Haplogroup Q (Y-DNA)

From Wikipedia, the free encyclopedia
Jump to: navigation, search
Haplogroup Q

Haplogroup Q (Y-DNA).PNG

Possible time of origin 17,000 to 22,000 years ago[1][2]
Possible place of origin Central Asia,[3] the Indian Subcontinent,[4] Siberia[5]
Ancestor P
Descendants Q1 (P36.2), Q*
Defining mutations M242
Highest frequencies Indigenous Americans, Kets, and Selkups

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Contents

[edit] Origins

Haplogroup Q is one of the two branches of haplogroup P (M45). Haplogroup Q is believed to have arisen in Central Asia or South Asia approximately 17,000 to 22,000 years ago.[6] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of M242, P36.2, and MEH2 as defining mutations.

This haplogroup has many diverse haplotypes despite its low frequency among most populations outside of the Americas. There also are over a dozen subclades that have been sampled and identified in modern populations.

[edit] Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

[edit] Subclades

In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

[edit] Haplogroup and Subclade Defining SNPs

Academic Name RS ID Position Change YCC 2008 rev ISOGG 2008 Parent Clade Publications Notes
P48 - 13006660-13006661 –>T Q1a4 Q1a4 MEH2 This is now considered a private SNP. The positive sample from Karafet 2008 was retested at the Family Tree DNA GRC and was found to be negative.
L57 rs34864948 14083496 A/G - - P36.2
L191 - 2947379 A>del - - {M346, L56, L57} The L191 SNP was found while testing a sample for M346 at the Family Tree DNA GRC. This SNP may represent a native Mexican lineage. L191 may represent single family or limited population group. Additional testing and a published haplotype or haplotypes are needed.
L213 rs34549365 8295033 C>G - - {M346, L56, L57}
L245 - 5735090 C>G - - {M378, L214, L215}
M346 - 2947156 C>G Q1a3 Q1a3 MEH2
L215 rs34601266 13399368 C>T - - P36.2
L55 rs35768544 17922729 G>A - - {M346, L56, L57}
L53 rs34724285 20101684 G>A - - {M346, L56, L57}
L54 rs34954951 21702170 G>A - - {M346, L56, L57}
L232 - 16025489 G>A - - M242 The SNP was found during WTY testing at the Family Tree DNA GRC.
L56 rs34703625 8208869 G>A - - P36.2
P36.2 - 13006449 G>T Q1 Q1 M242
MEH2 rs4252209 4985637 G>T Q1a Q1a P36.2
L214 rs34694026 20365995 T>C - - P36.2
M3 rs3894 17605757 C>T Q1a3a Q1a3a {L53, L54, L55}
M194 rs2032677 13523944 T>C Q1a3a2 Q1a3a2 M3
P292 rs13447374 13540161 –>G Q1a3a3 Q1a3a3 M3
P106 - 13932316 G>A Q1a3a3 Q1a3a3 M3
M19 rs3910 20192619 T>A Q1a3a1 Q1a3a1 M3
M199 rs2032589 13540505-13540504 –>G Q1a3a3 Q1a3a3 M3
M323 rs13447377 20327106 C>T Q1a6 Q1a6 M346
P89.1 - 13359859 G>T Q1a5 Q1a5 MEH2 Limited research indicates that this may be a private SNP. The P89 mutation is also found in R1b.
M265, N14 rs3212294 13540044 C>A Q1a1 Q1a1 MEH2
M242 rs8179021 13527976 C>T Q Q P SNPs
M378 - 13536901 A>G Q1b Q1b P36.2
M25 - 20326052 G>C Q1a2 Q1a2 P36.2
M143 - 20349206 G>T Q1a2 Q1a2 P36.2
M120 - 20366782 T>C Q1a1 Q1a1 P36.2

[edit] Phylogenetic Variants

The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR DYS435 with a value of 12.[4] Karafet 2008, dismissed it as unsuitable by not including it on the Y-Chromosome Consortium tree.[6] It has also been determined to be unsuitable for inclusion on the ISOGG Y-DNA tree.[7] Further, analysis of STR based haplotypes from Sharma 2007 indicates that the DYS435=12 variant, using online haplogroup prediction tools, may occur in multiple branches of the Q tree.

