Welcome to the computing section
of the Wikipedia reference desk.

Select a section:

WP:RD/C

Want a faster answer?

Main page: Help searching Wikipedia

How can I get my question answered?

Select the section of the desk that best fits the general topic of your question (see the navigation column to the right).
Post your question to only one section, providing a short header that gives the topic of your question.
Type '~~~~' (that is, four tilde characters) at the end – this signs and dates your contribution so we know who wrote what and when.
Don't post personal contact information – it will be removed. Any answers will be provided here.
Please be as specific as possible, and include all relevant context – the usefulness of answers may depend on the context.
Note:
- We don't answer (and may remove) questions that require medical diagnosis or legal advice.
- We don't answer requests for opinions, predictions or debate.
- We don't do your homework for you, though we'll help you past the stuck point.
- We don't conduct original research or provide a free source of ideas, but we'll help you find information you need.

Ready? Ask a new question!

How do I answer a question?

Main page: Wikipedia:Reference desk/Guidelines

The best answers address the question directly, and back up facts with wikilinks and links to sources. Do not edit others' comments and do not give any medical or legal advice.

May 31

Partitioning NTFS Drive

Hi, I've been running XP on a 350GB hard drive for several years, but I'm trying to partition it and install Ubuntu. I can't seem to reduce the XP partition, however, and after some googling, it appears many people have trouble with it. After several defrags and running chkdsk /f, I've gotten a fairly large (~60 GB) contiguous segment of free disk space, but it isn't at the end of the drive -- there are some files after it. Here's what it looks like: http://i430.photobucket.com/albums/qq22/rbedi100/Defrag_screenshot.jpg So, does the disk space I want to cut off of the XP Partition necessarily have to be at the physical end of the drive, or can it be more in the middle? Thanks! Rishi.bedi (talk) 00:22, 31 May 2010 (UTC)[reply]

It needs to be somewhere where it doesn't separate the NTFS logical section into 2 sections. What I did when I installed Ubuntu was let Ubuntu handle the partitioning (might have done it through the Live CD feature so nothing on the HDD was mounted). Gparted was able to shrink the NTFS (running Vista) and clear a space for Ubuntu. Later on, it let me shrink the Ubuntu volume and add it back to the Vista partition. Be warned though, it's not 100% safe, and there's a chance of losing data. Better get to backing up. --Wirbelwindヴィルヴェルヴィント (talk) 00:33, 31 May 2010 (UTC)[reply]

Have you considered running Ubuntu on a virtual machine within Windows? This will negate any risk to your data, although depending on your hardware may or may not be an ideal solution. -Amordea (talk) 02:05, 31 May 2010 (UTC)[reply]

Or wubi? F (talk) 06:39, 31 May 2010 (UTC)[reply]

I would recommend the phenomenal disk management utility Gparted, which is a live CD that can do these partition operations for you. I have found it able to resize/move partitions that other utilities could not, and here's a link to find the [1]. As always, I cannot stress enough, when attempting a partition resize/move, BACKUP BACKUP BACKUP! --rocketrye12^{talk/contribs} 14:32, 31 May 2010 (UTC)[reply]

Thanks, everyone -- I'm running a VM right now, but I need to install it on the HD now. I think I'm going to go ahead and use Gparted - Wirbelwind, if you used Gparted, what did you use the Ubuntu live CD for, re. partitioning? Rishi.bedi (talk) 23:29, 31 May 2010 (UTC)[reply]

I think I used the CD to run GParted, like Rocketrye12 also mentioned. --Wirbelwindヴィルヴェルヴィント (talk) 01:47, 1 June 2010 (UTC)[reply]

AUTOCAD 2009

How can I plot the cordinates which are created in excel work sheet. (One methord is copy the cordinates to notepad and again copy it to autocad2009 polyline command prompt). Thank you —Preceding unsigned comment added by 124.43.25.100 (talk) 07:22, 31 May 2010 (UTC)[reply]

This guide may be of use. Keep us posted.--rocketrye12^{talk/contribs} 14:33, 31 May 2010 (UTC)[reply]

Firefox bookmarks toolbar

Normally I do not display the Firefox bookmarks toolbar, but when I turned it on, instead of the blank toolbar I was expecting, it was populated with a large number of links. Although the links look like things I may have saved in the past, I cannot find them in my bookmarks list.

Where are the links in the Firefox bookmarks toolbar kept, as I would like to edit them? Thanks. 92.28.254.179 (talk) 11:51, 31 May 2010 (UTC)[reply]

Assuming Firefox 3.6.3 (the latest version), go to the menu bar, click the "Bookmarks" drop-down menu, and click "Organise bookmarks". This should give you the funtionality you are looking for. Xjmmlpsufmboe (talk) 13:08, 31 May 2010 (UTC)[reply]

Its not the functionality I'm asking about, but where the links in the bookmarks toolbar are kept? I tried doing as you suggested, did not help or reveal where the bookmark toolbar links are. I've deleted several links on the toolbar, but more links are added so that the toolbar is always full. I'd like to have just one or two links on the toolbar. 92.28.254.179 (talk) 13:38, 31 May 2010 (UTC)[reply]

I had a look at Bookmarks, then clicked on Bookmarks Toolbar. I deleted every link in that menu one by one. I do not know how they got there, but they are now gone. The Firefox bookmark menu system has a lot of unnecessary duplication and repetation in it and is not as easy or quick to use as the IE bookmarks. 92.28.254.179 (talk) 13:55, 31 May 2010 (UTC)[reply]

As a long-time Firefox user, I have never had this problem. I suspect it may have something to do with bookmark importing though. -Amordea (talk) 14:05, 31 May 2010 (UTC)[reply]

If your OS is 2k or XP, go C:\Documents and Settings\user name\Application Data\Mozilla\Firefox\Profiles →bookmarks.html. Oda Mari (talk) 14:21, 31 May 2010 (UTC)[reply]

In the organize bookmarks window, as Xjmmlpsufmboe mentions, there is a folder called "Bookmarks Toolbar". Firefox keeps these independent of the "Bookmarks menu" (which would explain these behavior), and if you double click that folder to view it, you may find what you are looking for. You'll need to expand the "All bookmarks" tab if "Bookmarks Toolbar" is not visible.--rocketrye12^{talk/contribs} 14:22, 31 May 2010 (UTC)[reply]

I may have misunderstood something in this discussion but if not Firefox from version 3 onwards I believe doesn't store bookmarks in the HTML file but in a sqlite3 database (along with the history for the wonder bar) AFAIK. There are daily backups in JSON format in the bookmarkbackups directory as well. See also [2] Nil Einne (talk) 04:43, 1 June 2010 (UTC)[reply]

Using Graphics in Java

I'm trying to make a grid (6rows by 7 columns) of squares. Later on, I want to be able to draw a circle any time a square is pressed. So when I was making my grid, I just stuck a test to see if it would work, and I got a NullPointerException (I tried to get the graphics component for one of my squares and draw a string). My code is at: http://pastebin.com/143x2LZm/ With the commented line (line 45) being the one that throws the exception. I looked up and some board said to use the paintComponent method but I'm not sure how that would work. I guess since getGraphics returns null if the component isn't currently displayable, I guess I should ask how to make the component displayable.

--66.133.196.152 (talk) 12:03, 31 May 2010 (UTC)[reply]

getGraphics() is being called in createGrid(), which is called in the constructor Grid.Grid(int,int). This in turn is main() at line 61. At this point the constructed Grid object hasn't been added to content pane, and the containing frame hasn't been set to visible. AWT components don't have native peers until they're "realized", that is they're added to a widget hierarchy (that is, a widget hierarchy with a visible Frame or Window or Dialog at its root). The same is fundamentally true for Swing components too, which rely (behind the scenes) on the underlying Frame's peer to render them (strictly, to provide a place for Java2D to render into). You're calling getGraphics() on an unrealised component; there's no peer, so getGraphics() fails with null. This fundamentally isn't how painting is done - AWT/Swing is event driven, and you have to be ready to paint your controls when you get an event asking you to do so. So the correct thing is to provide an implementation of paintComponent on the objects to plan on drawing (overriding JComponent.paintComponent). When the system calls that, it gives you a valid graphics context, and you paint there. Details here. But really your code is a jumble of objects, making it hard for you to progress. Firstly, you're adding Boxes inside a Box - but Boxes are containers, so those internal things shouldn't be boxes - they should be a concrete subclass of JComponent that you define, that implements paintComponent() as described above. Secondly it's not clear why you have a Grid class with a Box; it seems much more sensible to have Grid a subclass of Box (rather than have a Box instance being a member of a Grid object). Both the calling code and the code inside Grid will be more straightforward and make more sense that way. -- Finlay McWalter • Talk 15:01, 31 May 2010 (UTC)[reply]

Thanks for the good explanation! Helped alot. I was thinking of extending classes (I have a class that extends Box adding into another class that extends Box - it's the only way I could get them to fit flush with each other), but I was being lazy and just modifying an old grid I had. I got my game to work fine. BTW, why is it that when I had stuff to a JPanel, it won't add flush, even if I change the layout. --66.133.196.152 (talk) 03:41, 1 June 2010 (UTC)[reply]

You probably need to call the repaint() method on the JPanel; that throws a damage event which (in due course) will cause the repaint manager to call your paintComponent method(s). -- Finlay McWalter • Talk 14:51, 1 June 2010 (UTC)[reply]

Environment Variables in Windows Shortcuts

Preliminary: I have a flash drive with several of my technician tools on it. To keep it clean, I want to keep all the data files in separate directories from the executable portions. For accessibility, however, I'd like shortcuts to link to everything kept together in a single directory.

Problem: The problem arises when I change computers. Sometimes the computer will assign a different drive letter to the drive, thus making all my shortcuts defunct.

%CD% Variable: This seems like the most logical solution to me, however when I try to enter (for example):

"%CD%\folder\filename.exe"

as the shortcut's target, I get an error:

"The name '%CD%\folder\filename.exe' specified in the Target box is not valid. Make sure the path and file name are correct."

Now I've made sure that I've made no spelling errors, so all I can assume from here is that either this method does not work or my syntax is incorrect when using this variable in a shortcut.

