I will need to show some old emails in court as evidence; I would prefer something that could print them as near to how they look in Hotmail as possible. As there are thousands of them, I could not do anything on an email by email basis. Thanks 92.24.182.118 (talk) 17:32, 23 April 2011 (UTC)

Thunderbird uses a variant of the mbox format, which many other programs can read. Bar some quoting rules, an mbox is just the text of all the emails, as they were received, concatenated one after the other. If you wanted them in individual files, I've used Fookes Software's "Aid4Mail" program (which isn't free) to turn such archives into folders full of .eml files (one file per email). Parsing an mbox file is not especially difficult, so I'm sure others here will have recommendations for other programs that can do the job too. But I share your pain about the printing issue. Some Googling suggests this extension can save folders as HTML (which maybe printable); I haven't used that extension myself. The obvious solution (simply select all the emails and say print) should work too. -- Finlay McWalter ☻ Talk 17:56, 23 April 2011 (UTC)

Cannot print in MS Word

Resolved

Vista. Prints fine in Openoffice. Word boots me out when I CTRL P. Kittybrewster ☎ 18:12, 23 April 2011 (UTC)

CTRL P works fine for my Word running under Vista, but perhaps you have assigned the key to some other function? Dbfirs 18:46, 23 April 2011 (UTC)

1. Does it work if you go File > Print. 2. "Boots you out" how? Full crash or what? What's the message say? 3. Is it just one document in particular or all documents? --Mr.98 (talk) 18:56, 23 April 2011 (UTC)

No. File Print also boots me out. All documents. No message, no save, no hesitation, Word closes down altogether. Kittybrewster ☎ 19:12, 23 April 2011 (UTC)

Does the same thing happen if you use a different printer driver? Dbfirs 20:14, 23 April 2011 (UTC)

I think the way to check that would be through file print ... which boots me out. Kittybrewster ☎ 21:05, 23 April 2011 (UTC)

Go to Control Panel → Printers. Right-click a different printer icon and choose Set as Default. Then re-open Word and see if the Print box works. --Bavi H (talk) 04:05, 24 April 2011 (UTC)

Very helpful. Thank you. Kittybrewster ☎ 11:41, 24 April 2011 (UTC)

Making an animated GIF

I have a series of ASCII PPM files (24 bit color) which I would like to change into an animated GIF. How can I best (and most cheaply) accomplish this goal ? (No "tweening" is needed.) Right now I only have Gimp and MS Paint. I'm on Windows XP SP3. StuRat (talk) 22:01, 23 April 2011 (UTC)

Imagemagick: convert *.ppm foo.gif (more options listed here; -delay and -loop will be most useful for this operation) -- Finlay McWalter ☻ Talk 22:24, 23 April 2011 (UTC)

Thanks. I went to download it, but am confused by the "static" versus "dynamic" downloads offered here: [1]. What's the difference ? Does this refer to memory allocation within the program ? StuRat (talk) 00:32, 24 April 2011 (UTC)

From your perspective it doesn't matter. Use the "portable" one. 87.112.134.59 (talk) 01:25, 24 April 2011 (UTC)

That's 16 bits per pixel, or 48 bits total. I have limited memory and only need 24 bits total, so that seems like overkill. StuRat (talk) 01:59, 24 April 2011 (UTC)

Unless your pictures are of astronomical sizes, it will make little practical difference. I'm sure you're aware that if the colours in the images are drawn from nature (rather than being machine-generated from a very limited palette) the archaic nature of GIF's colour handling will do vile and sucktastic things to the colour rendition in the final GIF. 87.112.134.59 (talk) 02:04, 24 April 2011 (UTC)

They are computer generated images (from a program I wrote), and do use a limited palette. Being PPM ASCII, they are also huge, on the order of 5 MB each. StuRat (talk) 02:58, 24 April 2011 (UTC)

GIMP can create animated GIF images. It will use each layer as a frame. See this tutorial. --Andreas Rejbrand (talk) 23:08, 23 April 2011 (UTC)

Thanks. Does GIMP offer command line support for what I want ? StuRat (talk) 00:33, 24 April 2011 (UTC)

Yes, but it is not remotely near the simplicity of imagemagick. I had a job that imagemagick couldn't do and I spent two days writing scripts to get GIMP to do it from the command line. Basically, command line support is a limited feature of GIMP, but it is the primary feature of imagemagick. -- kainaw™ 02:17, 24 April 2011 (UTC)

Why couldn't imagemagick handle it ? StuRat (talk) 03:02, 24 April 2011 (UTC)

Here's my initial animated GIF, using imagemagick. Looks good, thanks guys !

StuRat (talk) 17:55, 25 April 2011 (UTC)

Resolved

StuRat (talk) 18:24, 25 April 2011 (UTC)

April 24

MS Word footnote

How to insert more than one references in a single footnote in MS Word?

For example in Mellitus#Early_life, the first sentence "The medieval chronicler Bede described Mellitus as being of noble birth.[4][5]" has two references. If I write this sentence in Word, how can I insert those two references in a single footnote? --Reference Desker (talk) 03:58, 24 April 2011 (UTC)

You insert a footnote, you add the two references into it. Copy, paste. Have you tried it? It's about as easy as you can make it. Let us know if you run into difficulty with it. Word does not require you to have only one reference per footnote or anything that I could imagine would make this difficult. If you are asking about how to format two references properly, it will depend on the reference format you are using. --Mr.98 (talk) 12:25, 24 April 2011 (UTC)

Disk Space

I have 320 GB harddisk. But on Windows XP it is showing less than 10 Gb in each of C:, D:,E: and F:, same is case in Windows 7. How do I get rest of my diskspace without reinstaling the systems ?  Jon Ascton  (talk) 04:26, 24 April 2011 (UTC)

Well the most likely cause of low hard-disk space is a large volume of media installed on your computer - e.g. if you have downloaded a lot of movies/tv shows, have an extensive music collection, or lots of photos then you can soon start eating into 320gb. The other thing to note is that the size of your hard-disk 'listing' (i.e. the 320GB you mention) and the actual space you get are different due to, well, see the article Hard disk drive#Capacity measurements. Beyond that if it's not down to being genuinely used up then it may be a partition/disk issue. ny156uk (talk) 08:04, 24 April 2011 (UTC)

It's also possible that a large portion of the disk has not been allocated to any partition. In that case, the easiest thing to do is to allocate it to a new partition you create, say "G:". StuRat (talk) 08:10, 24 April 2011 (UTC)

Windirstat is a application that will show what files take up the most place. Use it to find what's gobbling your disk. It's a free download from their website. General Rommel (talk) 09:41, 24 April 2011 (UTC)

Dual monitor system

Resolved

I'm considering a new computer and I want a dual monitor system so I can extend the desktop. There are four video cards available: Nvidia GT 420, and ATI Radeon 5450, 5670, and 5870. I think these all have three outputs: DVI, VGA, and HDMI. I asked the salesperson if that would support two monitors, and they said yes - plug one into the DVI and the other into either VGA or HDMI. Will that give me the extended desktop (not just show the same thing on both screens)? Bubba73 ^{You talkin' to me?} 05:43, 24 April 2011 (UTC)

Yes. Although I expect many would only have dual outputs. Also I would be surprised if they really have VGA. Most likely they are dual DVI with a single converter supplied for HDMI and a single one for VGA. Nil Einne (talk) 06:03, 24 April 2011 (UTC)

"Number of plugs" is not identical to "maximum number of simultaneous video output streams." It is probable that the card supports 2 monitors at a time: simultaneously, VGA and one of either DVI or HDMI. So, read the specifications carefully. Nimur (talk) 14:53, 24 April 2011 (UTC)

The DVI outputs are "dual", but that just seems to double the throughput, not allow two monitors. I looked at the specs of the cards, but I couldn't tell. I'll try to post links to them. Bubba73 ^{You talkin' to me?} 15:32, 24 April 2011 (UTC)

I expect more likely it supports both DVI-D and HDMI (and with an appropriate converter two DVI-D) simultaneously. As I said, I've never seen a modern card which doesn't support two DVI-D outputs and considering that is supported in I'm pretty sure all modern GPUs and the number of people wanting two digital outputs is by this stage probably higher then those wanting 1 digital and 1 analog, there's little reason why they wouldn't support it. It seems DVI+HDMI+VGA is more common then I thought [2], I guess with increasing popularity of HDMI it makes sense to include a HDMI plug instead of just a converter and with the smaller size it's possible to include a VGA so that is included. In fact, from a search I was reminded of an even bigger reason why the lack of 2 digital outputs is unlikely at least on the AMD/ATI side, Eyefinity. From our article on 5xxx and 6xxx AMD/ATI cards, it appears DVI-D, DVI-D/HDMI and VGA all simultaneously may also be supported although that doesn't mean they will work on the specified cards. (Definitely if your card has a DisplayPort and some combination of 2 total DVI or HDMI or 2 DisplayPorts and 1 DVI/HDMI then it should support 3 monitors.) Nil Einne (talk) 15:46, 24 April 2011 (UTC)