[edit] Phylogenetic Trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

[edit] The Genomic Research Center Draft Tree

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q.

  • P
    • Q M242
      • P36.2, L232, L273, L274
        • MEH2, L472, L528
          • M120, N14, M265
          • M25, M143
            • L697.2, L712, L713, L714, L715, L716, M365.3
          • M346, L56, L57, L474
            • L53, L54, L55, L213, L331
              • M3, L892
                • M19
                • M194
                • M199, P106, P292
                • PAGES00104, PAGES00126
                • PAGES00131
                • L663
                • SA01
                • L766, L767
                • L883, L884, L885, L886, L887
                • L888, L889, L890, L891
              • L191
              • L330, L334
                • L329, L332, L333
              • L400, L401
              • L456
              • L568, L569, L570, L571
                • L567
                • L619.1
              • L804, L805
                • L807
            • M323
            • L527, L529, L639
            • L717, L718
          • P89.1
        • L275, L314
          • M378, L214, L215
            • L245
              • L272.1
              • L315
              • L619.2
            • L301
            • L327

[edit] The Y-Chromosome Consortium tree

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[6] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[8]

  • P
    • Q M242
      • Q1 P36.2
        • Q1a MEH2
          • Q1a1 M120, N14, M265
          • Q1a2 M25, M143
          • Q1a3 L213, L53, L54, L55
            • Q1a3a L56, L57, M346
              • Q1a3a1 M3
                • Q1a3a1a M19
                • Q1a3a1b M194
                • Q1a3a1c M199, P106, P292
              • Q1a3a2 L191
            • Q1a3b M323
          • Q1a4 P89.1
        • Q1b L275
          • Q1b1 L214, L215, M378
            • Q1b1a L272.1

[edit] The 2011 ISOGG Tree

The subclades of Haplogroup Q with their defining mutation(s), according to the 2011 ISOGG tree are provided below.

  • Q M242
    • Q1 P36.2, L232, L273, L274
      • Q1a MEH2
        • Q1a1 M120, M265/N14
        • Q1a2 M25, M143
        • Q1a3 L56, L57, M346, L528
          • Q1a3a L53, L54, L55, L213, L331
            • Q1a3a1 M3
              • Q1a3a1a M19
              • Q1a3a1b M194
              • Q1a3a1c M199, P106, P292
            • Q1a3a2 L191
            • Q1a3a3 L330, L334
              • Q1a3a3a L329, L332, L333
          • Q1a3b M323
          • Q1a3c L527, L529
      • Q1b L275, L314
        • Q1b1 M378/Page100, L214, L215/Page82
          • Q1b1a L245
            • Q1b1a1 L272.1

[edit] Distribution

Haplogroup Q may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, North Africa, East Asia, South Asia, West Asia, and in Europe.

[edit] The Americas

Haplogroup Q is the predominant Y-chromosome haplogroup in indigenous peoples of the Americas.

Approximately 20,000 to 15,000 years ago, a group migrated from Asia into the Americas by crossing the Bering Strait.[2] Many of the men in this group must have belonged to haplogroup Q for it now accounts for the majority of non-European haplogroups in indigenous peoples of the Americas.

Indeed, haplogroup Q has been found in approximately 94% of Indigenous peoples of South America[9] and detected in Na-Dené speakers at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.[10]

In more modern population groups from the Americas, all Q samples tested for M346 have been positive. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).[2] Many members of haplogroup Q in the Americas belong to the Q-M3 subclade.[5]

However, a 4000-year-old Saqqaq individual belonging to Q-MEH2 haplogroup has been documented.[11]

[edit] Asia

Likely due to its origin in Central Asia, haplogroup Q may be found throughout Asia.[2] It has been reported that Q is found in the Altai people,[12] India,[13] Tibet,[14] Pakistan,[13] China,[15][16] Mongolia,[17] Tuvans,[18] and Uyghurs.[17]

[edit] East Asia

To the east, haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians.[12] It is found in 16% of Tuvans.[18]

The frequency of Q in northern China is about 4%, with many Chinese samples of haplogroup Q belonging to the subclade Q-M120.[15][16] Haplogroup Q is found in approximately 3% of males in Tibet[14] and Mongolia.[17] It is also found in 3% of Uyghurs.[17]

The highest frequencies of Q in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.