Batch File: This solution works. However it is ugly. I'd like the program's native icons to go with my shortcuts for a simpler, more visual cue as to what program I'm fixing to run. If there is a way for me to get the batch files to use the linked program's icon, however, I could work with this.

Finally, I would like to avoid the use of non-portable third-party programs to get this done as well. Having to install something on a user's computer is inelegant and even less desireable than having a bunch of batch files to do the work.

Any ideas as to how I can get the desired result, given the aforementioned guidelines? -Amordea (talk) 13:22, 31 May 2010 (UTC)[reply]

This guide may have what you are looking for. Also, this forum thread discusses some possible solutions including (1) a relative shortcut without variables and (2) a .bat file to launch files deep within the drive. Let us know if you need any further assistance. --rocketrye12^{talk/contribs} 14:32, 31 May 2010 (UTC)[reply]

The first link was one I had already read and does not address any specific issue regarding %CD%. In fact, to be sure I was doing it right, I dropped a copy of a sample exe into %APPDATA% and created a shortcut for it. Worked. The problem is unique to %CD%.

The second was very similar to one I read before. A novel suggestion was the usage of wildcards in the shortcut, however this appears to generate the same error as the %CD% variable. And I already knew batch files would work, as stated previously, but they do not provide the visual cue that I am interested in. -Amordea (talk) 15:05, 31 May 2010 (UTC)[reply]

The problem is that the "%CD%" variable is not the directory that the shortcut is in. Actually, %CD% is the current working directory. That value may be undefined if you are accessing the shortcut via the Windows Explorer interface (i.e., by clicking on the shortcut icon). You can work around this by having a shortcut to a batch file - because a batch script will have a well-known, deterministic current working directory. Let the batch file then access the non-portable programs using a relative path based on the %CD% variable. Nimur (talk) 16:02, 31 May 2010 (UTC)[reply]

Curious. It does beg the question though, in which directory is the shortcut?

I am not sure I follow your workaround however, so it might prove better to spell it out for me so that I understand what you mean. What would I type into the shortcut box for it to execute its intended link regardless of what drive letter it is mapped to? Seems to me that it's irrelevant whether it is pointing to an exe or a batch file, but I might have missed what you were trying to tell me. -Amordea (talk) 16:41, 31 May 2010 (UTC)[reply]

Oooh, I think it just dawned on me how the shortcuts function. Not at all intuitive, but I take it to mean the shortcut exists as an extension of the main file, sort of as a path? And so by running it in whatever directory I put it, it does not determine which directory the link is in, only where the file it is calling is in, so naturally %CD% is not going to help it find the file? Tell me if I'm warm. -Amordea (talk) 16:51, 31 May 2010 (UTC)[reply]

I think the point is that %CD% is a variable designed for use in a scripting / shell environment, where every running program or command has a "current directory". In a graphical interface, the "current directory" is less obvious - I can type a full path into the Start->Run... dialog, and reference a file from anywhere on my computer, without changing my "current directory" to anything related to that file.

Generally, I think, Windows executes batch files you double-click on as though the "current directory" is the directory containing the file, so that's why %CD% works there. A shortcut, however, is different - in fact one of the things you can set in the shortcut's Properties window is "Start in", which tells Windows what to set the "current directory" to when it executes the target file, after it's worked out where that file is.

One trick with batch files would be to create a batch file for each program, and then a shortcut to each of those batch files. Since the icon for any shortcut can be edited in its Properties window, it would then be easy to create the "visual cue" you are after by selecting the appropriate icon.

In fact, with a bit of fiddling, you could probably make one batch file with multiple shortcuts - for instance, a shortcut with a target of "convert_path.bat \program1\bin\foo.exe" could execute X:\program1\bin\foo.exe based on the current drive letter... - IMSoP (talk) 22:18, 1 June 2010 (UTC)[reply]

Thanks for the reply! That confuses me so much though, because the shortcut does exist as a file within the directory system (as a .lnk file). So why it refuses to allow the variable for shortcuts given that is beyond me.

And I fear I am still lost, as I do not understand how the shortcut will remain functional once the drive letter changes (keep in mind the shortcut will remain on the flash drive with the variable drive letter and never be on the user's computer). Anything I seem to type into the target box which does not include a full path is reported as invalid.

I appreciate all the responses, though. At the least I have gained a little insight as to how these things work. I am not sure why I am not getting this, but maybe it will click with me later. -Amordea (talk) 10:06, 2 June 2010 (UTC)[reply]

Would it be possible to have all of your scripts and programs reference your own environment variable, e.g. "%AmordeaRoot%\folder\filename.exe"?

Then, all you would need to do at startup is run one script that sets that variable into the environment; alternatively, you could just type it in from a command prompt with about the same amount of effort. DaHorsesMouth (talk) 23:08, 1 June 2010 (UTC)[reply]

I briefly considered this alternative, but I do not wish to modify the paths of the other user's computer. While a simple operation to add a path and then remove it when I am done, it is an additional step...and I dunno, probably the main reason is that it just feels inelegant, if that makes any sense at all. I think at this point I'm going to content myself with the batch files being the operative (while less pretty) option. -Amordea (talk) 10:06, 2 June 2010 (UTC)[reply]

The boot partition in XP seems to have been changed...

Ok, so I have a triple-boot setup where Windows 7 is the main OS, and XP and Ubuntu as the other OS'es. On my tower PC, I had used Norton Ghost to make a complete copy of the partition that XP is installed on (labeled as H in Windows XP and D in Windows 7), and had it copy to a partition on a second hard drive, labelled L in XP... Then when I rebooted, I began having problem after problem after problem with various things being unable to load. After a while, I realized that XP had set the boot drive letter to the backup that I had made, drive L... So In Windows 7, I deleted that partition (which probably wasn't a very wise decision...), and attempted booting into XP. It boots up initially just fine, but doesn't even get past the initial loading of the welcome screen, just showing the XP logo. I can see the original partition in Windows 7 and as far as I can tell everything is fine, it just seems like XP is trying to load files from the now nonexistant drive L. So how do I set drive H back as the XP boot partition? (And in case you're wondering, with most Windows OS'es modeled after Windows NT, which would be Windows 2000, XP, Vista, and 7, the "boot partition" is where the OS is installed, but the "system partition" contains the boot record.) The Thing That Should Not Be (talk) 14:39, 31 May 2010 (UTC)[reply]

I'm not sure if I understand. Do you mean the XP logo as in the bootup screen like this [3] or that Windows actually starts and then gets stuck? If Window starts and then gets stuck, perhaps try safe mode? If you mean the former, I'm not entirely sure if this will be of help since IIRC you should get an error message but perhaps take a look in the boot.ini in the Windows XP drive and you should see something like multi(0)disk(0)rdisk(0)partition(1). You may have to change the rdisk option and perhaps the partition option (if you're unsure, you can try making multiple different options with different labels and then keeping trying different ones until one works). Alternatively, you can boot up with the Windows XP CD, load the recovery console and run the bootcfg /default [4] option (perhaps fixmbr and fixboot too although I'm not sure if these will be necessary and you also risk screwing up with whatever bootloader you have depending on how your system is setup and whether you can disconnect drives). If this doesn't work, have you tried F8 and booting without bootscreen so you can actually see what the problem is? Also what is the first boot loader you are using? BTW, with Windows whenever installing a new OS I nearly always remove any unneeded disks to avoid the installer getting confused. Nil Einne (talk) 04:32, 1 June 2010 (UTC)[reply]

No, it's the welcome screen after the boot screen, but all that showed up was the XP logo. Also, after fiddling with XP's registry in Windows 7, I managed to get it to load the desktop, but there are several problems with programs still trying to start from drive L:... so I'm probably gonna reformat that partition and reinstall XP, or maybe I'll just stick with Windows 7. You know, it's ironic... the XP installation got screwed up by the very thing which was intended to help easily recover from a situation precisely like this one... The Thing That Should Not Be (talk) 04:54, 1 June 2010 (UTC)[reply]

Port forwarding in Ubuntu II

Follow up to [[5]].

I am still trying to reach the site: http://www.heliohost.org:2082/login/ behind a firewall (which cannot be changed).

I Installed SSH tunnel manager, but I don't know how to configure it, no matter how simple the interface looks like. A picture of the interface is here: [[6]] and here [[7]]. In the second picture, you can choose between local, remote or dynamic. The first picture sets the default port at 22, why does it do so? Why does it ask for two ports in the first picture?--Mr.K. (talk) 17:23, 31 May 2010 (UTC)[reply]

In order for this to work, you need an endpoint to tunnel through. This is an endpoint that can connect unobstructed to the Heliohost URL as noted above -- what you will be doing is using that computer as a proxy/routing point. Do you have access to a computer/server with an SSH server running on a unfiltered/firewalled connection? This second point, under your control, is necessary here. Public proxy points do exist, but should only be used as a last resort as they are very fly-by-night.--rocketrye12^{talk/contribs} 13:52, 1 June 2010 (UTC)[reply]

Supercomputers for financial services, not banking

Why are supercomputers needed for "financial services (H)" as described here http://news.bbc.co.uk/1/hi/technology/10187248.stm This is different from banking, where I presume millions of simple transactions are being processed. What fiendishly intensive calculations are being done for financial services - some complex models that predict share prices for example? 92.15.1.82 (talk) 17:36, 31 May 2010 (UTC)[reply]

When googling for supercomputer finance, the first hit suggests some applications. 88.112.56.9 (talk) 20:50, 31 May 2010 (UTC)[reply]

yes, largly option pricing. These days there are all sorts of weird and wonderful financial instruments available for trading on the markets, and being able to find the fair price for these quicker (and more accurate) than your competitors gives a real edge. Option pricing works in principle by "Monte Carlo Simulation", i.e. churning out millions of possible future market scenarios and averaging the value of your option over all of them.213.160.108.26 (talk) 21:20, 31 May 2010 (UTC)[reply]

Take a look through topics on mathematical finance for an idea. Then imagine the thousands of firms holding (or not holding) thousands of financial products, from annuities to credit default swaps, which all have mathematical models for valuation. The firms, from insurance companies to hedge funds, want to know in real time what change in value would arise in their portfolio if certain events occurred (stock market drops five percent, interest rates increase 0.50%). See financial risk management. Computers are by definition involved in algorithmic trading/high-frequency trading, where decisions are made and communications transacted on exchanges in microseconds (though anyone with a brain would agree that many of these are not "financial services"--ed). This is a simplified and partial answer of course! Riggr Mortis (talk) 23:02, 31 May 2010 (UTC)[reply]