Here is the link to the Nvidia card. On the specs tab it does say "multi monitor", so I hope that is what I want. On two of my computers I added in video cards that supported two monitors, to extend the desktop horizontally. It would be nice to not have to change video cards to do that. I'm not sure if the salesperson I chatted with actually understood that it would be two monitors, with different desktops. Bubba73 ^{You talkin' to me?} 17:22, 24 April 2011 (UTC)

And the ATI card specs tab talks about "ATI Eyefinity", but it isn't clear to me that it extends the desktop they way I want. Well, looking at Eyefinity I guess it does. Bubba73 ^{You talkin' to me?} 17:27, 24 April 2011 (UTC)

To answer the initial question (extended desktop), yes it can. In Windows 7, all you have to do is go to Screen Resolution in the control panel and where the monitors are labelled 1 and 2, drag them around whatever way you want and choose how to configure the screen which includes extending the desktop. Good luck General Rommel (talk) 00:19, 25 April 2011 (UTC)

Thank you, that helps a lot. Bubba73 ^{You talkin' to me?} 04:10, 25 April 2011 (UTC)

Followup question: I'm planning to get a computer with one of these cards in a few days. I have two VGA monitors - Can I use a VGA/DVI adapter on one, for the DVI port? Bubba73 ^{You talkin' to me?} 01:36, 27 April 2011 (UTC)

Yes General Rommel (talk) 01:49, 27 April 2011 (UTC)

Thank you. Bubba73 ^{You talkin' to me?} 02:12, 27 April 2011 (UTC)

One more - looking at a photo of the back of the computer, even though the specs say they have one of those cards, they show ports in the case rather than a card in a slot. It says HDMI/VGA port (I see both). It doesn't say DVI, even though that is supposed to be on the video card. And since it says HDMI/VGA, I'm again wondering if it can actually run two monitors in extended desktop mode. Whoops - in addition to those ports, it does show the card in the slow with all three connectors. Bubba73 ^{You talkin' to me?} 02:46, 27 April 2011 (UTC)

IP addresses

My AppleMacBookPro has taken to telling me occasionally "That another device is using your computers IP address, change one or the other". I am assuming that this refers to my iPhone or a new router. How do I change the IP address of either devices please, and why should I need to since this is a new problem?--85.211.214.249 (talk) 05:52, 24 April 2011 (UTC)

This occurs if two devices have been manually set to use the same IP address, or one is set to manually use an address in the DHCP pool, and that address has been handed out by DHCP to another device. However, I don't know how to configure networking on Macs/iDevices, so I'll leave it to others to assist you further. CS Miller (talk) 10:54, 24 April 2011 (UTC)

You may need to contact your network administrator. It's possible that your Mac is perfectly configured correctly, but that somebody else's device attached to the network is incorrectly configured. If that's the case, your network administrator can track down the responsible device and force them to fix their configuration. If it turns out your device is the misconfigured one, you can change your network settings by following these instructions: Changing your network settings. If you are the network administrator, make sure all your devices are using DHCP, with automatic addresses. Nimur (talk) 15:47, 24 April 2011 (UTC)

Thanks Nimur, will give it a try.--85.211.196.30 (talk) 16:30, 25 April 2011 (UTC)

What would cause this? Can sync Dropbox, download iTunes, but can't load webpages.

I clearly have a working internet connection; I can sync my Dropbox and search and purchase from iTunes, but I can't open webpages in a browser. Any ideas?

• Windows 7
• Firefox 4 or IE 9

Thanks! ike9898 (talk) 12:47, 24 April 2011 (UTC)

Two possibilities come to mind: your web browsers are all set up to use a proxy server, which is configured incorrectly or is not working; or you may be on a network that is blocking HTTP network traffic (which is very unusual, but completely possible).

Check your proxy settings: (instructions for IE and Firefox). That's the most common solution. Nimur (talk) 14:26, 24 April 2011 (UTC)

Thank you! I'll try your suggestions tonight. ike9898 (talk) 00:07, 25 April 2011 (UTC)

StarCraft II framerate issue

Resolved

I've been playing Wings of Liberty for a while and encounter some problems regarding framerate and heat. According to the StarCraft 2 article, the game itself has a problem with framerate, which is not locked in the menu, which may cause the GPU to overheat. I do not know if Blizzard has already patched it or not. My StarCraft version is v2.1.2.1631, running at custom medium settings. The framerate in the menu is around 50 fps, and in game is around 40. But when the in-game cinematics is running (the scene inside Hyperion where Raynor, Matt, and Tychus discuss), it even reaches 250+ FPS!!! My GPU load is 100% all of the time, and the computer's temp reaches 80 Celcius degree. I've been searching around but still cannot find the solutions. I have some questions about the game, as well as some technical concepts.

1. Enable Vertical Synchronization help me lock the cinematics framerate to 60 fps, but it also locks the in game fps to 30 (which is normally 40 -> 45). All I know is that when the framerate will be synchonized with the refresh rate if the framerate is too high. According to a post in some forum I found, if the framerate is less than the screen refresh rate (mine is 60 Hz), the V-SYNC option will lock framerate to 30, and if it is less than 30, the result is 15 and so on. I need a confirmation.
2. Does V-SYNC really limit the FPS (which means the video card is off-loaded), or it just ignore the redundant frames (which means the video card still works the same)?
3. Running high demanding games on a weak video card causes it to be fully loaded. The GPU continues to renders frames util cap framerate is met (often 60). Framerate lower than 60 indicates that the GPU is doing its best. But why do they overheat only when running SC2? Theoretically benchmark programs like 3DMark, which stretches GPU will make them overheat, too.
4. Do laptop CPU and GPU have seperate heat sinks? When all 4 cores of my CPU are fully loaded, the CPU temp is just 68 degree. But when all 4 cores are 40% loaded, but the GPU is at full load, the CPU temp even reaches 80 degree. It seems that they share the same heat sink.
5. Is there anything I can do to lock the framerate in the cinematics?

I really want to play this game, but also do not want to fry or roast my video card. A dead laptop video card would mean, including but not limited to, a motherboard replacement. Thanks for any helpful information. -- Livy the pixie (talk) 15:53, 24 April 2011 (UTC)

Don't worry about this, the 'GPU frying' issue was fixed with beta patch 1 in February 2010, long before the game even came out. (I can't find the official patch notes right now, possibly because the relevant page is currently down and doesn't have a Google cache, but I found this copy on wikia. The article needs to be updated. (Any volunteers? I can't be arsed right now, especially after a long futile search for the official patch notes.)

(1.) The information about V-Sync you found is almost correct, but not quite ... for example, if your refresh rate is set to 60 Hz and your GPU is rendering slightly slower than 30 Hz, you'll probably get a frame rate of 20, not 15 ... I won't explain the details here as in practice it's more complicated anyways, but I guess for the purposes of answering your questions it suffices to say that enabling V-Sync restricts performance, sometimes severely so.

(2.) Yes it really limits the work the GPU will do.

(3.) "But why do they overheat only when running SC2?"

It's actually common for insufficiently cooled GPUs to overheat when playing demanding games. Usually the game or system will crash before permanent damage is done, but apparently some combinations of rendering instructions are more dangerous than others and in the SC2 beta, a particularly pathological case (on certain GPUs) bit particularly many unsuspecting victims at the same time. Note that there are many different ways in which a GPU can be taxed (e.g. 3DMark does different things with it than SC2's menu screens).

(4.) Could be, depends on your machine.

(5.) I haven't researched this, but apparently there is a way to cap the frame rate by editing variables.txt. Note that in the menus, frame rate is capped anyway (since the beta patch 1 fix was implemented)!

TL;DR: To maximise your enjoyment of the game, you'll probably want to leave V-Sync off and stop worrying about your hot, but not dying notebook. 188.118.245.52 (talk) 21:04, 24 April 2011 (UTC)

Thank you for your answer. For the V-Sync, i guess the screen refresh rate must be a multiplication of the sync framerate (if the sync rate is 20 fps and the refresh rate is 60 Hz, the screen refreshes 3 times to display a single frame, right?). Having 30 FPS in Resident Evil 5 is fully playable, but it is really annoying in StarCraft II. I am relieve to disable it now. -- Livy the pixie (talk) 02:34, 25 April 2011 (UTC)

I'm not sure if "sync (frame)rate" is the correct technical term but basically you've got the right idea.

Aside: I'm hesitant to make simplifications that would allow me to explain V-Sync simply and succinctly, because after many years of playing and making games I've become too fascinated with the topic to risk implying even the slightest misconception about the topic. There are such wonderful subtleties: The term V-Sync comes from CRT monitors but has slightly different implications in the above context; LCDs don't really need to be refreshed but still are generally updated at regular intervals; a game appearing to run at a solid 30 Hz isn't actually completely "locked" to that frequency; even which of SC2's two full-screen modes one selects makes a difference in how exactly V-sync works ... I better stop now before I end up giving a lecture on the intricacies of how exactly, once upon a time, changing your monitor refresh rate could potentially allow you to perform longer jumps in Q3A ;)

In short, the screen is updated at regular intervals, but it takes the computer a slightly different, slightly unpredictable time to render each frame. So when the rendering of a new frame is delayed until the previous one has been fully sent off to the display, the frame rate is related to the refresh rate by a factor that is an integer, but can change from frame to frame. So in practice, it's sort of almost, but not quite an integer factor :) The result is that the transmission of "fully formed" frames eliminates tearing (which doesn't always imply that turning V-Sync off will introduce tearing ...), while the delays increase lag and the quantisation of the aforementioned factor increases jerkyness/stutter. 188.118.245.52 (talk) 08:50, 25 April 2011 (UTC)

Furmark is known for stressing video cards to the extent some manufacturers have coded it in to drivers to reduce performance if they detect it running. Nil Einne (talk) 07:12, 25 April 2011 (UTC)

Interesting! I've read about drivers drivers detecting benchmarks in order to cheat and produce more favourable measurements, but this is news to me, thanks for sharing! I'm frequently annoyed to no end by Apple insisting on providing their own graphics drivers (at a glacial pace, making me wait years until I can use new OpenGL standards on my Mac) instead of allowing graphics card vendors to provide their own updates, but at least that should protect me from such dickery :) 188.118.245.52 (talk) 08:50, 25 April 2011 (UTC)

Rooting my own tablet?!