[edit] South Asia

Some examples of Q* (negative for known subclades) have been reported in the Indian subcontinent in low frequency.[4] The same studies have found Q-M346* (negative for known subclades) restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q-M346. However, these are from studies where all current branches of the Q tree have not been tested.

The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.

[edit] West Asia

Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q belong primarily to the subclade Q-M25.[19]

In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)[20] or 3.4% (6/176).[21]

Approximately 2.5% of males in Saudi Arabia belong to haplogroup Q.[22]

According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q.[23] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.

Haplogroup Q has also been found in Algerians, Arabians, Syrians, Lebanese[24] and the United Arab Emirates.,[25]

[edit] Europe

The frequency of haplogroup Q in Norway and Sweden is about 3%, while 2,5% of Slovak males are in haplogroup Q.

To the south east, approximately 2% of males in Turkey,[26] In a study by Gokcumen it was found that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.[27] Further, the Q-M25 subclade has been found in Turkey[26]

Q-M346 is found among the Khanty.[28]

[edit] Population Frequencies from Studies

Population Paper N Percentage SNPs Tested
Austro-Asiatic (Khasi-Khmuic) Reddy 2009 353 5.40 P-M45(xM173) §
Austro-Asiatic (Mundari) Reddy 2009 64 10.90 P-M45(xM173) §
Nicobarese (Mon-Khmer) Reddy 2009 11 0.00 P-M45(xM173) §
Austro-Asiatic (Southeast Asia) Reddy 2009 257 1.60 P-M45(xM173) §
Garo (Tibeto-Burman) Reddy 2009 71 1.40 P-M45(xM173) §
Tibeto-Burman (India) Reddy 2009 226 3.10 P-M45(xM173) §
Tibeto-Burman (East Asia) Reddy 2009 214 0.00 P-M45(xM173) §
Indo-European (Eastern India) Reddy 2009 54 18.50 P-M45(xM173) §
Southern Talysh Iran Nasidze 2009 50 4.00 P-M45(xM124,xM173)
Northern Talysh Azerbaijan Nasidze 2009 40 5.00 P-M45(xM124,xM173)
Mazandarana Iran Nasidze 2009 50 4.00 P-M45(xM124,xM173)
Gilakia Iran Nasidze 2009 50 0.00 P-M45(xM124,xM173)
Iranians (Tehran) Iran Nasidze 2004 80 4.00 P-M45(xM124,xM173)
Iranians (Isfahan) Iran Nasidze 2004 50 6.00 P-M45(xM124,xM173)
Bakhtiari Iran Nasidze 2008 53 2.00 P-M45(xM124,xM173)
Iranian Arabs Iran Nasidze 2008 47 2.00 P-M45(xM124,xM173)
North Iran Iran Regueiro 2006 33 9.00 P-M45(xM124,xM173)
South Iran Iran Regueiro 2006 117 3.00 P-M45(xM124,xM173)
Georgians South Caucacus Nasidze and Stoneking 2001 77 3.00 P-M45(xM124,xM173)
Armenians South Caucacus Nasidze and Stoneking 2001 100 2.00 P-M45(xM124,xM173)
Azerbaijanis South Caucacus Nasidze and Stoneking 2001 72 0.00 P-M45(xM124,xM173)

§ These may include members of haplogroup R2.

