Haplogroup Q (Y-DNA)

From Wikipedia, the free encyclopedia

Jump to: navigation, search
Haplogroup Q
Time of origin 15,000 to 20,000 BC
Place of origin Ural or Siberia
Ancestor P
Defining mutations M242
Highest frequencies Native Americans, Kets & Selkups

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.

This haplogroup contains the patrilineal ancestors of many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[1] This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

Contents

[edit] Origins

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 15,000 years ago. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).

[edit] Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent, though in low frequency.[2] A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent. However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) .[2] Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration,[2] Q5 may be positioned as Q1a7.

[edit] Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

[edit] Distribution

In the Old World, the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the west, the Iranian plateau in the south, and northern China in the east. It has also been detected in Yemenite Jews, Algerians, Lebanese, and Turks. The frequency of Q in Norway and northern China is about 4%, with Chinese samples of haplogroup Q belonging almost exclusively to the subclade Q1a1-M120.[3] In Iran, the frequency runs between approximately 2.6% in the south and 9.1% in the north; Iranian samples of haplogroup Q belong almost exclusively to the subclade Q1a2-M25.[4] In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)[5] or 3.4% (6/176).[6] Haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians,[7] 16% of Tuvans, and 3% of Uyghurs,[8] all of which are Turkic peoples inhabiting parts of Central Asia and southern Siberia. Haplogroup Q is found in approximately 3% of males in Tibet[9] and Mongolia,[8] and approximately 2% of males in Turkey,[10] Lebanon,[11] and the United Arab Emirates.[12] Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.

[edit] Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in the ISOGG 2008 tree because it is a value for an STR. This low frequency value been found as a novel Q lineage (Q5) in indian populations.[2]

The 2008 ISOGG tree

[edit] References

  1. ^ Zegura SL, Karafet TM, Zhivotovsky LA, Hammer MF (January 2004). "High-resolution SNPs and microsatellite haplotypes point to a single, recent entry of Native American Y chromosomes into the Americas". Mol. Biol. Evol. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. http://mbe.oxfordjournals.org/cgi/reprint/21/1/164.pdf. 
  2. ^ a b c d Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMID 18021436. 
  3. ^ a b Wen B, Li H, Lu D, et al (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. http://www.nature.com/nature/journal/v431/n7006/abs/nature02878.html. "Supplementary Table 2: NRY haplogroup distribution in Han populations". 
  4. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078. 
  5. ^ Sadaf Firasat, Shagufta Khaliq, Aisha Mohyuddin, Myrto Papaioannou, Chris Tyler-Smith, Peter A Underhill and Qasim Ayub: "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan." European Journal of Human Genetics (2007) Vol. 15, p. 121–126.
  6. ^ a b c d e Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
  7. ^ V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  8. ^ a b Hammer et al., "Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes," © The Japan Society of Human Genetics, Springer-Verlag (2005)
  9. ^ a b c Gayden T, Cadenas AM, Regueiro M, et al (May 2007). "The Himalayas as a directional barrier to gene flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMID 17436243. 
  10. ^ a b Cinnioğlu C, King R, Kivisild T, et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  11. ^ Zalloua PA, Xue Y, Khalife J, et al (April 2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMID 18374297. 
  12. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816. 
  13. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R, et al (August 2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMID 11526236. "Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region". 
  14. ^ Pierre A. Zalloua et al., "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events," American Journal of Human Genetics 82, 873–882, April 2008.
  15. ^ Mirabal S, Regueiro M, Cadenas AM, et al (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet.. doi:10.1038/ejhg.2009.6. PMID 19259129. 
  16. ^ Bortolini MC, Salzano FM, Thomas MG, et al (September 2003). "Y-chromosome evidence for differing ancient demographic histories in the Americas". Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMID 12900798. PMC: 1180678. http://www.ucl.ac.uk/tcga/tcgapdf/Bortolini-AJHG-03-YAmer.pdf. 
  17. ^ Peidong Shen, Tal Lavi, Toomas Kivisild, Vivian Chou, Deniz Sengun, Dov Gefel, Issac Shpirer, Eilon Woolf, Jossi Hillel, Marcus W. Feldman, and Peter J. Oefner, "Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation," Human Mutation 24:248-260 (2004). Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
  18. ^ http://www.familytreedna.com/public/AshinaRoyalDynasty/default.aspx?section=results

[edit] See also

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L M NOP S T
|
NO P
| |
N O Q R

[edit] External links

Personal tools