Dear Wikipedians:

I understand how, if I get an android smartphone, I may have to root it to get more functionality because I got the smartphone as part of a contract with a telecom company, sometimes the smartphone even comes for free as part of the contract, therefore I understand the need of the telecom company to impose some control over my phone since I do not truly own my phone. And thus the need to root it, which is actually a breach of contract.

But rooting my own tablet??!! Gimme a break. I spend ~$400 of my hard earned money to purchase a tablet from Future Shop (no telecom companies, no third parties, no one else is involved, I spend money and Future Shop gives me the merchandise, plain and simple) and yet the manufacturer won't even give me root control over my tablet? And since when did single-user Linux systems come without root power for the user? I mean when I install Slackware on my own computer, the first thing Slackware asks me is to set up the root password, I then choose to setup another ordinary user account which I use most of the time to prevent myself from accidentally harming the system, but that is entirely up to me, I may choose to run my Linux always as root if I so choose. So why does Android, which is a Linux distro from Google, remove root power from me? And how do they even do that, wouldn't Android ask me to setup the root password while I'm installing it into the tablet?

I am really confused.

76.68.7.242 (talk) 17:01, 24 April 2011 (UTC)

There is only one tablet on the market, which is the Apple iPad. The source of your confusion is thinking that the other offerings have anything to do with a tablet. Specifically, Googles ays that you can't dig around, because you're running smartphone software -- you are not really working on a tablet -- and may not look behind the curtain. A related RIM review: http://www.infoworld.com/d/mobile-technology/rim-blackberry-playbook-unfinished-unusable-534 . I don't own an iPad and have no affiliation with anyone, I just have basic understanding of the marketplace and technology. 94.27.242.110 (talk) 18:00, 24 April 2011 (UTC)

...I guess Comparison of tablet PCs needs an update, then? :p ¦ Reisio (talk) 19:18, 24 April 2011 (UTC)

Yes, all but the third row (Apple iPad) should be removed. 94.27.217.110 (talk) 01:10, 25 April 2011 (UTC)

You probably should also ask Google why they made a tablet oriented version of Android only to then help vendors use it on smartphones. And it's somewhat unclear to me how something can be a smartphone when it can't actually connect to any mobile phone network. BTW, AFAIK Apple lets you dig around or looking behind the curtain even less with the iPad so it's also not entirely clear the connection between digging around and working on a tablet that you allege is the root behind this tablet/non-tablet dichotomy. Nil Einne (talk) 06:57, 25 April 2011 (UTC)

I know it's resolved, but... Honeycomb is not "smartphone software". --Wirbelwindヴィルヴェルヴィント (talk) 07:11, 25 April 2011 (UTC)

Yes that's what I meant Nil Einne (talk) 07:14, 25 April 2011 (UTC)

"Rooting", incidentally, means something rather different for embedded devices like these than just giving you the root password. These type of devices (smartphones, tablets, etc.) boot off a flash memory part (the bootloader) which then boots the rest of the system. That bootloader typically verifies that the OS image is cryptographically signed, and frequently that OS in turn verifies that applications are also signed. "Rooting" means to change that bootloader to one that doesn't make that check, which in turn allows you to install a modified OS image which doesn't check applications. Android is Linux based, but in many ways it's quite divergent from a conventional Linux install you might run on a desktop. In particular, the login environment, and the program loader, is entirely different - I don't think the concept of "user" (super or not) particularly applies in the same way it does in say Ubuntu. Some Android platforms are quite cooperative to those power users who want to switch the bootloader (they figure if you're smart enough to know what a bootloader does, you're smart enough to take the responsibility for what software you run); some are less cooperative, and some actively try to prevent it (I'll see if I can dig up the list I saw). Beyond that, the choice is yours - if you want full control over a device then you need to only buy those devices that provide that (and write to the suppliers of the others telling them why they failed to get your business). While maybe the most visible, this is far from the only place where you're deprived of the ability to run whatever software you want on devices you own outright - the diagnostic software in your car (which freezes small repairers out of the market), the firmware in your printer (which refuses to accept refilled ink cartridges), games consoles (which will only run games for which the console manufacturer has been paid to approve), and the firmware in your DVD player (which enforces region lockout and unskippable ads). Your frustration at this is the motivating factor of the GPL, and (in these particular cases, where GPL-based software like Android is still not giving you all the control you feel you've paid for) GPLv3 - see Tivoization. -- Finlay McWalter ☻ Talk 18:03, 24 April 2011 (UTC)

Thanks soooooooooo much for your well crafted response. I guess my rage have blinded me to the obvious fact: that OEM-dictator electronics have been with us since long before the advent of the media tablets. The media tablets are simply the latest incarnations of this abomination. I have written the whole diatribe at the beginning without realizing that my cousin's PlayStation 3 is staring me right in the face. And unlike the media tablets which could still be rooted, so far there has been no way to crack PlayStation 3's copyright hardware. So all my dilemmas dissolve away. Now I am increasingly appreciative of just how much my old desktop PCs matter to me: for they enshrine the sacred principles of freedom and is my final haven. But I also pray for the day of the downfall of Sony, Apple, and all the oppressive electronic regimes out there, to be replaced by GNU and FSF and nothing but. 76.68.7.242 (talk) 20:04, 24 April 2011 (UTC)

It's not really Google that attempts to take root away from you, AIUI, but the phone vendor, the people who actually install it onto the phone, and this is of course because they don't want to deal with support for people who break their installs. If you're worried about rooting, just make an exact backup beforehand and you can always revert back — some rooting software even does this by default. ¦ Reisio (talk) 19:18, 24 April 2011 (UTC)

Resolved

Virus questions

My computer got a Trojan horse virus yesterday from a video of a television episode I was watching online. I ran a scan of AVG (software), and it found this before I had to stop the scan (if I let the scan run past about 60% completion, my computer crashes):

File	Infection	Result
C:\WINDOWS\system32\wuauclt.exe (3640)	Trojan horse Agent_r.XJ	Deleted
C:\WINDOWS\system32\wuauclt.exe (2228)	Trojan horse Agent_r.XJ	Deleted
C:\WINDOWS\system32\svchost.exe (1596)	Trojan horse Agent_r.XJ	Deleted
C:\WINDOWS\explorer.exe (3380)	Trojan horse Agent_r.XJ	Deleted
C:\WINDOWS\system32\wuauclt.exe (3640):\memory_001b0000	Trojan horse Agent_r.XJ	Infected
C:\WINDOWS\system32\wuauclt.exe (2228):\memory_001b0000	Trojan horse Agent_r.XJ	Infected
C:\WINDOWS\system32\svchost.exe (1596):\memory_001a0000	Trojan horse Agent_r.XJ	Infected
C:\WINDOWS\explorer.exe (3640):\memory_001a0000	Trojan horse Agent_r.XJ	Infected

In addition, if I am running an Internet browser at the time of the scan, it detects that it is infected as well.

This leads me to have a few questions:

1. Can I remove this virus myself without damaging my computer, and if so how? If not, what needs to be done to remove the virus? AVG doesn't seem to be doing anything to it other than detecting it, and I already unsuccessfully tried a system restore to before I know I got the virus.
2. Just in case I end up losing files, is it safe to connect an external hard drive and transfer over the "My Documents" folder while my computer still works reasonably well, or will this risk the external hard drive becoming infected as well?
3. If I load Linux onto a bootable CD, can I boot up my computer using that as a way to bypass the virus affecting windows and thus still have use of my computer? If so, how do I go about doing this?

Thanks, (from iPod) Ks0stm ^(T•C•G) 17:37, 24 April 2011 (UTC)

Those files are (very) important, so you can't just delete them - an anti-virus program has to "heal" them (by undoing the changes the virus did). If AVG won't do it, you need to find something that will. Some people swear by Ultimate Boot CD for Windows; I've no personal experience with it, because I've never had a virus. It's probably safe to copy files to an external disk (because boot-sector virusses are mostly a thing of the past) but remember that files like Word documents themselves may contain virusses, so you're not clear until everything has passed a virus check on a trustworthy machine. Yes, you can boot Linux off a CD without risk; the Ubuntu linux download page has a detailed how-to. -- Finlay McWalter ☻ Talk 18:19, 24 April 2011 (UTC)

I doubt that those executable files need "healing". It's fashionable right now for malware to run in the address space of a standard system process to make it harder to kill from Task Manager, etc. This happens at runtime, not by modifying the file on disk. The actual malware program has some other name and quits at startup after starting threads in other processes. You can still find it if you look at a list of software that runs at startup. It might also be in the list of AppInit_DLLs. HijackThis is a good program for finding this kind of thing.

