Haplogroup Q-M242

From Wikipedia, the free encyclopedia
  (Redirected from Haplogroup Q (Y-DNA))
Jump to: navigation, search
Haplogroup Q

Haplogroup Q (Y-DNA).PNG

Possible time of origin 17,000 to 22,000 years ago[1][2]
Possible place of origin Central Asia,[3] the Indian Subcontinent,[4] Siberia[5]
Ancestor P
Descendants Q-P36.2 (P36.2)
Defining mutations M242
Highest frequencies Kets and Selkups

In human population genetics, haplogroups define the major lineages of direct paternal (male) lines back to a shared common ancestor in Africa. Haplogroup Q-M242 is a Y-chromosome DNA haplogroup.

Contents

Origins [edit]

Haplogroup Q-M242 is one of the two branches of haplogroup P-M45. Haplogroup Q-M242 is believed to have arisen in North Asia approximately 17,000 to 22,000 years ago.[6] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of the M242, P36.2, and MEH2 SNPs as defining mutations.

This haplogroup has many diverse haplotypes. There also are over a dozen subclades that have been sampled and identified in modern populations.

Technical specification of mutation [edit]

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades [edit]

In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic Trees [edit]

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center Draft Tree [edit]

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q-M242. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[7]

  • P
    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1

The Y-Chromosome Consortium tree [edit]

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[6] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[8] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The 2011 ISOGG Tree [edit]

The subclades of Haplogroup Q-M242 with their defining mutation(s), according to the 2011 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

  • Q M242
    • Q-P36.2 P36.2, L232, L273, L274
      • Q-MEH2 MEH2
        • Q-M120 M120, M265/N14
        • Q-M25 M25, M143
        • Q-M346 L56, L57, M346, L528
      • Q-L275 L275, L314
        • Q-M378 M378/Page100, L214, L215/Page82

Phylogenetic Variants [edit]

The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR DYS435 with a value of 12.[4] Karafet 2008, dismissed it as unsuitable by not including it on the Y-Chromosome Consortium tree.[6] It has also been determined to be unsuitable for inclusion on the ISOGG Y-DNA tree.[9] Further, analysis of STR based haplotypes from Sharma 2007 indicates that the DYS435=12 variant, using online haplogroup prediction tools, may occur in multiple branches of the Q-M242 tree.

Distribution [edit]

Haplogroup Q-M242 may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, North Africa, East Asia, South Asia, West Asia, and in Europe.

The Americas [edit]

Several branches of haplogroup Q-M242 are part of the pre-Columbian male lineages in the predominant Y-chromosome haplogroup in indigenous peoples of the Americas. They were part of groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups had few founders, but they must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In Canada, two other lineages have been found. These are Q-P89.1 and Q-NWT01. They may not be from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of shifts in a small founder population over time. However, Q-M242 came to dominate the paternal lineages in the Americas. Indeed, haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of South America[10] and detected in Na-Dené speakers at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.[11]

However, a 4000-year-old Saqqaq individual belonging to Q-MEH2 haplogroup has been documented.[12]

Asia [edit]

Q-M242 origininated in Asia, and is widely distributed there.[2] It has been reported that Q-M242 is found in the Altai people,[13] India,[14] Tibet,[15] Pakistan,[14] China,[16][17] Mongolia,[18] Tuvans,[19] and Uyghurs.[18] It was found in 9 out of 49 specimens (18%) in a Y-Haplogroup study of Pashtuns in Kabul the Capital of Afghanistan.[20]

North Asia [edit]

To the east, haplogroup Q-M242 has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians.[13] It is found in 16% of Tuvans.[19] They are also found in several prehistoric sites in Northwest China and probably related to Xia Dynasty and Xiongnu.[21]

The frequency of Q-M242 in northern China is about 4%, with many Chinese samples of haplogroup Q-M242 belonging to the subclade Q-M120.[16][17] Haplogroup Q-M242 is found in approximately 3% of males in Tibet[15] and Mongolia.[18] It is also found in 3% of Uyghurs.[18]

The highest frequencies of Q-M242 in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.

Q-M346 is found among the Khanty.[22]

South Asia [edit]

Some examples of Q-M242 (negative for tested subclades) have been reported in the Indian subcontinent in low frequency.[4] The same studies have found Q-M346* (negative for known subclades) restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q-M242 to the Indian subcontinent followed by an autochthonous differentiation to Q-M346. However, these are from studies where all current branches of the Q-M242 tree have not been tested.

The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.