Quick compact operating system

Which freely available operation system (eg versions of Linux) would be quickest and compact, able to run normal software, but not bothering with fancy graphics or other unwanted bloats? Thanks 92.15.1.82 (talk) 17:41, 31 May 2010 (UTC)[reply]

slax is quite good. It can run from a live cd or usb, is 200mb total size, comes with a number of common programs (firefox, vlc, etc) and has the option to add more programs as "modules". I'm sure there are smaller OSs than that, but it's a good starting point. 82.44.55.254 (talk) 19:31, 31 May 2010 (UTC)[reply]

Is there a comparison of speeds and sizes anywhere please? 92.24.179.218 (talk) 21:05, 31 May 2010 (UTC)[reply]

If you don't want fancy graphics, disable them. Check blackviper.com for services you can disable (Start --> Control Panel --> Administrative Tools --> Serivces). You can also remove programs you don't need from your computer (Start --> Control Panel --> Programs and Features). If you disable the Themes Service, the graphics will be gone. Switching to another operating system altogether is not the easier solution. It would be easier to just optimize Windows rather than learn a new operating system. If you disable enough junk on your computer, you can make it faster than a Slax installation.--Best Dog Ever (talk) 00:51, 1 June 2010 (UTC)[reply]

This presumes he was on Windows in the first place (as opposed to a bloated Linux distro). You make valid points about how Windows can be tuned, but your conclusion needs support. Having first hand experience with Slax and a number of other small Linux distros, as well as with optimized versions of Windows (which are harder to come by,) it's hard to say which is truly faster in the fully optimized state since they each have advantages in certain applications. He also stipulated that he was interested in a "free" solution so cost/legitimacy might be an issue as well, where windows can not compete. One thing is for certain however: if disk space (or running from a live CD) is important, you will get a LOT further with Linux than windows. My advice to the OP: since these are all available in livecd (or better yet live-USB) formats, why not try a few and find out what works best for you? It only takes a little time (unless your net connection is slow). --144.191.148.3 (talk) 16:56, 1 June 2010 (UTC)[reply]

You might try Damn Small Linux or Ubuntu lite, both of which I use on a regular basis. Though I find that standard Ubuntu fits these requirements as well.--rocketrye12^{talk/contribs} 02:08, 1 June 2010 (UTC)[reply]

Slax 200MB, speed ?

Damn Small Linux, 50MB, speed ?

U-lite, ? MB, speed?

Puppy Linux, 68MB, speed ?

92.24.178.172 (talk) 09:54, 1 June 2010 (UTC)[reply]

Google Desktop - Deleting

I am paranoid about PC privacy - not for any ulterior reason - simply that I place my privacy on a very high plateau. So I am always very careful to delete any computer usage history and cookies etc., after each session. But not being particulary IT savvy, I have just seen a short video that shocked me by illustrating that every thing I do is also stored on Google Desktop. So when I had a look and began browsing, I realised what a fool I had been in thinking I had deleted my actions from Internet Explorer whilst unwittingly leaving a perfect audit-trail behind me on Google. So I now intend clearing that trail too after each session, but it seems I can only click one page at a time to select for deletion. Is there any way I can choose to delete my entire history in one go? I really will be grateful for any advice. Thanks 92.30.45.200 (talk) 18:10, 31 May 2010 (UTC)[reply]

I don't know the answer to the question you actually asked (sorry), but deleting Google Desktop's history won't be enough to remove all traces of your browsing history from your computer. Even uninstalling Google Desktop and your browser entirely and deleting all of your data files would generally leave traces that could be found by forensic analysis, if it came to that. On the other hand, as long as you control your computer, your browsing history is private no matter how many copies of it exist on your hard disk. So I think it comes down to what kind of threat to your privacy you're envisioning. If you're worried about theft, for example, then full-disk encryption is the way to go. -- BenRG (talk) 02:20, 1 June 2010 (UTC)[reply]

At the very least, clear all temporary directories, delete the pagefile and wipe all freespace but that still won't guarantee there's no trace left. In terms of the original question, a quick search for 'Google Desktop history' finds [8] [9] Nil Einne (talk) 05:08, 1 June 2010 (UTC)[reply]

The freeware CleanUp!, particularly when used in its most severe mode, should remove various histories and logs from your computer. I do not know about any information Google keeps on its servers. 92.24.178.172 (talk) 09:57, 1 June 2010 (UTC)[reply]

If you have a Google account (eg. Gmail, Google Reader etc.) and use Google services while signed in, you can go to https://www.google.com/accounts/ManageAccount?hl=en and alter your settings so that Google doesn't remember your browsing history. Under "My Products", "Web History" gives a listing of everything you've used the Google search engine for while signed in and what links you ended up clicking on. If you choose "Edit" beside "My Products" you can switch this facility off. --Kateshortforbob _talk 10:21, 1 June 2010 (UTC)[reply]

Password

Hi. I created a facebook account, and I thought it was interesting. I didn't go for any of the in-case-you-forget-your-password things because I was sure I wouldn't forget my password. And...I forgot my password :( I had to delete the email address I registered with because it had been...*ahem*...compromised by one of my friends. I also did not set my browser to save it. I don't want to create a new account though. I have heard my computer stores passwords and such that I enter into its RAM or something. Is there any way I can retrieve it? 76.229.166.153 (talk) 18:53, 31 May 2010 (UTC)[reply]

Unless you told your browser to remember it, it's not on your computer. It's not in your RAM, because your RAM is cleared whenever you shutdown your computer. Your only option is dealing with Facebook directly. I'm sure you're not the only one this has happened to, so they might have a protocol for regaining access to your account in a situation like this.--el Aprel (^facta-_facienda) 19:33, 31 May 2010 (UTC)[reply]

Or, try lots of different passwords, eventually you should get it right. Or just create another account identical to the last, and remember to write your password down somewhere this time. 148.197.114.158 (talk) 08:23, 1 June 2010 (UTC)[reply]

Just contact facebook, they deal with this stuff all the time, it might not be super quick but once you prove you own the account they should let you back in. if you've deleted the email it might make it a bit harder but they should still be able to help you. Vespine (talk) 06:18, 3 June 2010 (UTC)[reply]

ITV rugby

can people outside of the UK see the highlights at http://www.itv.com/rugby/ ? —Preceding unsigned comment added by 86.128.188.99 (talk) 19:56, 31 May 2010 (UTC)[reply]

"Sorry, the video could not be found", it says [Sweden]. --Andreas Rejbrand (talk) 20:20, 31 May 2010 (UTC)[reply]

I get "This video is only available to be viewed within the United Kingdom." I assume this is because ITV only has bought the rights for the UK, and therefore must geoblock the videos to the UK to protect rightsholders in other countries. Xenon54 (talk) 20:24, 31 May 2010 (UTC)[reply]

thx -- is there any way round it? —Preceding unsigned comment added by 86.128.188.99 (talk) 21:00, 31 May 2010 (UTC)[reply]

You could use a proxy located in the UK. A proxy server is an intermediary between you and the website's server. The server sends the website to the proxy, and the proxy forwards it to you, so if the proxy's in the UK, the website will think you're in the UK. Setting up your browser with a proxy can be tricky, and insecure if the proxy is malicious. Plus, proxies go down or disappear frequently, so you can constantly be looking for a new proxy. You really have to want to access the content if you want to deal with all this.--el Aprel (^facta-_facienda) 21:50, 31 May 2010 (UTC)[reply]

Surely there's other TV networks that have got coverage of this? It would be safer than using a proxy. Chevy monte carlo 05:44, 1 June 2010 (UTC)[reply]

rugbydump (google it) carries highlights of some GP matches, it probably does not block people based on geography 129.67.37.143 (talk) 20:05, 1 June 2010 (UTC)[reply]

Netbook running XP

I've got a netbook running XP. At present I've got it connected up to an external monitor. The netbook is setup at 800*600 pixels. I want to have the monitor display the same image - 800*600. I can go to display screen settings and set the monitor to 800*600. All works fine. I shut down and later boot up and it boots up at 800*600 on the monitor. But then just as it finishes booting, it changes the monitor resolution to something much finer (maybe 1024*768, I don't recall the exact figure, so i have to go back in and reset it to 800*600. Is there a way to make the 800*600 stay selected and stopit changing resolution at the end of the boot? -- SGBailey (talk) 21:56, 31 May 2010 (UTC)[reply]

What netbook? Specifically does it have an intel graphics chip (likely) - if so you should have some intel graphics software installed - try right clicking on the desktop - is there an option "Graphics Properties" - if so click on this - you can set various modes using this, (create one, save it as a scheme and select that scheme) and the effect should survive reboot. Hopefully.87.102.77.88 (talk) 12:46, 1 June 2010 (UTC)[reply]

sounds like some tool at the acer/dell/asus/whatever factory added some kind of autoconfig that resets the screen to what is most likely (given that it's a netbook) the native resolution, 1024*600. There are several options here. One I personally use and can vouch for is Ultramon ( http://www.realtimesoft.com/ultramon/ ), a payware program that is by far the finest multi-screen management software available for Windows. It's definitely overkill for what you need, but it has a "profile" system that allows profiles to be applied automatically on startup; that should work. Alternatively, a google search turns up this forum thread: http://forums.techarena.in/windows-xp-support/1042558.htm . You could download the mentioned programs, make a batch file, and dump it in your startup folder. Hope I helped, Riffraffselbow (talk) 08:58, 4 June 2010 (UTC)[reply]

June 1

Computer graphics

What is flicker? How this can be reduced? —Preceding unsigned comment added by Ajit.abhishek (talk • contribs) 04:00, 1 June 2010 (UTC)[reply]

Computer monitors work by flickering. They flicker so fast that your brain doesn't notice so you see a solid image. It's also why you get tired after using a computer after a while.^{[citation needed]} Why not read Flicker (screen) for more information. Chevy monte carlo 05:42, 1 June 2010 (UTC)[reply]

Well, I think so anyway :) Chevy monte carlo 16:29, 2 June 2010 (UTC)[reply]

Problems with Ubuntu Live CD

My Windows 7 desktop computer just crashed with no warning whatsoever, giving me a "disk boot failure - insert system disk and press enter" message. So, after several attempts of accessing my system drive with no success, I decided to try booting from a Ubuntu Live CD (v. 10.04 "Lucid Lynx", if that matters). I successfully burned the .iso to a disc and tested it under Parallels on my MacBook, but I can't boot into Linux with it on my desktop. It spends a long time telling me my SATA drive is misclassified, then it hangs for several minutes at a line that has syscall_call+0x7/0xb on it before going to a black screen, whereupon it is either hanging up completely or taking over 45 minutes to do whatever it is it's doing.