Incredibly (to me), I can't find any description of "Agent_r" on AVG's web site, or anywhere else. All I find is random people trying to get rid of it, and random other people offer random advice, with no apparent knowledge of what the thing is. This is incredibly irresponsible on AVG's part, or maybe I just don't know where to look. I did find this, about AVG falsely reporting ZoneAlarm as a variant of "Agent_r". I would not be at all surprised if your "Agent_r" is also a false positive.

In the absence of any information, all I can suggest is posting a HijackThis log here, or trying TDSSKiller, as suggested by some random people on other random Internet threads. Does "Agent_r.XJ" belong to the family "Rootkit.Win32.TDSS"? Who knows?

If you don't mind the hassle, it would almost certainly work to copy your documents to an external drive and reformat and reinstall everything. The only thing I'd be concerned about there is AutoRun; be sure to disable it on the pristine system before you plug the backup drive in. It's true that Microsoft Word documents can be infected with malware, as can PDFs or JPEGs or many other formats if you happen to be running a viewer with an unpatched vulnerability, but (a) I doubt that this malware is going to infect any of those formats (because very little, if any, malware does so), and (b) even if it does, you can avoid the vulnerabilities by using up-to-date versions of the applications.

Of course, I'm only guessing about all of this, because AVG has not seen fit to give me any information. -- BenRG (talk) 05:43, 25 April 2011 (UTC)

AVG may be failing to fix all the infected files because they're in-use (and thus unwritable) at the time of its scan. It is possible to boot in to safe mode and let AVG work there, affording it less competition for the files in question. -- Finlay McWalter ☻ Talk 18:22, 24 April 2011 (UTC)

What I would do in your position is to actually remove your hard disk, buy a new, bigger hard disk, install Windows and all your applications on it, and then to reduce the likelihood this will happen in the future, I would make sure to create a user account with no administrator rights and would use that account habitually. (This makes it harder for malware to infect your system in the future.) Then I would connect the old hard disk, scan it with at least two types of anti-malware software in an attempt to disinfect it, and move your important documents over to the new hard disk as needed. While carefully treating the old hard disk like poison. See Wikipedia:Reference desk/Computing/Viruses for more details on this method. Comet Tuttle (talk) 17:21, 25 April 2011 (UTC)

No, that's silly. Upgrade your hard drive if you want a larger hard drive. Treat your old drive like a collection of stuff from your old house, some of which you should throw away.

I would be less annoyed by all this if a malware product called "Agent_r" actually existed. No program except AVG detects something called "Agent_r". It's a name invented by AVG to refer to god knows what. The only concrete information about its identity that I've found in a web search is two distinct reports of false positives (one of which I linked above). Everything else is an echo chamber of meaningless guesses from end users. If AVG were a responsible vendor, it would provide information about the threat—how it spreads, what servers it contacts, common file names and file sizes, etc.—and without that, I simply don't believe in it. People need to stop trusting the antivirus products. There is no industry or government body checking the quality of their work. There is ample evidence that they do a bad job, like the frequent false alarms, frequent failure to detect real threats, and incompetent programming. There is no incentive for them to improve; on the contrary, they benefit from a certain rate of false positives and successful malware attacks, because it keeps people scared. Use AVG if you must, but please don't trust it. If you run a virus scan with products A and B and A detects a virus and B doesn't, don't assume that B is the one that made the mistake. -- BenRG (talk) 20:13, 25 April 2011 (UTC)

According to http://www.google.com/search?q="Agent_r.XJ" this is an AKA for Alureon, which means you will be better off backing up your personal data, reinstalling the OS, and ensuring any binaries in your personal data are clean before utilizing them again (IIRC eset's online scanner can detect it) ...or just switch to Linux. You can remove Alureon and whatever you think it installed, but you can never know everything that was altered without a fresh system install (or enormous list of checksums) to compare to. Additionally, trojans are not viruses, viruses are not trojans, and while you certainly could have acquired malware by visiting a shady website, particularly with an insecure and/or old browser, it probably wasn't the video itself.
http://ubergeek.tv/article.php?pid=54 ¦ Reisio (talk) 21:22, 25 April 2011 (UTC)

Seems your OS almost corrupted. What can you do now, either to log in via safe mode or unplug the hard disk and let in be scanned by another PC. By the way, if do you need to install new OS, ensure you will make at least 2 partitions, 1 for OS & 1 for your personal documents. This would help if you do need to re-install the new OS as it will delete the primary partition only. One more thing, use a license antivirus instead of free trial antivirus for better result and protection.

XML regular expressions syntax

I'm reading XML Schema Part 2: Datatypes Second Edition and have a trouble with a mixture of formal definitions and ordinary, every-day English. First the definition comes:

A normal character is any XML character that is not a metacharacter. (...)

[10] Char  ::= [^.\?*+()|#x5B#x5D]

and then the comment appears:

Note that a ·normal character· can be represented either as itself, or with a character reference.

How should I understand that? If authors put a special emphasis on the possibility of representing ·normal characters· with character references then I expect that such representation for metacharacters is not allowed. Am I right at this point?

And if I am, what are the implications, if a character reference specifies a code point of a metacharacter, say asterisk, as in 'a*'?

1. Is this expression simply invalid?
2. Or rather the reference becomes a normal character of the expression (and it works as 'a\*' with asterisk escaped)?
3. Something else?

CiaPan (talk) 21:49, 24 April 2011 (UTC)

Save chats

Is there a way to save messenger's chats in gmail automatically? —Preceding unsigned comment added by 200.46.129.81 (talk) 23:06, 24 April 2011 (UTC)

Messenger? As in AOL Instant Messenger? Or the Gmail chat app within Gmail? If the latter, go to Settings > Chat > Save Chat History. Dismas|^(talk) 00:46, 25 April 2011 (UTC)

I am using windows live messenger 2011 and I really want to use googletalk, but none of my friends have a gmail account. —Preceding unsigned comment added by 200.75.219.64 (talk) 03:36, 25 April 2011 (UTC)

April 25

How long is a bit?

Ok, so an ethernet cable transmits low voltage digital data along its length in bits. How long is the higer voltage (a 1 for example) segment in a ethernet cable? Maybe to make it simpler, imagine a cable in a single segment (forget standards) that runs for miles and miles. 69.180.160.77 (talk) 00:43, 25 April 2011 (UTC)

That depends in part on what speed you're running your ethernet at. In common use there's 10BASE-T, 100BASE-TX, and 1000BASE-T, running at 10 Mbit/s, 100 Mbit/s, and 1000 Mbit/s (1 Gbit/s), respectively. There's also 10 Gigabit Ethernet, 40 Gigabit Ethernet, and 100 Gigabit Ethernet. As you go faster, the bits come faster, so each would take up less space. The one you're probably using right now is 100BASE-TX, which the article says runs the raw signal at 25 MHz. That is, each bit of raw signal gets allotted 40 ns of time. If you're looking for length length rather than time length, the signals travel around 95% of the speed of light, which means that one bit traveling along a really long wire would occupy 11.4 m (37.4 feet). (Or more accurately, at any instant there would be 11.4 m between the start of one bit and the start of the following bit.) Note that not all of that time/space would actually be used in the detection of the bit. There's generally two ways of detecting a signal (and I'm not sure which one ethernet uses). You can either detect absolute levels at a regular intervals, in which case there would be a buffer space between the bits where the signal can switch, or you can detect transitions between the levels, in which case it's only a small fraction of time which is actually the bit itself, an the rest of the time you're just sitting around waiting for the electronics to stabilize. -- 174.31.219.218 (talk) 01:14, 25 April 2011 (UTC)

It's a bit more complicated than that -- 25MHz is the clock speed of the MII, and it carries 4 bits per clock. The groups of 4 bits are run through 4B5B encoding, which expands them to 5 bits (and mixes them together). The results of that is then MLT-3 encoded, which turns each of the 5 bits into a (possible) voltage level change. Net result: each 11.4 m (37.4 feet) of signal contains up to 5 voltage transitions, which collectively encode 4 bits of actual data. You can't really pick out the length of a particular bit on the wire, because they're mixed together in groups of 4.

Other ethernet versions can be even more complicated. For example, if I understand right, 1000BASE-T mixes the bits together in groups of 8 (clocked at 125MHz), which are then spread across 4 pairs of wires. So each 2.3 m (7.5 feet) carries 8 bits. Speaker to Lampposts (talk) 03:26, 25 April 2011 (UTC)

Is Firefox getting spacey?