Southwest Asia [edit]

Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q-M242 in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q-M242 belong primarily to the subclade Q-M25.[23]

In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[24] or 3.4% (6/176).[25]

Approximately 2.5% of males in Saudi Arabia belong to haplogroup Q.[26]

According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q.[27] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.

Haplogroup Q-M242 has also been found in Algerians, Arabians, Syrians, Lebanese[28] and the United Arab Emirates.,[29]

Approximately 2% of males in Turkey,[30] In a study by Gokcumen it was found that among Turks that belong to the Afshar tribe haplogroup Q-M242 is seen with a prevalence of 13%.[31] Further, the Q-M25 subclade has been found in Turkey[30]

Europe [edit]

The frequency of haplogroup Q-M242 in Norway and Sweden is about 3%. It is believed that almost all of these are either Q-L527 or Q-L804. Around 2.5% of Slovak males are in haplogroup Q-M242.

Subclade Distribution [edit]

See also [edit]

Populations [edit]

Genetics [edit]

Y-DNA Q-M242 Subclades [edit]

Y-DNA Backbone Tree [edit]

Evolutionary tree of human Y-chromosome DNA (Y-DNA) haplogroups
MRC Y-ancestor
A0 A1
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
G H IJK
IJ K
I J LT K(xLT)
L T M NO P S
N O Q R

External links [edit]

References [edit]

Citations [edit]

  1. ^ Fagundes, Nelson J.R.; Ricardo Kanitz, Roberta Eckert, Ana C.S. Valls, Mauricio R. Bogo, Francisco M. Salzano, David Glenn Smith, Wilson A. Silva, Marco A. Zago, Andrea K. Ribeiro-dos-Santos, Sidney E.B. Santos, Maria Luiza Petzl-Erler, and Sandro L.Bonatto (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19. "Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages" 
  2. ^ a b c Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. 
  3. ^ Y-DNA Haplogroup Q and its Subclades - 2010
  4. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436. 
  5. ^ a b "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21. "Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present" 
  6. ^ a b c Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274. 
  7. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Retrieved 2012. 
  8. ^ "Y-DNA Haplotree".  Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  9. ^ Private communication reported between Charles Moore, of ISOGG, and Rebekah Adele Canada, of the FTDNA Y-DNA Q Project.
  10. ^ Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798. 
  11. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30. 
  12. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11. 
  13. ^ a b V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
  14. ^ a b c The Y Chromosome Consortium 2008
  15. ^ a b c d Gayden T, Cadenas AM, Regueiro M, et al (May 2007). "The Himalayas as a Directional Barrier to Gene Flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243. 
  16. ^ a b c Wen B, Li H, Lu D, et al (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. "Supplementary Table 2: NRY haplogroup distribution in Han populations" 
  17. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912. 
  18. ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082. 
  19. ^ a b Pakendorf, Brigitte, Novgorodov, Innokentij N., Osakovskij, Vladimir L., Danilova, Al’Bina P., Protod’Jakonov, Artur P., Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541. 
  20. ^ a b Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552. 
  21. ^ 中国北方古代Y-DNA研究的分析与历史时期汉族Y-DNA变迁 - 新浪博客
  22. ^ Mirabal S, Regueiro M, Cadenas AM, et al (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129. 
  23. ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078. 
  24. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675. 
  25. ^ a b c d e Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-; Chow, Emiliane T.; Lin, Alice A. et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics 78 (2): 202–221. 
  26. ^ a b Abu-Amero, Khaled K., Hellani, Ali, Gonzalez, Ana M., Larruga, Jose M, Cabrera, Vicente M, Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics 10: 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609. 
  27. ^ a b http://www.springerlink.com/content/xvj2jwclptvrvmer/
  28. ^ Zalloua PA, Xue Y, Khalife J, et al (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. 
  29. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816. 
  30. ^ a b c Cinnioğlu C, King R, Kivisild T, et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. 
  31. ^ . ISBN 978-0-549-80966-1.  Missing or empty |title= (help)
  32. ^ Grugni, Viola et al. (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981. 
  33. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663. 
  34. ^ a b Wells RS, Yuldasheva N, Ruzibakiev R, et al (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. "Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region" 
  35. ^ Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics 71 (4): 480–495. 
  36. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y et al. (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE 6 (8): e24282. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623. 
  37. ^ Zalloua, Pierre A., Xue, Y, Khalife, J, Makhoul, N, Debiane, L, Platt, DE, Royyuru, AK, Herrera, RJ et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297. 
  38. ^ Bortolini MC, Salzano FM, Thomas MG, et al (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798. 
  39. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852.  Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  40. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606. 
  41. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M. et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982. 

Bibliography [edit]