I've tried messing with the boot parameters according to this page, with the same result.

Here are my system specs:

Windows 7 Professional
Gigabyte GA-MA790GP-DS4H motherboard
AMD Athlon™ 64 X2 Dual-Core 6000+ 3.1GHz
Kingston ValueRam 2x2GB PC2-6400 DDR2 800MHz (5-5-5-15)
Sapphire Radeon™ HD 3650 725MHz, 512MB DDR2 1000MHz, PCIe x16, DVI /2
SEAGATE, 500GB Barracuda 7200.11, SATA 3 Gb/s, 7200 RPM, 32MB cache

Any help would be appreciated. 74.190.49.225 (talk) 05:50, 1 June 2010 (UTC)[reply]

Tried scanning your hard drive with Seatools? (Get the Dos version.) F (talk) 06:44, 1 June 2010 (UTC)[reply]

Or scan it with TestDisk (it might be able to recover your boot partition temporarily) but from what you've described it doesn't sound good; looks like a hard drive crash in which case you might need professional recovery services if you need any data back. Was the drive making funny clicking noises recently? Sandman30s (talk) 10:37, 1 June 2010 (UTC)[reply]

No, no funny clicking noises at all. It was working yesterday, then I turned off my computer and when I rebooted it, it gave me the disk boot failure message.

I scanned with Seatools and it couldn't even find the hard drive. I've swapped out cables and SATA slots on the motherboard, so I'm pretty sure that only leaves the drive. This thing is less than two years old. >:-( Am I wasting my time even trying to get into it via the Ubuntu Live CD? 74.190.49.225 (talk) 16:22, 1 June 2010 (UTC)[reply]

Try booting from the Linux CD after unplugging the probably broken hard drive - if it comes up without the syscall error you mentioned above, it is pretty likely that the hard disk is damaged beyond recognition. -- 109.193.27.65 (talk) 18:01, 1 June 2010 (UTC)[reply]

Yup, it booted successfully with the hard drive disconnected. Any suggestions for recovering the data from the drive (without spending lots of money on a data recovery service)? Thanks. 74.190.49.225 (talk) 19:44, 1 June 2010 (UTC)[reply]

All the cheap data recovery software I know requires the computer to at least recognize the disk. Try it in another computer? 203.167.190.79 (talk) 05:21, 2 June 2010 (UTC)[reply]

Afraid you're at the point where you have to consider expensive data recovery OR doing a lot of research to find software that can bypass the drive controller. You might be able to find something in one of the many boot cd's with software bundles that can read the drive at a lower level. I would also try, for example, attaching it to a USB external shell (or whatever it's called) and trying to mount it using LFS. I don't know, I've been here before and it gets really hairy. This is why the pros charge so much I guess, some claim to have tools to read the magnetism directly off the platters and raw data takes a long time to recognise and transform to usable data. It could be cheaper if you ask them to search for a specific type of file. G'luck! Sandman30s (talk) 06:35, 2 June 2010 (UTC)[reply]

And then there's the old hard drive in the freezer trick. Of course I'd only try this if you're willing to risk further damage to the HDD before sending it off to a data recovery service. -Amordea (talk) 15:56, 5 June 2010 (UTC)[reply]

Enough power for USB 2?

My neice has a PC, a Dell Dimension desktop PC around 5 years old, with Windows XP SP3. After much hassle getting a stable connection to the internet using the wireless access point in a distant corner of the house, earlier this year I installed a Belkin N Wireless USB adapter which is connected to one of the USB ports on the PC, and now the connection is pretty reliable. Like many teenagers, she is heavily into social networking so has installed several messaging apps and Skype, and has recently got herself a webcam so she can hold video chats with her friends. Recently, there has been some problems when she connects a USB flash drive or a digital camera, the PC reports that the device has "malfunctioned". After a lengthy investigation last weekend, including a full reinstall of Windows, I have at least managed to find out something about the problem.

While the PC appears to have many USB controllers listed in the device manager, only one is a USB 2 controller. The wireless adapter is always connected to this controller. When the USB flash drive or a digital camera is connected to any physical USB port, it is also connected to this same USB 2 controller but draws 0 mA (the wireless adapter seems to draw all 500 mA available under USB 2). I strongly suspect the reason the PC reports the devices have "malfunctioned" is a lack of power, and this is reinforced because if I disconnect the wireless adapter, the other USB devices now magcally work again.

My investigation has led to a number of questions: Why does the PC allocate the other devices to the only USB 2 controller rather than one of the 3 unused USB 1 controllers? Is there a way I can reduce the power consumption of the wireless adapter? Would connecting an external, powered USB hub solve the power problems? Would buying a USB 2 PCI card, make additional USB 2 controllers available so that the PC can allocate the other devices there instead? Astronaut (talk) 13:20, 1 June 2010 (UTC)[reply]

I have had this as well, when I added too many USB devices that get their power from the port or used a long cable. The simplest fix is to use a USB hub with a power pack. The hub powers the devices, not the PC. ---— Gadget850 (Ed) ^talk 13:37, 1 June 2010 (UTC)[reply]

Agree with the above. Just one additional note, AFAIK your PC doesn't allocate devices to a controller, i believe controllers are physically connected to USB ports. So the sockets you are plugging into are connected to the USB2 controller in your PC. If you have USB1 controllers in device manager or whatever, they might be connected to ports on the back of your PC or even possibly just headers on your motherboard which are not physically connected to any USB ports at all. Vespine (talk) 06:13, 3 June 2010 (UTC)[reply]

"In the news" archive

Is there an archive of the in the news section (right side of homepage)? I'd like to make a screen shot of a particular news event last week (maybe 2 weeks ago). Cheers! Aaadddaaammm (talk) 13:54, 1 June 2010 (UTC)[reply]

There is, of a sort: Wikipedia:ITN_archives. But it appears to show, per month, all items listed in that month. (or perhaps added in the month). --Tagishsimon (talk) 14:07, 1 June 2010 (UTC)[reply]

Socially engineered malware

Hi, I'm trying to understand the term "socially engineered malware". I found this definition, but I still don't get it. What do the words "socially engineered" have to do with anything? Anyone any idea? —Preceding unsigned comment added by 86.185.76.171 (talk) 16:53, 1 June 2010 (UTC)[reply]

Your friend Joe's computer gets infected by malware, which then goes through his address book in his email client and sends a message to you, saying "Check out these pictures from my vacation!" You click on the attached picture file, because you trust Joe, and that file then infects your computer and starts the process over again. That's an example. "Socially engineered" relates to the way the malware is passed around. 74.190.49.225 (talk) 17:03, 1 June 2010 (UTC)[reply]

And, of course, we have an article on social engineering in general. -- Coneslayer (talk) 17:16, 1 June 2010 (UTC)[reply]

Right. Social engineering means you are relying on human interactions, rather than technical hacks, to gain entry to a system. So if I call someone up at an office and say, "oh, yeah, this is Joe from level 6, I need the admin password, you know? Cause I'm locked out and that's really gonna make the boss mad!" and they believe me, that's "social engineering" in the context meant here (as compared with, say, using my computer to exploit a bug in their system software). So social engineered malware is malware that takes advantage of human factors—you fool the human into doing something they really shouldn't do, not because their computer is lacking in proper security or has bugs, but because they are humans and they are fallible. --Mr.98 (talk) 20:41, 1 June 2010 (UTC)[reply]

Indeed many of the many of the more successful malware include some social engineering aspects. E.g. I selected these [10] [11] [12] [[13] [14] [15] [16] [17] from some random person's list of malware which include social engineering aspects (and in fact I didn't even include a few that were distributed by P2P which also use social engineering). The first few perhaps being famous for it Nil Einne (talk) 21:54, 1 June 2010 (UTC)[reply]

Just as an aside, the concept of 'social engineering' really refers to the idea of coercing people into doing things they should do rather than doing the somewhat dumb things they actually do do. technically speaking, parking tickets are a form of social engineering - you convince people to behave civilly with respect to parking by making them pay if they behave rudely. in hacker terminology it has the same semi-sarcastic, semi-self-justificatory sense as when a grifter talks about 'educating' a mark; if the mark is smart they will learn not to do whatever stupid thing it was that allowed the grifter to rip them off, and ultimately the world will be filled with better, more street-wise people. --Ludwigs2 06:21, 4 June 2010 (UTC)[reply]

rss

I need a program that can monitor rss feeds every few mins and alert me if any contents in the feed match a specific keyword. I'm currently experiment with Thunderbird which is working quite well for just viewing feeds, but I want it to be able to alert me for specific keywords. Anyone know how this can be done, or better programs that might do this? Thanks 82.44.55.254 (talk) 19:06, 1 June 2010 (UTC)[reply]

You can create a keyword filter at Yahoo! Pipes and pass the original RSS feed through that, and subscribe to the pipe output in Thunderbird. -- Coneslayer (talk) 19:27, 1 June 2010 (UTC)[reply]

If you happen to use a Mac, you can use Mail and its built-in rules. You can set these up so if a message contains a keyword then certain actions (playing an alert noise, changing the colour of the message in the inbox) are carried out. This can be extended further using Applescript. Brammers (talk/c) 22:15, 1 June 2010 (UTC)[reply]

That's exactly what I want, but I don't have a Mac :( Is there a Windows port or clone? 82.44.55.254 (talk) 22:35, 1 June 2010 (UTC)[reply]

I had a rummage round. Although I don't use Thunderbird myself, it seems that there is a rough equivalent to rules called filters. Here and here might be of use, although I don't know how broad the range of actions are. It might be worth dropping by the Thunderbird community forums via the official website and asking there. Hope you manage to find a workable solution, Brammers (talk/c) 11:07, 2 June 2010 (UTC)[reply]

Excel - Inserting a link, programatically

Resolved

In excel you can insert a hyperlink into a cell, so that you have an visible anchor and a hyperlink value associated with the cell; and if you click on the anchor, you get taken to the hyperlinked site. So far so good. I have a spreadsheet, it has one column of hyperlinks. I want to extract the hyperlink value, amend it, and insert it as a hyperlink in cells in a second column.