Every so often Firefox (on Vista) gets another security upgrade because as usual anybody on the web can take over a windows system at any time. But it seems like after these upgrades Firefox keeps getting slower, so that now after the last one it is stopping in the middle of page loads, so I have to click the link again, stopping in the middle of scrolling down a page and waiting 5 seconds to continue. Using a laptop with 1 gig of memory only, but little else running. Is this a general problem of the program as upgraded or does it indicate a problem locally? Wnt (talk) 08:07, 25 April 2011 (UTC)

I have a similar setup (Firefox, Vista, and just 1 GB) and I have a similar problem occasionally, but I've always blamed my slow internet connection because the same happens in Opera, so I'll be interested in the replies to this. The stopping in the middle of the scroll down does sound like a resources problem on the laptop. Do you have some bloatware anti-virus running? Dbfirs 11:41, 25 April 2011 (UTC)

Please hook me up with donation brokers for old hardware.

i hope to donate an old PC system and cellphone to an impoverished country. Which brokers/organizations would help me make it so? Thanks. --70.179.169.115 (talk) 10:58, 25 April 2011 (UTC)

http://www.google.com/search?q=atlanta+georgia+donate+computer ¦ Reisio (talk) 11:58, 25 April 2011 (UTC)

Sadly, I'm from Manhattan, KS. I'll one day figure out if those Atlanta-area agencies will accept them and not have me pay the shipping. --70.179.169.115 (talk) 20:58, 25 April 2011 (UTC)

You get the idea: http://www.google.com/search?q=manhattan+kansas+donate+computer ¦ Reisio (talk) 21:09, 25 April 2011 (UTC)

Is there computer assistance in modern-day aircraft traffic control?

Lately in the news (in the US, at least) there's been a lot of coverage of recent events of air traffic controllers falling asleep on the job. Yes, I get that due to the high stakes involved, no fully automated system could be trusted to do that job, but I'd be very surprised to find that in this day and age with so many airplanes going into and out of airports, it's still a matter of a/some human(s) relying on their mental ability to handle schedule rearrangements. Do they at least have software products to suggest multiple possible reorganizations of influx and outflux of planes while taking into account each plane's constraints much more quickly than any human could, while leaving the final choice of which option (if any) to take up to the human? 20.137.18.50 (talk) 14:44, 25 April 2011 (UTC)

One note that's a little of a tangent — pilots I have talked with say that the recent news stories about sleeping air traffic controllers are overhyped, and it's not a very big deal. Pilots land at unattended airports all the time, and they all are trained on how to talk to each other on their radios to determine position and decide who gets to land first. At a nighttime airport without a lot of air traffic, the lack of a controller isn't a significant safety issue. Comet Tuttle (talk) 17:15, 25 April 2011 (UTC)

As I understand it, they were not allowed to land without tower clearance, and this was the problem. So they either need to allow pilots to land on their own when the air traffic controller dozes off, or they need to make sure they never doze off (how about requiring those angle sensitive ear alarms, as well as avoiding insanely long shifts ?). StuRat (talk) 18:15, 25 April 2011 (UTC)

One problem with automating systems is that people soon begin to over-rely on them. Thus, while the air-traffic controller SHOULD notice that, due to a glitch in the program, it has recommended smashing all the planes together into a big fireball, it's not certain that they WOULD notice this, rather than just doing what the program suggests. StuRat (talk) 18:18, 25 April 2011 (UTC)

There is significant computer assistance, at many levels, in modern air traffic control. I ran down a brief overview of the modern ASR systems in response to a question in February 2011. Digital ASR means that a complicated computerized system is responsible for coordinating every aspect of the system, from the electrical properties of the RADAR signal all the way to the "animated blip" on a "Google Maps" style software overlay map that the controller/operator uses. The rise of GPS and the integration of ground-control RADARs, approach RADARs, GPS, and regional air traffic surveillance, have changed the technology significantly; it's fair to say that the policies and procedures need to do some catching up to make sure there are no safety gaps. Probably, the recent media hype has been overblown, and has not affected commercial/civil aviation safety in an adverse way. Nimur (talk) 20:48, 25 April 2011 (UTC)

Gigabit Ethernet Jumbo Frames — performance and switches

How can I determine if my Ethernet switch can handle Jumbo Frames? Generally speaking, what kind of performance gains there with Jumbo Frames with large streams of data (like uncompressed video)? --24.249.59.89 (talk) 14:56, 25 April 2011 (UTC)

You could look at the specifications or user manual to see if it make a statement on the matter, it may be listed as the Maximum transmission unit size. Jumbo frames can only be found on gigabit Ethernet and should be able to support 9000 bytes. All devices connected to the switch network have to support jumbo frames and have the option turned on if you want to use it. I will leave the performance gain for someone else. For simple networks with one switch there may be little benefit, and the main advantages will come if there are many switches or long latencies involved, or if you go to speeds of 10 gigabits per second or higher. Graeme Bartlett (talk) 11:42, 28 April 2011 (UTC)

Server?

"The server did not recognize your user name or password for account" xxxxxx .” Make sure you enter them correctly." My iCal programme comes up with this message before giving me the programme, as I am a non-techie can someone please advise what server it is writing about since so far as I can see all my passwords are in order.

Is this a program which runs over the Internet ? If so, the server is the computer at the other end of the Internet where the program actually runs, then it returns the results to your computer. As for not recognizing the password, the most common problem is that you have the case wrong for some or all of the password. Since most passwords are case-sensitive, this will give an error. (Unfortunately, it's the same error as if you typed in something random.) So, check whether the CAPS LOCK light on the keyboard is on, then be very careful to enter the password exactly as you did before, including uppercase versus lowercase. StuRat (talk) 18:08, 25 April 2011 (UTC)

iCal is groupware - it synchronizes your calendar with other peoples' calendars in your network (business, school, etc). To do this, it needs to talk to a server - kind of like an email program, only for calendars. If you did not intend your iCal to be set up as a networked calendar, you can disable the hosted calendar by removing that account from "Accounts" in your iCal preferences. Nimur (talk) 23:49, 25 April 2011 (UTC)

Thank you both, I have changed the password and will see what happens. By the way would Nimur care to move in please, we have a spare bedroom, he always answers my problems so promptly.--85.211.238.236 (talk) 16:53, 26 April 2011 (UTC)

No, changing the password did not work. I used the password in my Keychain, so I don't know what it wants or where to find it.--85.211.210.107 (talk) 08:59, 27 April 2011 (UTC)

Check the account preferences to determine where this networked-calendar is hosted. You will need to use the account credentials that are appropriate for the account on that calendar server, which can be different from the login you use on your local machine. If you don't know what account that is, you should contact the IT department who set up your machine or calendar system. Nimur (talk) 17:12, 28 April 2011 (UTC)

April 26

2006 Honda civic hybrid

My 06 Honda civic hybrid was in an accident where someone ran into the side of my car driving a 2004 Lincoln.I was stopped at a red light for more than 60 seconds and did not go forward until my signal light turned green. I would like to know if the computer in my car will prove my car was stopped just prior to being hit and at what speed I was going when hit. I would also like to know if the computer in the 04 Lincoln will show the speed it was going when it ran into my car. Both cars came to a sudden stop when the collision occurred. ---four tildes — Preceding unsigned comment added by Bracet01 (talk • contribs) 02:11, 26 April 2011 (UTC)

Your Honda mechanic would know. I would think just the positions of the cars after the collision, and even the impact points would be enough to suggest you had stopped, though, unless the average speed you would have been going even having not been stopped at a red light would match the speed you'd have been going had you been. ¦ Reisio (talk) 03:04, 26 April 2011 (UTC)

Building a DOS command containing the current directory.

Let's say I want to issue the following DOS command:

DIR "C:\Documents and Settings\Owner\foo.bar"

But let's say the current directory string is way too long to type in. I know that CD will tell me the name of the current directory, so can I use that somehow to build the above command ? (Yes, I realize you don't need to specify the current directory for the DIR command, but I want to know how to do this for other commands, too.) StuRat (talk) 05:22, 26 April 2011 (UTC)

The current directory has the codename "." and the parent directory the name "..", so:

DIR ".\foo.bar"

should do what you want. Let me know if it doesn't - it's been a while since I've used DOS! --Tango (talk) 06:20, 26 April 2011 (UTC)

Thanks. That did work for the DIR command, but not for the following command, issued from a system call within a FORTRAN program:

@start "" /b "C:\Program Files\Internet Explorer\iexplore.exe" ".\draw.gif"'  

However, this does work:

@start "" /b "C:\Program Files\Internet Explorer\iexplore.exe" "C:\Program Files\gfortran\StuRat\draw.gif"'

I think the problem is that IE considers "C:\Program Files\Internet Explorer" to be it's home directory. The FORTRAN program does know what the home directory really is, and a "CD" issued from it does produce the proper results. Now I just have to figure how to stuff that result into this command. StuRat (talk) 07:41, 26 April 2011 (UTC)

Another option is to use the subst command so you don't have to type all that stuff. Here is Microsoft's page on it (from the Windows XP days). As that page suggests, you might use:

subst z: b:\user\betty\forms

...so in future you just use z: instead of the whole pathname. Comet Tuttle (talk) 17:04, 26 April 2011 (UTC)

Unfortunately, that just displaces the problem. That is, I now need to figure out how to stuff the current directory into the "subst" command in my program. StuRat (talk) 17:48, 26 April 2011 (UTC)

Depending on the context of your program, the environment variable %CD% may be set. Try echo %CD% to see if it works in your context. Nimur (talk) 19:50, 26 April 2011 (UTC)

You could just use pushd . to store the current directory and then popd will change you back to it.  ZX81  ^talk 23:37, 26 April 2011 (UTC)

Can you explain better what you're doing? Are you really running under DOS and using DOS's command.com, or are you using the Windows command prompt (cmd.exe)? Is there some reason why you must use a command prompt (which is basically another programming language) to determine the current directory and to run your program, rather than just doing these things directly from your Fortran program? Which Fortran environment is it? -- BenRG (talk) 04:26, 28 April 2011 (UTC)

I am using gFortran, and the command is:

call system (' @start "" /b "C:\Program Files\Internet Explorer\iexplore.exe" "C:\Program Files\gfortran\StuRat\draw.gif" ')

This works, but right now I have to write the current directory path to a file, then read it in, to insert it into the string as "C:\Program Files\gfortran\StuRat". I was hoping for a more elegant way to do this. StuRat (talk) 06:42, 28 April 2011 (UTC)

Quality problem with animated GIF.