[edit] Subclade Distribution

[edit] See also


Evolutionary tree of Human Y-chromosome DNA (Y-DNA) haplogroups

most recent common Y-ancestor
A
A1b A1a-T
A1a A2-T
A2 A3 BT
B CT
DE CF
D E C F
G H IJK
IJ K
I J LT K(xLT)
L T M NO P S
O N Q R

Y-DNA by populations · Famous Y-DNA haplotypes

[edit] External links

[edit] References

[edit] Citations

  1. ^ Fagundes, Nelson J.R.; Ricardo Kanitz, Roberta Eckert, Ana C.S. Valls, Mauricio R. Bogo, Francisco M. Salzano, David Glenn Smith, Wilson A. Silva, Marco A. Zago, Andrea K. Ribeiro-dos-Santos, Sidney E.B. Santos, Maria Luiza Petzl-Erler, and Sandro L.Bonatto (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. http://www.familytreedna.com/pdf/Fagundes-et-al.pdf. Retrieved 2009-11-19. "Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages" 
  2. ^ a b c d Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. http://mbe.oxfordjournals.org/cgi/reprint/21/1/164.pdf. 
  3. ^ Y-DNA Haplogroup Q and its Subclades - 2010
  4. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2258157. 
  5. ^ a b c "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. http://www.genebase.com/tutorial/item.php?tuId=16. Retrieved 2009-11-21. "Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present" 
  6. ^ a b c Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2336805. 
  7. ^ Private communication reported between Charles Moore, of ISOGG, and Rebekah Adele Canada, of the FTDNA Y-DNA Q Project.
  8. ^ "Y-DNA Haplotree". https://www.familytreedna.com/y-dna-haplotree.aspx.  Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  9. ^ Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics 73 (3): 524. doi:10.1086/377588. PMC 1180678. PMID 12900798. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1180678. 
  10. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. http://www.genetree.com/education/q. Retrieved 2010-01-30. 
  11. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. http://www.nature.com/nature/journal/v463/n7282/full/nature08835.html. Retrieved 2010-02-11. 
  12. ^ a b V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  13. ^ a b c The Y Chromosome Consortium 2008
  14. ^ a b c d Gayden T, Cadenas AM, Regueiro M, et al (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1852741. 
  15. ^ a b c Wen B, Li H, Lu D, et al (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. http://www.nature.com/nature/journal/v431/n7006/abs/nature02878.html. "Supplementary Table 2: NRY haplogroup distribution in Han populations" 
  16. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912. 
  17. ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082. 
  18. ^ a b Pakendorf Brigitte, Novgorodov Innokentij N., Osakovskij Vladimir L., Danilova Al’Bina P., Protod’Jakonov Artur P., Stoneking Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541. 
  19. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078. 
  20. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2588664. 
  21. ^ a b c d e Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
  22. ^ a b Abu-Amero Khaled K., Hellani Ali, Gonzalez Ana M., Larruga Jose M, Cabrera Vicente M, Underhill Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics 10: 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2759955. 
  23. ^ a b http://www.springerlink.com/content/xvj2jwclptvrvmer/
  24. ^ Zalloua PA, Xue Y, Khalife J, et al (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2427286. 
  25. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816. 
  26. ^ a b c Cinnioğlu C, King R, Kivisild T, et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  27. ^ . ISBN 9780549809661. 
  28. ^ Mirabal S, Regueiro M, Cadenas AM, et al (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2986641. 
  29. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663. 
  30. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R, et al (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=56946. "Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region" 
  31. ^ I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," Annals of Human Genetics Volume 71 Issue 4, Pages 480 - 495 (July 2007).
  32. ^ Zalloua Pierre A., Xue Y, Khalife J, Makhoul N, Debiane L, Platt DE, Royyuru AK, Herrera RJ et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2427286. 
  33. ^ Bortolini MC, Salzano FM, Thomas MG, et al (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798. http://www.ucl.ac.uk/tcga/tcgapdf/Bortolini-AJHG-03-YAmer.pdf. 
  34. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852.  Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
  35. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606. 
  36. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M. et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2668061. 

[edit] Bibliography

Personal tools
Namespaces
Variants
Actions
Navigation
Interaction
Toolbox
Print/export
Languages