If you want to extract the hyperlink value from acell, it seems you need a custom function such as [18] or [19].

What counterpart function would I need in order to set a hyperlink value around anchors in my second column? thanks --Tagishsimon (talk) 22:32, 1 June 2010 (UTC)[reply]

Ah. =hyperlink(link,anchor). --Tagishsimon (talk) 23:38, 1 June 2010 (UTC)[reply]

June 2

Round corners for IE

the moz-border-radius quality only works in Firefox. I'm working on a website for kids, who will likely be using IE6 to 8. Can I make round corners show up for them at all? {{Sonia|talk|simple}} 00:16, 2 June 2010 (UTC)[reply]

There are lots of ways, but they all involve using images of rounded corners. Here are a bunch of links relating to just this question. --Mr.98 (talk) 00:31, 2 June 2010 (UTC)[reply]

(edit conflict) Yes. In fact, this question is so frequently asked, there's an entire article on MSDN about it. (Furthermore, when IE9 rolls around, it will support the CSS3 standard border-radius property and no hacks will be necessary to make rounded corners work across up-to-date browsers.) « Aaron Rotenberg « Talk « 00:36, 2 June 2010 (UTC)[reply]

IE9 preview does support border-radius; see {{round corners}}. ---— Gadget850 (Ed) ^talk 00:54, 2 June 2010 (UTC)[reply]

I wonder, how does the following atrocity behave on IE6? -- Finlay McWalter • Talk 01:00, 2 June 2010 (UTC)[reply]

Work laptop still has IE6 ;) I see a green rectangle with a curved left border. Sandman30s (talk) 06:40, 2 June 2010 (UTC)[reply]

I don't know about IE6, but it works in IE8. However, I think I just died a little inside. Putting it near children, as the OP intends, is probably unwise. « Aaron Rotenberg « Talk « 05:46, 2 June 2010 (UTC)[reply]

Good God. That's.... a very scary way to make round corners, but it admittedly works. I don't really want images, so the best it appears I can do is something like this: [20], which is not ideal, but works. :P {{Sonia|talk|simple}} 07:24, 2 June 2010 (UTC)[reply]

I don't even see why you guys are saying it's an atrocity! That's awesome! Comet Tuttle (talk) 22:31, 2 June 2010 (UTC)[reply]

Safari 'Tabs'

A while ago someone kindly advised me how to create a tab for a web page, but I have mislaid it, can anyone help please? Thanks in anticipation.--Artjo (talk) 08:26, 2 June 2010 (UTC)[reply]

Sorry, but I don't really understand. Are you trying to create a website with 'tabs' or are you browsing the Internet and want to use tabs? If so, you can right-hand click on a link and choose 'Open link in new tab' to do so, or you can go Command->T on a Mac or Ctrl->T on a Windows computer to open a new blank tab. Chevy monte carlo 12:30, 2 June 2010 (UTC)[reply]

I'm not sure what you mean, but if you mean how to set an html link top open in a new tab? If so, that's still under the browser's control. Adding the property target="_blank" to the A tag asks the browser to open in a new window or tab - which they choose is up to the browser's settings. CSS3 adds the target-new property, but the browsers I've tried don't seem to support it. -- Finlay McWalter • Talk 14:36, 2 June 2010 (UTC)[reply]

If, however, you want a web page to look like it's got tabs within it, then you'd typically use a JavaScript UI client library with support for tab controls built in. Many of the full-featured toolkits do just this, including jQuery [21], Yahoo! UI Library [22], and Dojo [23]. -- Finlay McWalter • Talk 14:36, 2 June 2010 (UTC)[reply]

Thanks all, great stuff, know how to do it now ie:Command -> T on my Mac.--Artjo (talk) 14:50, 2 June 2010 (UTC)[reply]

Why Mac Address alone is not Sufficient ? why do we need IP Address ?

As Mac Address is 48 bits why it can alone be used to address the internet , why we need IP ? —Preceding unsigned comment added by R.srinivaas (talk • contribs) 09:38, 2 June 2010 (UTC)[reply]

To make routing tractable. MAC addresses are assigned by equipment manufacturers and thenceforth remain static. The process of selling and distributing equipment essentially shuffles all the equipment around, so there's no pattern to them. The IP devices in your home, or in your street, have an essentially random salad of MAC addresses. Now when you send a packet out, it goes to your ISP's router. If routing was done by randomly-distributed MACs, each router in the world would need a comprehensive list of every IP enabled device, in order to know where to send the packet. Its routing table would look like this:

80:00:00:00:01 send_to_entanet

80:00:00:00:02 send_to_google

80:00:00:00:03 send_to_level3

80:00:00:00:04 send_to_bt

80:00:00:00:05 send_to_google

80:00:00:00:06 send_to_bt

80:00:00:00:07 send_to_cableandwireless

That whole table would be vast, with hundreds of millions of entries. And every time a dynamic node (a cellphone or a laptop, say) moved, you'd have to update every router in the world with the routing information. The internet would be clogged with vast updates for these massive routing tables. So that's not what is done - instead IPs are assigned, and those IPs are strongly correlated with the network toplogy. So a routing table can consist of ranges, and you can do all the work with a few tens or hundreds of entries. Such a table looks like:

71.30.0.0-71.33.255.255 send_to_entanet

71.34.0.0-71.40.255.255 send_to_level3

with each entry covering thousands, sometimes millions of addresses. Your scheme works fine on very small networks (indeed, that's how ethernet switches decide where to send packets on their local VLAN) but it doesn't scale. -- Finlay McWalter • Talk 09:56, 2 June 2010 (UTC)[reply]

Thanks --User talk:R.srinivaas 16:25, 6 June 2010 (UTC)[reply]

Windows Server Update Services

Hi, how many computers does one have to run so that the use of Windows Server Update Services makes sense, as opposed to updating each computer manually (by setting all but your testbed computers to auto-download, but not auto-install, and walking around/RDPing to install the downloaded patches once you have verified their compatibility on your testbed computers)? I mean, doing manual updates on a bunch of computers does take a while, but maintaining a WSUS server takes time, too (and I'm guessing time-consuming errors can happen both ways, be it by manually installing a patch by accident that hasn't been tested yet, or a WSUS-managed machine failing to report back to the WSUS server, requiring manual fix-up) - so where's the break-even? Is there an official Microsoft recommendation, or at least some sort of rule-of-thumb? -- 109.193.27.65 (talk) 10:36, 2 June 2010 (UTC)[reply]

Poppler binary for Windows

The PDF article tells me that the combination of Inkscape plus Poppler would let me edit PDF files. I have a Windows computer. Installing Inkscape is easy. Poppler, however, looks like it's for Linux. Googling for "poppler windows binaries" or similar takes me to pages that either are inscrutable or that seem to assume I'm using something called Calibre. Any tips for a befuddled non-expert? Tama1988 (talk) 11:13, 2 June 2010 (UTC)[reply]

Have you tried just using Inkscape? My version of it can import/export PDFs without using Poppler already. I suspect the article is out of date, saying that it requires Poppler. --Mr.98 (talk) 12:54, 2 June 2010 (UTC)[reply]

You're right, it works well. Thank you for the tip. Incidentally, I should have read the article more closely; it suggested that Inkscape used Poppler rather than that the "end user" had to make a conscious decision to use Poppler. Tama1988 (talk) 07:49, 4 June 2010 (UTC)[reply]

Code cracking...

From the synthetic genome Craig Venter recently made (well, published), there are 4 regions which encode some kind of code. I've tried cracking them, but as a biologist failed miserably. Any experts out there want to have a go?

Lengthy code hidden. ╟─Treasury Tag►sundries─╢ 18:15, 2 June 2010 (UTC)[reply]

The following discussion has been closed. Please do not modify it.

TTAACTAGCTAAGTTCGAATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAATACTGTGCGCTTGACTGTGATCCTGATAAATAACTTCTTCTGTAGGGTAGAGTTTTATTTAAGGCTACTCACTGGTTGCAAACCAATGCCGTACATTACTAGCTTGATCCTTGGTCGGTCATTGGGGGATATCTCTTACTAATAGAGCGGCCTATCGCGTATTCTCGCCGGACCCCCCTCTCCCACACCAGCGGTGTAGCATCACCAAGAAAATGAGGGGAACGGATGAGGAACGAGTGGGGGCTCATTGCTGATCATAATGACTGTTTATATACTAATGCCGTCAACTGTTTGCTGTGATACTGTGCTTTCGAGGGCGGGAGATTCGTTTTTGACATACATAAATATCATGACAAAACAGCCGGTCATGACAAAACAGCCGGTCATAATAGATTAGCCGGTGACTGTGAAACTAAAGCTACTAATGCCGTCAATAAATATGATAATAGCAACGGCACTGACTGTGAAACTAAAGCCGGCACTCATAATAGATTAGCCGGAGTCGTATTCATAGCCGGTAGATATCACTATAAGGCCCAGGATCATGATGAACACAGCACCACGTCGTCGTCCGAGTTTTTTTGCTGCGACGTCTATACCACGGAAGCTGATCATAAATAGTTTTTTTGCTGCGGCACTAGAGCCGGACAAGCACACTACGTTTGTAAATACATCGTTCCGAATTGTAAATAATTTAATTTCGTATTTAAATTATATGATCACTGGCTATAGTCTAGTGATAACTACAATAGCTAGCAATAAGTCATATATAACAATAGCTGAACCTGTGCTACATATCCGCTATACGGTAGATATCACTATAAGGCCCAGGACAATAGCTGAACTGACGTCAGCAACTACGTTTAGCTTGACTGTGGTCGGTTTTTTTGCTGCGACGTCTATACGGAAGCTCATAACTATAAGAGCGGCACTAGAGCCGGCACACAAGCCGGCACAGTCGTATTCATAGCCGGCACTCATGACAAAACAGCGGCGCGCCTTAACTAGCTAA