On the right is a file I created as a PPM. I then used imagemagick to create an animated GIF, and have captured the matching frame on the left. There's a significant decrease in the image quality. How can I prevent this ? Do I need to abandon animated GIFs and go for some other movie format ? Is there one which other people are likely to be able to read ? How do I produce this format ? (I already tried two of imagemagick's other movie formats, FLC and MNG. The FLC file was huge (58MB versus 4MB) and I couldn't display either movie to check on the quality.) StuRat (talk) 07:16, 26 April 2011 (UTC)

This is due to GIF having a small fixed palette. There is no way to get a GIF to perform any better (you can tweak ImageMagick's dither algorithm slightly, but the problem will remain). Ideally you'd use the MNG format, but browser manufacturers would rather implement new ways to do drop shadows than give us a decent animation format, so it's barely supported. That leaves a genuine movie format. Use ffmpeg this: ffmpeg -r 25 -i foo%03d.png out.mp4 (where 25 is the frame rate; adjust as you need). -- Finlay McWalter ☻ Talk 08:20, 26 April 2011 (UTC)

And would I then use a movie player to display the results, versus a browser or other software ? StuRat (talk) 09:37, 26 April 2011 (UTC)

Yes. If you intend to put the animation on Wikipedia, you'd encode the video to OGG Theora (.ogv) [I'll figure out the commands for that if you want) and MediaWiki will present the animation in a flash-based player. -- Finlay McWalter ☻ Talk 09:51, 26 April 2011 (UTC)

(Edit conflict, but I'll just post this anyway.) GIFs are limited to 256 colours per frame; I suspect that's the cause of the problem here. The best file formats for this sort of thing, in particular MNG and APNG, tend to be poorly supported by most programs. Unfortunately, most well-supported formats (e.g. WMV or MPEG-4) use lossy compression, which means you won't be able to get a pixel-perfect representation. Furthermore, they tend to be patented, which may also pose a problem. All in all I'd still say APNG is the best (it's non-patented, lossless, and designed especially for animations with many colours and no audio), despite the fact that only a few applications support it. --Link ^(t•c•m) 08:53, 26 April 2011 (UTC)

Thanks. Since I already produced an MNG, how can I view it ? StuRat (talk) 09:37, 26 April 2011 (UTC)

Multiple-image Network Graphics lists some viewers. Support for it is pretty disappointing. -- Finlay McWalter ☻ Talk 09:51, 26 April 2011 (UTC)

Also, I should add that I would like a format which supports running in a loop. StuRat (talk) 09:37, 26 April 2011 (UTC)

I was going to say that that GIF did a pretty good job of representing a very large range of colors with its palette of just 256 colors. Dithering is the technique used to do this with such a small palette, and dithering is the cause of the artifacts you're complaining about. Comet Tuttle (talk) 16:51, 26 April 2011 (UTC)

Dithering might not be so bad, but this seems to be a particularly poor job of dithering. If it can't find the exact color match in it's palette, it should be able to find something closer to what was chosen. I just did another test, restricting the color output to 256 colors per frame, and there was no horrid dithering, so that's one option. StuRat (talk) 17:54, 26 April 2011 (UTC)

I'm not familiar with imagemagick, but programs like Paint Shop Pro give options for optimizing the pallet used which can significantly improve (or worsen!) the final GIF. I agree with Comet Tuttle, though, that the image looks pretty darn good for only 256 colours and you're not likely to improve it much while still using the GIF format. Still, it may be worth a try since you've come this far already. Matt Deres (talk) 19:03, 26 April 2011 (UTC)

Try Photoshop's "Save for Web" option. It has several algorithms for selecting an optimum 256 color palette. (Usually the best one is "perceptual"). Also, if you choose the dithering option of "pattern" rather than "diffusion", it may make the dithering less apparent when animated. --24.249.59.89 (talk) 16:04, 28 April 2011 (UTC)

Legality of deep linking

I want to know what is the legality of deep linking in the US, the UK, and India? In archive search, I found an old discussion here, but that does not shade much light on this issue. I searched Google and found the following results:

In the US

• [3][4] A Texas court judge said deep linking "qualify as a copied display or performance of plaintiff's copyrightable material". But at the same time the judge was criticized. It is mentioned in the Wikipedia article. But it does not shed light on the overall legal situation in the US.

In the UK

• I do not find any information.

In India

• The Wikipedia article gives one example of court ruling which says court critical of deep linking.
• [5] This says, "There is no decided case law in the area of deep linking, although there have been several high profile cases settled out of court and a recent partial decision in one large case."

I was browsing the Guardian website and saw how they used massive deep linking. Is that legal? --Goqer (talk) 09:41, 26 April 2011 (UTC)

The trouble is, there aren't any laws against it, just questions about whether deep linking has any interpretation within the framework of copyright law. It's entirely unclear that it does, as you can see above. Given how common the practice is, even amongst the various governments in question, it seems safe to assume that most people don't assume deep linking has any legal implications. That's not the same thing as being safe, though — all it takes is a few lawsuits squeaking through and you're in trouble. It is one of those areas of the law which is not yet fully determined. It seems to me incredibly unlikely that any general decision against deep linking will occur; the argument that it appropriates content is rather specious, and it's technically quite easy for a linked-to site to prevent sites from linking to their content (add a paywall or whatever). But one should never underestimate the technical ignorance of judges, who actually make these kinds of decisions in the absence of legislation. --Mr.98 (talk) 12:20, 26 April 2011 (UTC)

Some sites even forbid linking to them at all - check this list; some on that have changed since, but not all - if you read their T&C at face value, the Wikipedia Ocado article violates it. Worse, are website T&Cs legally enforceable, civilly or even criminally? No, or maybe, or yes, even if no-one reads them. You can guess yourself, or pay a lawyer to guess for you. -- Finlay McWalter ☻ Talk 13:29, 26 April 2011 (UTC)

It's of note that the final "yes" there was an extremely specific legal case that had nothing to do with linking, and the judge in question explicitly put limits on their own ruling. I'd want to see specific cases about deep linking before drawing any big conclusions about whether the TOS clauses matter at all in that area. --Mr.98 (talk) 14:02, 26 April 2011 (UTC)

What you really want are law review articles that address this specific point. They'll give you a good overview, and link you to the specific cases on point. It's much better for you to get your information from someone that spent a semester toiling over this question than any of us here, no matter how Jeopardy-esque some of us are.

I found a few, although some are a little older. Here's a list of cites. They're not generally available online so you may need to find yourself a local law library: 29 Stetson L. Rev. 203 (1999-2000); 49 Case W. Res. L. Rev. 181 (1998-1999); 2000 Stan. Tech. L. Rev. 1 (2000); 1998 J. Info. L. & Tech., Issue 2 (1998); 82 Tex. L. Rev. 1053 (2003-2004); 16 Berk. Tech. L.J. 1273 (2001). There are many more. This might be a good place to start though. Shadowjams (talk) 19:20, 27 April 2011 (UTC)

HTM page in "www.south-pole.com" brings down the browser

Resolved

Doing a Google search I cannot follow the link to page "www.south-pole.com/p0000101.htm". With Firefox 3.6.16 all Firefox windows are brought down. With IE 8.0.6001.18702 I get the error "We were unable to return you to south-pole.com.". This behaviour occurs even if I try and access the cached version of the page. I'm using Windows XP SP3. Any advice on how to get more information about this problem? By the way, I have nothing to do with the site, I'm just trying to follow a link. Jan1naD ^{(talk • contrib)} 13:20, 26 April 2011 (UTC)

The menu at the top is a Java applet; your java install may be broken. -- Finlay McWalter ☻ Talk 13:31, 26 April 2011 (UTC)

Thanks very much, that's exactly what it was. Jan1naD ^{(talk • contrib)} 14:06, 26 April 2011 (UTC)

Google and its web of lies!