TTAACTAGCTAACAACTGGCAGCATAAAACATATAGAACTACCTGCTATAAGTGATACAACTGTTTTCATAGTAAAACATACAACGTTGCTGATAGTACTCCTAAGTGATAGCTTAGTGCGTTTAGCATATATTGTAGGCTTCATAATAAGTGATATTTTAGCTACGTAACTAAATAAACTAGCTATGACTGTACTCCTAAGTGATATTTTCATCCTTTGCAATACAATAACTACTACATCAATAGTGCGTGATATGCCTGTGCTAGATATAGAACACATAACTACGTTTGCTGTTTTCAGTGATATGCTAGTTTCATCTATAGATATAGGCTGCTTAGATTCCCTACTAGCTATTTCTGTAGGTGATATACGTCCATTGCATAAGTTAATGCATTTAACTAGCTGTGATACTATAGCATCCCCATTCCTAGTGCATATTTTCATCCTAGTGCTACGTGATATAATTGTACTAATGCCTGTAGATAATTTAATGCCTGGCTCGTTTGTAGGTGATAATTTAGTGCCTGTAAAACATATACCTGAGTGCTCGTTGCGTGATAGTTCGTTCATGCATATACAACTAGGCTGCTGTGATATGGTCACTGCCCTTACTGTGCTACATATTACTGCGAGGGGGATGACGTATAAACCTGTTGTAAGTGATATGACGTATATAACTACTAGTGATATGACGTATAGGCTAGAACAACGTGATATGACGTATATGACTACTGTCCCAAACATCAGTGATATGACGTATACTATAATTTCTATAATAGTGATAAATAAACCTGGGCTAAATACGTTCCTGAATACGTGGCATAAACCTGGGCTAACGAGGAATACCCATAGTTTAGCAATAAGCTATAGTTCGTCATTTTTAAGGCGCGCCTTAACTAGCTAA

TTAACTAGCTAATTTAACCATATTTAAATATCATCCTGATTTTCACTGGCTCGTTGCGTGATATAGATTCTACTGTAGTGCTAGATAGTTCTGTACTAGGTGATACTATAGATTTCATAGATAGCACTACTGGCTTCATGCTAGGCATCCCAATAGCTAGTGATAGTTTAGTGCATACAACGTCATGTGATACAACGTTGCTGGCTGTAGATACAACGTCGTATTCTGTAAGTGATACAATAGCTATTGCTGTGCATAGGCCTATAGTGGCTGTAACTAGTGATATCACGTAACAACCATATAAGTTAGATTTAATGCCCCTGACTGAACGCTCGTTGCGTGATAGTTTAGGCTCGTTGCATACAACTGTGATTTTCATAAAACAACGTGATAATTTAGTGCTAGATAAGTTCCGCTTAGCAAGTGATAGTTTCCGCTTGACTGTGCATAGTTCGTTCATGCGCTCGTTGCGTGATAAACTAGGCAGCTTCACAACTGATAATTTAATTGCTGATATTGCTGGCTGTCTAGTGCTAGTGATCATAGTGCGTGATAGTTTAAGCTGCTCTGTTTTAGATATCACGTGCTTGATAATGAAACTAACTAGTGATACTACGTAGTTAACTATGAATAGGCCTACTGTAAATTCAATAGTGCGTGATATTGAACTAGATTCTGCAACTGCTAATATGCCGTGCTGCACGTTTGGTGATAGTTTAGCATGCTTCACTATAATAAATATGGTAGTTGTAACTACTGCGAATAGGGGGAGCTTAATAAATATGATCACTGTGCTACGCTATATGCCGTTGAATATAGGCTATATGATCATAACATATATAGCTATAAGTGATAAGTTCCTGAATATAGGCTATATGATCATAACATATACAACTGTACTCATGAATAAGTTAACGAGGATTAACTAGCTAA

TTAACTAGCTAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACATCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGTGATATTTTCACTACTGGCTTGACTGTAGTGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAGTGATATAATCCAACTAGATAGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTAAACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGATATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGTGCTAGATACTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTAGCACTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGTTTAGTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAGCTGTGATATCATAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGTGCTGCCGTTGAATAAGTTCCCTGAACATTGTGATACTGATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTAATTATAGGCTAACATTGCCAATAGTGCGGCGCGCCTTAACTAGCTAA

Here are some clues: "encoded in the watermarks is a new DNA code for writing words, sentences and number that includes a web address to send emails to if you can successfully decode the new code.

It also includes the names of 46 authors and other key contributors and three quotations: “To live, to err, to fall, to triumph, to recreate life out of life” from James Joyce; “See things not as they are, but as they might be” from the book American Prometheus; and “What I cannot build, I cannot understand” from Richard Feynman."

Cheers, have fun!

Aaadddaaammm (talk) 12:10, 2 June 2010 (UTC)[reply]

I can give you some hints (based in part on an interview I heard with Venter). In the interview he said that they wanted to make sure that their "code" didn't actually produce anything worthwhile when processed by the ribosome. I don't know enough about proteinogenic amino acid synthesis to know whether this means we can reject some triplet codons as being proteinogenic in a eukaryote. If there are some that can, it would be tempting to use that population (of triplet-codons) as a simple alphabet (you need 26, plus a few for .,:/ . If there aren't, I guess you'd have to figure out how they prevent proteinogenesis from occuring (I guess lots of stop codons, or something clever based on RNA interference). One might imagine that a molecular biologist would want to base their alphabet on codons rather than just a string of base-pairs, but if they want upper- and lower-case, they'll need a broader "byte" than the 64 options a 3-codon gives them. Once you know the ciphertext alphabet that's available, the coding itself shouldn't be too hard - it's mostly a caesar cipher, but you'll probably find that they code adjacent letters with logically adjacent codons (so 'A' might code as AAA, 'B' as AAC, 'C' as AAG, etc.). And the web address gives a nice crib - if it starts with http://, then you have a repeat followed by two dissimilar letters followed by another repeat. -- Finlay McWalter • Talk 16:08, 2 June 2010 (UTC)[reply]

Thanks for the tips, I just figured it out myself - using the quotes as a "crib" (especially the word CANNOT). I didn't see any pattern in the codon:letter arrangements, but wasn't really looking. Aaadddaaammm (talk) 16:17, 2 June 2010 (UTC)[reply]

(ec)And the plaintexts have plenty more cribs, such as the repeated " life" in the Joyce quote, repeated " as they" in the Prometheus quote, and repeated " cannot " in the Feynman quote (including the spaces in all, assuming Venter's code does store spaces). I think these fairly length repetitions, with known spaces between them, will be the key to figuring it out. -- Finlay McWalter • Talk 16:18, 2 June 2010 (UTC)[reply]

/dev/random and OpenBSD

Resolved

I know openbsd has /dev/random, but does it behave the same as it does in Linux? If I try sudo cat /dev/random I get an Input/output error. Is this normal? /dev/urandom works fine. Shadowjams (talk) 16:44, 2 June 2010 (UTC)[reply]

This page says that /dev/random only works if you have a real hardware random number generator, while the other /dev/?random devices are for various weaker alternatives. --Sean 18:29, 2 June 2010 (UTC)[reply]

Perfect, that explains it. Even feels vaguely familiar. Shadowjams (talk) 20:11, 2 June 2010 (UTC)[reply]

creating or assmebling a Pdf document using free software

In this country, some explicitely ask for the Job application as a single pdf document. It usually contains covering letter, resume and scanned certificates. I tried that using word - pasted one image per page and wrote an index, linked them using hyperlink. Yes, Ms word isnt free, but my university has it, although i cannot install any software or even a word plugin. When i convert this doc to pdf using a free online tool, link does not exist. Layout is damaged too - certain image titles appear on the previous pages. I tried options such as putting the image caption and image in a two row table or using "image description" in word, neither worked. First two sections are largely ok, since it is almost entirely text. Please advice how to create a pdf document that does not have distorted pages and with linked index for certifcates. —Preceding unsigned comment added by 134.99.136.3 (talk) 17:04, 2 June 2010 (UTC)[reply]

Have you tried Scribd or Google Docs - they both have pretty high quality doc->pdf conversion, something other programs aren't so good on. I don't know how they handle indices, however. -- Finlay McWalter • Talk 17:09, 2 June 2010 (UTC)[reply]

If you can install printers on any system with a word processor, then PDF Creator is the perfect option. It's what I use, basically you send any document to print, but instead of selecting library canon black-and-white or whatever, you select a PDF option. And it's open-source. ╟─Treasury Tag►senator─╢ 17:13, 2 June 2010 (UTC)[reply]

Similarly, I use CutePDF Writer, which is freeware. You "print" to a PDF file. If I were in your situation, I'd go straight to the person in charge of the computers there and explain your need. Comet Tuttle (talk) 17:37, 2 June 2010 (UTC)[reply]

But on the downside, "CutePDF Writer" has an unbearably twee name ;) ╟─Treasury Tag►CANUKUS─╢ 17:39, 2 June 2010 (UTC)[reply]

Agreed, and there's confusion with CuteFTP, which I also use. Cuteness abounds on my machine. Comet Tuttle (talk) 18:11, 2 June 2010 (UTC)[reply]

See List of PDF software. --Spoon! (talk) 19:50, 2 June 2010 (UTC)[reply]

If you can print to PostScript you can then try Ghostscript. If the computer has access to any printers, there's a fair chance they use PostScript so you can try these although you'll be limited to whatever options the printer supports. Ghostscript doesn't need to be installed although you obviously need to be able to run it on some computer. BTW, Microsoft Office 2007 SP2 [24] and 2010 come with a built-in PDF creator. This is also available for earlier versions of Office 2007 but wasn't installed by default because of legal problems with Adobe. If your uni is using Word 2007, I'm surprised they haven't already upgraded to SP2 but you could ask them to install the addin (or upgrade to SP2 which has been out for over a year!). When it is installed, look in the save as for a save as PDF option. Nil Einne (talk) 20:07, 2 June 2010 (UTC)[reply]

The best way of doing what you want to do is to write the application from the beginning in LaTeX. Then you just use the pdflatex command to produce your final PDF file. The "hyperref" package will allow you to put in the hyperlinks.

But I have to admit that by "best" I mean "best if you already know how to do it". If you don't, there's a fairly large amount of material you need to learn. Possibly worth it on the grounds that you can then use LaTeX again, but it's a large task that you may not have time or attention to deal with in the middle of a job search. --Trovatore (talk) 20:14, 2 June 2010 (UTC)[reply]

Your last statements are correct, Trovatore; the advice to use LaTeX is bad advice for this querent, who just wants to use Word to save a job application as a PDF. Comet Tuttle (talk) 20:34, 2 June 2010 (UTC)[reply]

We don't know that. It's entirely possible that the knowledge of a superior typesetting system will be advantageous to him in the future. I'm just laying out the options (LaTeX is better, but it is a fair amount of work to learn) and leaving it up to him. --Trovatore (talk) 20:54, 2 June 2010 (UTC)[reply]

problem adding to a home network

I have an existing wired/wireless home network that has three XP desktops. I got a Windows 7 laptop and I'm trying to add that to the network, via wireless. The new laptop connects fine and it sees the rest of the computers. The XP computers don't quite see it. On the new laptop, I told it to share, etc.

On the XP desktops, under Network Places/Entire network/MS windows network, there is 1. MShome - the old network name - it shows the old computers 2. workgroup - this is new. It shows the name of the new laptop, but there is no "+" beside it, and the other computers can't open it.

How can I get the old XP desktops to see the new W7 laptop on the network? Bubba73 ^{(You talkin' to me?)}, 20:05, 2 June 2010 (UTC)[reply]

Are you sure the Windows 7 laptop firewall is not blocking connections? I believe the 'wizard' (if you used that) should automatically add an exception but it probably pays to check it in any case. If this doesn't help, do you know the IP and/or computer name (not workgroup name!) of the hew computer? Workgroup sounds more like the workgroup name. If you do, try manually visiting the computer, e.g. \\bubba73comp1 or \\192.168.0.97 You might as well set the workgroup name to be the same unless you have a reason for it to be different as well although this shouldn't case problems initself. P.S. When you say you told it to share I presume you're actually sharing something right? Nil Einne (talk) 20:12, 2 June 2010 (UTC)[reply]

The easiest is to make sure all of them are using the same workgroup. So change MSHOME to WORKGROUP or vis versa. Alternatively you can use the "\\COMPUTERNAME\" syntax in the address bar of any normal folder window. If you have firewalls running they could interfere with it too unless you set them up (I think the default windows firewall does not need to be specifically setup). Shadowjams (talk) 20:14, 2 June 2010 (UTC)[reply]

I don't know how to change WORKGROUP to MSHOME (it must have been the default.

I had both Windows and Norton Firewall on - always a bad idea. I turned Windows Firewall off in 3 places (domain, public, private). I told Norton to turn off the firewall too, but I have the same problem. Bubba73 ^{(You talkin' to me?)}, 21:24, 2 June 2010 (UTC)[reply]

Unless you want the Norton firewall, I would uninstall. Norton I believe is one of the firewalls known to still cause problems even when it's supposed to be disabled. I doubt it's what's causing the problems here but I would do it. If you want to change the workgroup name in Windows 7, go to the Control Panel and type 'workgroup' into the search bar and choose the obvious option. In Windows XP try the System properties (it's actually the same place but XP lacks the search bar). Anyway I'd recommend you find out the name of the computer (again Control Panel then type in 'computer name' in the search bar, you can actually see and change the name and workgroup starting from here too) and try the \\ recommended by me and Shadowjams and see if that works. Nil Einne (talk) 01:05, 3 June 2010 (UTC)[reply]

I uninstalled Norton. I changed the workgroup name to match, but now the laptop doesn't see the others properly. They show up but it can't access them ("not accessible") and it gives the message "not enough server storage...". The one I;m trying to access has 4GB of RAM and plenty of HD space. Bubba73 ^{(You talkin' to me?)}, 02:08, 3 June 2010 (UTC)[reply]

I asked here because the Microsoft newsgroup ended. But perhaps MS Forums would be a better place to ask. Bubba73 ^{(You talkin' to me?)}, 02:09, 3 June 2010 (UTC)[reply]

Looks like you already did it, but just so we're on the same page, to change the workgroup, rightclick on My Computer, go to properties, then go to Computer Name, and then click on the Change button. Have you tried using the "\\192.168.0.1" (replace the right IP there) method? Does that work? Shadowjams (talk) 02:26, 3 June 2010 (UTC)[reply]

From a quick search it seems something has messed up your computer settings, possibly Norton AV (I'm reminded again of why I really dislike Norton products). I'm not sure why it happened now, perhaps the Norton Firewall stops the Norton AV from messing up the computer settings (actually on second thought, maybe Norton Firewall allows the network to work with the IRPStackSize set low)? Anyway see [25] [26] [27] which also describe how to fix this. Incidentally have you tried connecting to the laptop to see if we at least fixed that? P.S. I would personally try the MS forums or some other more specialised forums myself for this sort of thing if I couldn't resolve it myself Nil Einne (talk) 02:25, 3 June 2010 (UTC)[reply]

I'll look at those links tomorrow (bedtime now). I posted on the MS networking newsgroup, but then I learned that they basically ended 6/1. Then I posted on MS forums. Ten people have viewed my message, but no reply so far. Bubba73 ^{(You talkin' to me?)}, 05:28, 3 June 2010 (UTC)[reply]

I'm getting help from the MS forums and the firewall tech support. Bubba73 ^{(You talkin' to me?)}, 19:06, 3 June 2010 (UTC)[reply]

Find the contents of a div in arbitrary html using javascript

Hi all,

I'm trying to write a JavaScript function that, when handed a string of HTML, will look for a div with an id and hand me back the contents of it. For instance, if I'm looking for the id "test," and I give it the string "<div id="test">wooo</div>" it should return"wooo."

I was originally writing this using a regex, but it started to look complicated, and I knew that there already existed javascript functions for DOM parsing. The only problem is, this isn't HTML that is actually on the page -- it's just coming from an arbitrary string, and I don't want to have to stick that into the DOM.

Any thoughts? Thanks! — Sam 63.138.152.135 (talk) 20:56, 2 June 2010 (UTC)[reply]

You need comething along the lines of document.getElementById("test").innerHTML. A search for "javascript getelementbyid innerHTML" should yield various use examples. -- Tom N (tcncv) talk/contrib 23:46, 2 June 2010 (UTC)[reply]

Except document.getElementById() uses DOM, and the OP doesn't want to limit himself/herself to relying on DOM. Your original idea, with RegExp, is the way to go. For your example above, see the code below:

Javascript code

var str; //your HTML string
var innerhtml = null;

var position = str.search(/id="test"/im); //search for the id and get its position in the string
for(var i = position; i < str.length; i++) {
if(str.charAt(i) == ">") { //you found the start of the inner HTML
var oneChar;
while((oneChar = str.charAt(i++)) != "<") { //get each character till you get to the end tag (hopefully there are no <'s in-between!)
innerhtml += oneChar; //and add it to your result variable
}
break; // stop looking
}
}

if(innerhtml != null) {
//print innerhtml or do whatever you planned with it
//...
}
else {
//no match was found
}

I don't write a lot of javascript, so there may be some small errors, but you get the idea.--el Aprel (^facta-_facienda) 02:11, 3 June 2010 (UTC)[reply]

Thanks a lot for that! I'm not sure that's the best way, though, in part because of the requirement that the innerHTML have no tags. But it looks like some clever lateral thinking! In the end, I found a much simpler regex:

Javascript code

var pattern = /<div id='test'>(.*?)<\/div>/;
var matches = article.match(pattern);
var testInnerHTML = matches[1];

It could be spruced up with some fancier regexing for the div itself, incase it isn't as precise as that, but this is good for my purposes. Thanks so much anyway! — Sam 63.138.152.135 (talk) 14:21, 3 June 2010 (UTC)[reply]

Citation highlighting

I'm not exactly sure where to ask this particular question, so I'll ask here.

I've seen that on another site using MediaWiki citations work differently. Mainly, what I want to know is how the text is highlighted, like when you click on [1] and it highlights the citation that it jumps to. If anyone could explain, that would be great.

Just to confirm, the site in question uses the same citation extension as Wikipedia (with ref tags). Killr 22:00, 2 June 2010 (UTC)[reply]

See Help:Cite messages and ask me anything you don't understand. ---— Gadget850 (Ed) ^talk 22:44, 2 June 2010 (UTC)[reply]

Program with Templates

I need to compile a yearbook, using templates for articles and templates for pictures. The picture templates should be able to use word art on or around the pictures. So I should be able to take raw camera pictures and crop them into shapes, etc. Does anyone know of the best software (or multiple programs) for this task? Free is not a must, but I'd prefer it. Thanks in advance! Mxvxnyxvxn (talk) 23:35, 2 June 2010 (UTC)[reply]

June 3

File Association

Resolved

I have a strange problem here one of my fellow while opening a song go for the Open with option and wrongly done some thing strange,now my every software i have installed including the firefox shortcut on desktop open in VLC Media Player.when i try to download a new program it also open in VLC Player.I know it is problem of file association but i am not able to recover it.please fix this for me that can install software with .exe format and all the shortcuts of installed software open in the dafault program. this can done with open with is well but this option is not available. thnx i am using windows 7. —Preceding unsigned comment added by 221.120.250.79 (talk) 11:44, 3 June 2010 (UTC)[reply]

I haven't tried this, but i have gotten some good advice on other issues here:

. [28]. ---— Gadget850 (Ed) ^talk 12:15, 3 June 2010 (UTC).[reply]

Thanks man the problem is solved.many many thnx

Do intel cores automatically have centrino inside?

hi.. how do i know if my intel processor has centrino in it (aside from obviously looking at the sticker on the laptop)? The sticker says "Intel Core 2 Duo inside." I read in wikipedia an article about centrino, in which it states something like it's part of the Intel Core 2 Duo under Sta Rosa and Napa Platforms---things I hardly understand. If you have any idea, please tell me. Thanks. —Preceding unsigned comment added by 112.202.194.203 (talk) 13:28, 3 June 2010 (UTC)[reply]

Centrino isn't so much a physical product, but rather a combination of specific motherboard chipsets, WiFi cards AND processors. I'd recommend reading the Centrino article for more information, but although your processor is likely "compatible" it depends what WiFi and motherboard chipset you have as to if it "qualifies" to have the Centrino branding (easiest way though is to literally look for a sticker as it's the sort of thing they want to show off it if has one). ZX81 ^talk 14:15, 3 June 2010 (UTC)[reply]

cryptography- software to analyse code?