If I search Google using 'SV40PA', I find the following page as the first result. This page contains a string of letters including 'TCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTC', which Google includes as an excerpt. If, however, I search Google using 'TCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTC', it tells me a bare-faced lie that there are no results. Are there any search engines which don't discriminate against geneticists? --129.215.47.59 (talk) 14:42, 26 April 2011 (UTC)

What you're using is Google Search, a generic text search engine chiefly intended for searching normal human written text for dictionary words and proper names. Such engines perform poorly for indexing, and searching on, textual information that's mostly not composed of words (e.g. computer source code, mathematical expressions, genetic or chemical data, and numerical data). So you're using the wrong tool, and you're no more being discriminated against than if you were trying to a hammer a nail in with a cat and finding the cat uncooperative. Google does have an experimental search engine for computer source code but I'm not aware that they have one for genetic data. Genome.gov lists some more specialised options here. -- Finlay McWalter ☻ Talk 14:54, 26 April 2011 (UTC)

• That's simply because you used only a part of the "word" appearing on the page. The search engine is designed for finding words, because that's what people seek in Google most often. Use the whole 'word' ATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACA and Google will find it – [6] --CiaPan (talk) 15:41, 26 April 2011 (UTC)

By what I've understood, a lie is deliberate misinformation. Google search engine is not perfect, and as far as I know, doesn't claim to be. I'm also fairly sure it doesn't discriminate against geneticists, but rather has a "competence" issue, in other words, a bug or technical limitation. Zakhalesh (talk) 16:12, 26 April 2011 (UTC)

There is a search engine called QueryGene that uses Google to search based on partial nucleotide sequence data, but it doesn't seem to be operational at the moment. Looie496 (talk) 17:12, 26 April 2011 (UTC)

Edit

Where has the 'Edit' link gone, it seems to come and go, a Wiki problem or my computer?--85.211.238.236 (talk) 16:49, 26 April 2011 (UTC) Damn it! it's back again!--85.211.238.236 (talk) 16:50, 26 April 2011 (UTC)

For performance reasons, people who view Wikipedia when not signed in see a version served to them typically from a cache, and sometimes see weird effects where things appear and disappear, depending on which cache they're looking at (as, for performance reasons, the different web caches are not synchronised or consistent). If you create an account and view the site when signed in you get an uncached, definitive view of the site, and such now-you-see-it antics won't happen. -- Finlay McWalter ☻ Talk 17:02, 26 April 2011 (UTC)

This has been an issue for a while now, here is one of the recent discussions on it. It's a problem with Wikipedia not your computer. To clear it when it happens you can try purging the server cache like this. 82.43.89.63 (talk) 20:20, 26 April 2011 (UTC)

In Firefox, just hit ctrl-F5 to reload the page clearing the cache, and the edit button should come back. I don't know the equivalent in other browsers. 69.111.194.167 (talk) 06:29, 27 April 2011 (UTC)

That will clear Firefoxes cache, but the problem is happening with Wikimedias cache. I've tested and even a completely new instance of Firefox with all browsing data cleared will suffer the problem when it happens. 82.43.89.63 (talk) 16:22, 27 April 2011 (UTC)

Did you hit ctrl-F5, and what happened? I think it does more than just clear the browser cache. I haven't looked at the wire traffic but it may be sending different cache-control headers to the server, or something like that. Anyway, it always works for me. You can also put ?action=purge at the end of a WP url, e.g.

http://en.wikipedia.org/wiki/Wikipedia:Reference_desk/Computing?action=purge

69.111.194.167 (talk) 07:41, 28 April 2011 (UTC)

Where does gcc literally write binary to the .o file?

Getting past the conversion of high-level language and supposing in your .s file you have some assembly line like ADD r6, r1, r2 (add r1 + r2 and store in r6) where would you find the code in gcc that would be running at the moment 0x223020 (the MIPS example from here, suppose that was your target architecture) was written to the .o file? Thanks. 20.137.18.50 (talk) 21:41, 26 April 2011 (UTC)

Presumably you mean a recent version of GCC. The general process you describe is performed by the assembler, as. You might find the GNU C Compiler Internals wikibook helpful as an overview; here are very technical resources for you: GCC Selected Readings. The exact implementation (and thus, the "line of code" and even the source file) for as depends on your specific toolchain; if you are on an ordinary Intel-style PC, your flow generally goes from C code expression to GIMPLE intermediate representation to gcc RTL to x86 object file format, as described here, in from RTL to Object, and finally your operating system's loader (or GNU ld) will help GCC convert a .o into an executable program that meets your operating system's execution contract. In GCC 4.1 and more recent:

Each target architecture has its description represented as struct gcc_target targetm. Default initializers are available in file targhooks.c.

The backend generates the assembly code for the specified target platform. Function output_asm_insn() is called for each instruction written to the assembly file. Function final_start_function() generates the prolog of the function before it is saved to the assembly file.

In most cases, the result is a .s assembly-language file, which typically only exists as a Unix pipe between gcc and your as driver. as then does a dumb machine translate between textual mnemonics and binary code.

Understand that not all architectures are created equally; so your as may vary.

As a last note, understand that the GNU toolchain is actually a very complicated software system; feel free to ask for clarification if you're lost or just need more technical details. This is a very sophisticated system, and it's surprising how few people on the planet spend the time to learn how it actually works. If the Kernel embodies a net worth of a half billion dollars of invested software engineering time, imagine how valuable our Free Compiler is, which is a requisite to building the Kernel! Point is, a lot of man-hours are invested in this stuff, it's incredibly complicated. Nimur (talk) 22:16, 26 April 2011 (UTC)

April 27

Blackberry .REM Files

Hi Guys,

I work for the DoD and carry a BlackBerry Bold 9700. It contains a 2gb micro SD card that holds the photos that are taken. The other day, the screen went completely white and stopped responding to all keyboard inputs. (Strangely, it can still receive phone calls.) I took it to the IT department, who told me that it was dead, and to have my group's BlackBerry PoC return it under its warranty and issue me another one. Unfortunately for me, he is away on business for three weeks.

While it's a relief that the photos that I have taken are stored on the SD card and not on the phone itself, they are encrypted with BlackBerry's proprietary ".REM" extension. Such encryption is apparently mandated by DOD Security policy. There is also a toggle within the device options for allowing files to be transferred off of a BlackBerry SD card (which term escapes me at the moment). This is also mandatorily set to "locked" by the DOD. As such, I cannot transfer the photos off of the phone with BlackBerry's desktop manager or media transfer utilities. Neither can I simply plug the SD card into a USB adapter, and then into the computer, and transfer them to my hard drive. (Well, I can do that, but the pictures remain in encrypted format, and cannot be viewed.) The only bona fide way that I have been able to access the BlackBerry's photos in the past has been to e-mail them to myself from the BlackBerry itself. (I know. Dumb.) But with a crashed device, that is no longer possible. My sister-in-law has a BlackBerry as well, (a Curve, I think,) so I popped my SD card into her phone and instantly got a message that files were found, but they were encrypted, so I couldn't access them from her device either.

My question: Am I... SOL? If I am issued another Bold 9700, will the files be accessible, or does it have to be the exact same device? I would ask IT, but to be frank, since picture-taking with a DoD-issued device isn't considered "mission-essential," they likely will not consider my predicament very urgent. Thanks in advance, as always! Kingsfold (Quack quack!) 01:21, 27 April 2011 (UTC)

With all due respect, I don't think we should offer any advice about accessing encrypted data on a Government-owned computing device (let alone DoD)! We can assume that the data is strongly encrypted, and as such can't be practically recovered unless you know the encryption type and password; you should get assistance from your I.T. guys, because even if the contents were personal, the device is not. Here is some information on encryption on Blackberry devices from the manufacturer's site. Nimur (talk) 04:02, 27 April 2011 (UTC)

Update: In frustration, I put everything back together this morning (media card, battery, cover) and clapped it a few times, very firmly, into the palm of my other hand. My suspicion is/was that it's simply a short in the connection with the screen. It flickered and miraculously I could make out "BlackBerry" on a startup screen. I slapped it a few more times, ran a quick errand, and when I came back, it seemed to be fine. (!) Now I'm e-mailing myself my photos as quickly as I can, realizing that I'm probably on borrowed time. I guess sometimes violence IS the answer. Kingsfold (Quack quack!) 12:06, 27 April 2011 (UTC)

If it's functioning, you should be able to plug it into a computer and suck the stuff off the memory card through Desktop Manager, unless it's prevented via IT Policy. Foofish (talk) 05:04, 28 April 2011 (UTC)

Samba share-level logging options

Is it possible for me to set different logging options for individual shares in samba? O'reilly tells me I expressly can't do this, however I wondered if there were any common workarounds or other tricks. Specifically I want extended logging on a particular share (actually a particular user, so if there was a way to do user level logging either through samba or with the system in general that could work as well) including any file actions (open, modify, delete, permission changes) but I don't want that level of detail on other shares. Shadowjams (talk) 05:59, 27 April 2011 (UTC)

How about setting up detailed logging for every share and every user; then use tail and/or grep to extract only those log messages you care about? You can further set up a cron job to delete the "complete" version of the log as often as you desire. Nimur (talk) 16:02, 27 April 2011 (UTC)

I'm afraid I may have to do something like that, which is a lot more trouble and also means writing and maintaining another script. Is there perhaps a way I can setup access logging within the OS itself? For example, if a sysadmin wanted to monitor the actions of shell users is there a way to log actions to the filesystem?

Another idea I considered is using preexec and postexec to manually change the log settings, but I'm not sure if that'd work (restarting samba in the midst of a share open could lead to some strange behavior)? Shadowjams (talk) 19:03, 27 April 2011 (UTC)

computer field

i am doing BCA from distance education of sikkim manipal university.i have to know that can i fill all the forms of government sector its certificate is valuable in every sector or not? give me some better way to find a better carrier. — Preceding unsigned comment added by Niraj kumar bca (talk • contribs) 09:38, 27 April 2011 (UTC)

If I understand you correctly you're doing a Bachelor of Computer Application and want to know if your degree will be valuable in all areas of government? Am I also correct that you only mean for jobs related to computing or more particularly computer applications? Because to state the obvious your degree is only likely to be of limited use if you want to become a government economist or a diplomat. You may still be able to get a job in say the Ministry of Finance (India) or the Ministry of External Affairs (India) but without significant on job training or further qualifications it's likely to be concentrated on the area of you degree. If my understanding is correct, then I would think most areas of government would probably have enough use of computers that there may be jobs available for people with a degree like yours but the number of jobs available is likely to vary. Nil Einne (talk) 01:25, 28 April 2011 (UTC)

SQLite on Ubuntu

Can somebody give me a step by step guide (or a link to a good one) on how to install SQLite on Ubuntu 10.10, to work with Java? I tried through Synaptic, but didn't work. Any method is fine as long as it works. Many thanks, 13:51, 27 April 2011 (UTC) —Preceding unsigned comment added by 122.255.9.203 (talk)

You almost certainly have the sqlite library (/usr/lib/libsqlite.so.0) already (if not, sudo apt-get install libsqlite0). Then you need a JDBC driver for it. This one, which includes instructions on how to use it, which worked fine for me. There are several other JDBC drivers for sqlite; I don't know if this one is better or worse than the others. I can't immediately see any in the normal Ubuntu repositories, however. -- Finlay McWalter ☻ Talk 14:47, 27 April 2011 (UTC)

What is downloading?

Recently I found following note on a webpage:

"Reproduction, including downloading of ARS works is prohibited by copyright laws and international conventions without the express written permission of Artists Rights Society (ARS), New York."

But, if I'm seeing the page, I will be automatically downloading it (even if it's only saved in the cache directory). Would pressing the save button of my browser make this different? Quest09 (talk) 16:38, 27 April 2011 (UTC)

This is text written by an idiot lawyer, or wannabe lawyer, who doesn't understand as well as you do that any viewing of a web page requires a download. My bet is that the idiot lawyer or wannabe lawyer means "downloading via Napster", and is hoping his or her legal notice will come in handy if they ever sue a torrent downloader. Not that the idiot lawyer or wannabe lawyer knows what "torrent" means. Of course if they put stuff on their publicly accessible web site there's implied consent for any visitor to view the page at will with no legal consequences. Saving the page would count as a fair use in the US almost certainly but I'm not aware of any case law that enshrines this. Comet Tuttle (talk) 16:48, 27 April 2011 (UTC)

IANAL, so this is just my own personal feeling, but I tend to think that if I get to view something on the net in the first place, I have the full right to save it as well. Distributing it further is a whole different kettle of fish though, and isn't generally allowed without permission. JIP | Talk 18:05, 27 April 2011 (UTC)

This is actually a bit ambiguous. As our article on uploading and downloading states, "The use of the terms uploading and downloading often imply that the data sent or received is to be stored permanently, or at least stored more than temporarily.". Looie496 (talk) 18:12, 27 April 2011 (UTC)

Copyright law doesn't usually require that notice anymore (although it helps for a variety of reasons) and even without it, copying works is still covered by copyright law. What makes most of what's legitimately offered on the internet non infringing is the fact that the owner offered it up to the public at large. That's a sort of implied license, which does not require a writing in most circumstances.

It's hard to comment on this particular case without broader context, but in general when someone offers something up on a public web page they're giving you an implied license to, at the least, view it (including having it saved in your browser's cache). They're probably not giving you a license to go publish a book with the same content. How you determine what's in-between is where the "idiot lawyers" come into play. That all depends on the circumstances and context. Shadowjams (talk) 19:08, 27 April 2011 (UTC)

Verizon iPhone in China

Hi guys,
I'm an American going to China next year. I want to get an iPhone, but I'm unsure how best to go about it. I'm on Verizon (which doesn't have SIM cards, right?), and I'm hoping for a phone that will work both here and in China (so that I don't have to switch phones if I switch countries).
So the question is, what are my options for this? Should I buy an AT&T iPhone 4 (can I just buy the phone, without a plan?) and then jailbreak it/switch SIM cards? Should I stick with Verizon and just switch plans when I switch back and forth between countries? What's the cheapest/most effective way to get effectively full use (3G, cheap intranational calling plan, etc) out of my phone in both countries?
Thanks so much,
140.247.157.117 (talk) 21:09, 27 April 2011 (UTC)

My friend is going blind and needs help with her computer

My friend has a condition in which her eyesight has degraded and needs assistance in interacting with Windows. She refuses to budge on the switch to open source technology, so my ability to help her is exceptionally limited. She already uses ZoomText, and has an exceptionally large computer monitor.

The immediate problems I've run into: The Norton virus is stuck on her computer. What software do I need to remove Norton? What open source antivirus is best for Windows? The high contrast setting doesn't allow her to see certain hyperlinks (blue on white is hard to see). The automatic updates are all interactive (they keep asking her before doing anything, and are not automatic at all). ZoomText can't seem run as a Daemon process. Windows in general does random unexpected things (As expected).

Please note that I understand how to solve all these problems in the Gnome environment, with Compiz Fusion; As I stated, she doesn't want to switch to open source tech. I would also like to state that I will remove any responses that are off subject (i.e. "what's her condition," or "you spelled 'bananas' wrong.").

Please cite any information sources you can. Any and all help is appreciated. --67.173.155.123 (talk) 21:59, 27 April 2011 (UTC)

Learn how to use the accessibility features of Windows 7, from Microsoft. Nimur (talk) 22:17, 27 April 2011 (UTC)

Personal taste only, but fwiw I tend to use the AVG Free anti-virus product [7]; it's not open source but it is licensed for free use by individuals. Unlike any Norton experiences I've had (admittedly in the very dim past), it tends to get on with its job with the minimum of fuss. I'd have expected that there would be an Add/Remove Programme option in Control Panel that would allow you to remove Norton. There is a Norton removal tool [8] for older versions of Norton. The standard assistive technology products in use where I work, again fwiw, are JAWS [9] as a screen reader, Dragon Dictate for speach entry, and Zoomtext. I forget what the braille output application's name is. Oh; and texthelp [10] billed as being useful for dyslexics and those with mild visual impairments. As to Zoomtext, as possibly per Nimur's pointer, I noticed recently (by toggling it on & not being fully in control of getting it to go away) a built in screen magnifier in newer versions of Windows. Possily this would be a substitute for zoomtext. Windows doesn't (to my knowledge) do daemons as linux does, but it'll be possible to configure zoomtext to start when the machine boots, if only by putting the app in the start-up menu option. You spelled banana correctly, but my guess is that your friend wants your help more than she wants the whole thing to become a venue for refighting the free versus propritary software battle. --Tagishsimon (talk) 22:48, 27 April 2011 (UTC)

If you can get it to work on Windows (apparently some graphics devices are unsupported, see README), xcalib could be useful for just inverting the colors, instead of bothering with any of the 'contrast' themes. Can make looking at a screen much easier on the eyes. ¦ Reisio (talk) 00:46, 28 April 2011 (UTC)

Zoom Text has options for changing colors, so try those out to see if you can find a good combo for her. You might also consider dual monitors, as one at normal magnification and the other zoomed in is a good way to work. Also, don't forget to change the screen resolution to the minimum in the normal Windows way, too (Start + Control Panel + Display + Settings Tab). That will help her when Zoom Text is off. And her medical condition does matter, for at least 2 reasons:

1) For some medical problems, like macular degeneration, which produces multiple blind spots, bigger isn't necessarily better, since a larger word is likely to encounter more blind spots.

2) A rapidly deteriorating condition would indicate that she needs to move to a screen reader, while a gradual deterioration may allow her to continue with screen magnifiers, etc. StuRat (talk) 03:10, 28 April 2011 (UTC)

I'm a screen reader user. I've never used screen magnifiers, but I can try to help. Here's a page with a link to ZoomText's user guide, in case it's of any use. It says that ZoomText can be started automatically when Windows starts through the preferences dialogue, but it doesn't seem to say whether it starts as a service, a rough equivalent to daemons on Linux. Have you considered asking your friend to try Magic, another major screen magnifier for Windows? I agree with all the points above ... especially about replacing Norton with something like AVG! Graham87 03:55, 28 April 2011 (UTC)

April 28

Registry Repair

Is there registry repair freeware out there? Apparently, I have 4442 registry errors. Plasmic Physics (talk) 08:45, 28 April 2011 (UTC)

What persuades you that you have 4442 registry errors? Beware of scam websites that resemble Windows programs which report virus infections and registry corruption, and offer to "fix" it. -- Finlay McWalter ☻ Talk 09:32, 28 April 2011 (UTC)

I used the program advocated on Wiki-Errors. Finding the errors is free, but having them fixed is not. Plasmic Physics (talk) 10:31, 28 April 2011 (UTC)

Most registry errors are minor. I use CCleaner, other recommendations are at TechSupportAlert.com. ---— Gadget850 (Ed) ^talk 10:41, 28 April 2011 (UTC)