How easy would it be to create:

Something to run inputted text through every Caesar shift and select the most probable one based on recognised word patterns
Something to do frequency analysis (just spit out the percentages of each letter)
Something to detect patterns in transposition ciphers

and what would I use to do it? My teacher said you could just write a macro for Word, but I don't know how to do that either, so... {{Sonia|talk|simple}} 21:48, 3 June 2010 (UTC)[reply]

For any automatic decoder, you need to have a program that reads the decoded text and rates how much of it appears to be real words. That is the hard part. From a simplistic view, you can have a dictionary of 1,000 most common words and see how many of the characters in the decoded text match one of those words. To be more complicated, get the 10,000 most common pairs of words and look for word pairs instead of single words. If possible, check for real grammar and locate sentences, not just words. Once you have a program that can tell gibberish from real text, decoding and checking the outcome is trivial. You can write this in any programming language you like as every programming language that is common is easily capable of manipulating text. -- kainaw ™ 21:52, 3 June 2010 (UTC)[reply]

Frequency analysis is fairly simple; it's just chugging through the ciphertext letter by letter and incrementing a counter every time a certain letter is found. I used Applescript because it's simple and the only one I know, but that only works on Macs. I'm sure an Excel macro would do the same job; I used Excel as an output anyway so I could get a bar chart of relative frequencies making it easier to spot frequent letters. The other tasks would be more fiddly. If you need to do some frequency analysis, there are a couple of free utilities online, like this one, which picks up small repeated strings for you as well. Brammers (talk/c) 22:40, 3 June 2010 (UTC)[reply]

As for doing a quick substitution cipher, this will shift everything by 13 (it shifts all 8bit ascii, so adjust if you don't want that)

cat File_of_text | perl -e 'undef $/;@i=split //,<>;foreach (@i) {if (ord() > 31 && ord()<127) {$_=chr(((ord() - 19) % 95) + 32)}}print @i'

~~If you want a different shift or to iterate through each version, then just add a modifying variable and put it through a loop ($i++; ... " - 19 + $i", etc.)~~ Shadowjams (talk) 02:47, 4 June 2010 (UTC)[reply]

This does all versions:

undef $/;@i=split //,<>;($lr, $hr)=(32, 126);while($i < ($hr-$lr)){my @loop=@i;foreach (@loop){if (ord() > $lr - 1 && ord() < $hr - 1){$_=chr(((ord()-$lr+$i)%($hr - $lr)) + $lr);}}$i++;print @loop}

To adjust the ascii range it deals with, change the $lr and $hr values (ascii 8, the printable characters start at 32 and end at 126, so if you just want letters, change it to 65 and 122. Shadowjams (talk) 03:16, 4 June 2010 (UTC)[reply]

Okay, thanks all.... but how? @Shadowjams: thanks for the message on talk page, but (me being tech-illiterate) I don't know what I'm supposed to do with it. Put it into command prompt? save it as a .exe and run it? Make a macro (which I still don't know how to do)? {{Sonia|talk|simple}} 12:52, 4 June 2010 (UTC)[reply]

The first one is a command-line command that executes a Perl program (everything between the single quotes is the program). The second one is a different version of the Perl program. In any event, you'd need to have Perl installed, which isn't the case by default on Windows systems, but isn't too hard, I think. I don't think that the Microsoft Word macro language is all that expressive, so writing a macro for this would probably be a pain. Paul (Stansifer) 14:20, 4 June 2010 (UTC)[reply]

Lian Li power supply not turning on

I have a Lian Li case with the included power supply. I know it has some sort of fancy power failure detection thing in it. What that means - if you get sudden power failure, the computer cannot be turned on by pressing the power button. After a week or so, it will begin working normally, but I cannot figure out how to convince the computer that it is OK to turn on sooner. Anyone here have experience with these stupid things and knows how to turn one on after a power failure? -- kainaw ™ 21:56, 3 June 2010 (UTC)[reply]

Solved: Remove and reinsert the CPU. A bit of a pain, but it gets the dumb thing to turn back on today instead of a week from now. -- kainaw ™ 01:09, 4 June 2010 (UTC)[reply]

You probably don't want to experiment now, but I'd imagine that holding down the power button for 5 seconds might have persuaded it; that seems to be a common signal to intransigent PSU microcontrollers that you really really do want to turn on or off. -- Finlay McWalter • Talk 10:01, 4 June 2010 (UTC)[reply]

Tried that first. Even tried smacking it around a bit. Tried leaving it unplugged. Removed/replaced the CMOS battery. Nothing worked until I removed/replaced the CPU. -- kainaw ™ 14:40, 4 June 2010 (UTC)[reply]

June 4

CPU Temperatures

I'm running an Core 2 Duo E6550 on the stock cooler not overclocked. The idling temperature is around 48C to 50C. However, when I run anything moderately CPU intensive, the temperatures I measured with RealTemp shoots up to mid to high 90s! This is clearly not good for the CPU. Is there any reason why this would happen? I cleaned the dust out of the case and re-applied thermal grease (1 medium sized drop of Arctic Silver) to the interface between the CPU die and the cooler. I also cleared the PSU cables from the paths of the casefans/stock cooler. The ambient temperature in my room is about 27-30C. Should I invest in a new heatsink/fan or is there another simpler solution? 74.105.225.192 (talk) 00:31, 4 June 2010 (UTC)[reply]

First, your room is too hot. The ideal temperature for a computer room is about 65–75° F. Your room is 80–85° F.

Second, make sure that the heat sink for the CPU is attached firmly. The Intel LGA heat sink is known for coming loose. It has been my experience that if even one of the four posts is not completely pressed into the motherboard, then the CPU will overheat. The heatsink needs to be attached firmly.—Best Dog Ever (talk) 01:55, 4 June 2010 (UTC)[reply]

I used to have a core 2 Duo and it surprised me how quiet and cool it ran. Have you modded the case? Added or removed any fans? But yeah i agree with the above, 27-30 deg is pretty hot for a computer room, obviously you aren't going to buy a aircon just for your computer. Maybe you could consider buying an aftermarket heatsink? You should be able to get something cheap now the chip has been around quite a while, maybe even a 2nd hand one? Generally even the cheapest ones are improvements over the stock intel sink. Vespine (talk) 05:36, 4 June 2010 (UTC)[reply]

I run a coolermaster fan over my Core 2 Duo, with the air getting sucked out of a conduit cut into the case lid. Air flow in the box matters too... the fan at the back inhales and the fan at the front exhales. My idle is 30C and I rarely see the CPU ever go over 60C. And I live in a hot country without air conditioning in the room. If nothing works for you, either change your software or perhaps the motherboard sensor is malfunctioning. Sandman30s (talk) 05:44, 4 June 2010 (UTC)[reply]

The case; make sure airflow is unrestricted, that the case fans are working properly, and add more case fans if necessary/possible (e.g. many cases don't come with a front intake fan, but can use one). My E6600, overclocked and using the stock cooler, is idling at 29C right now, and sits in the 50s under load. The stock Core 2 heat sink is pretty reasonable. -- Consumed Crustacean (talk) 17:18, 4 June 2010 (UTC)[reply]

I'm rather skeptical about that temp, I think it's a faulty reading. Open up the case and put a portable thermometer in there, right by the CPU, close it back up, use the comp for a while, then open it back up and look at the real temp. Or, even better, if you have a digital thermometer with a remote probe, just put the probe inside.

Now, if the temp really is that high, I'd leave the case off and point a box fan at the interior. StuRat (talk) 19:30, 4 June 2010 (UTC)[reply]

Put the computer near the fridge. --TylerDurdenn (talk) 21:27, 4 June 2010 (UTC)[reply]

If you put your hand near a closed fridge, you'll notice how bad your suggestion is. Comet Tuttle (talk) 21:33, 4 June 2010 (UTC)[reply]

Craigslist

Is it just me, or is this a bot add: [29]. How do I know? That crazy invisible/white text that appears after the black text. Or is Craigslist just trying to pull a fast one to get attention to the page? I'd sure like to know because I see a lot of these pages in my area. Magog the Ogre (talk) 00:45, 4 June 2010 (UTC)[reply]

Almost certainly spam, for my money. --Tagishsimon (talk) 00:58, 4 June 2010 (UTC)[reply]

I'm trying to see the value-added in that invisible nut-job text. It can't be seen (immediately, anyway) by the reader, and there are easier ways to tag an article for recognition; it doesn't show up in the reply-to email... what's the point? --Ludwigs2 06:03, 4 June 2010 (UTC)[reply]

It's probably for a search engine, like Google. It's called black-hat SEO. It can make a page seem relevant to a search engine, even if it isn't.--Best Dog Ever (talk) 06:13, 4 June 2010 (UTC)[reply]

Alternatively, it's an attempt to bypass automated spam filtration. Riffraffselbow (talk) 09:06, 4 June 2010 (UTC)[reply]

An easy way to detect Craigslist spam is to just google a choice sentence. Searching for "Template:Websearch" reveals that this apartment is so awesome it's available not only in State College, PA, but also in San Diego and NYC! --Sean 18:51, 4 June 2010 (UTC)[reply]

That's a pretty awesome apartment. -Amordea (talk) 14:33, 5 June 2010 (UTC)[reply]

Resting web pages - blocking AJAX requests

Is anyone aware of a way in Firefox (i.e., a plug-in) to temporarily stop a tab from further communication with the server via AJAX? What quickly crossed my mind would be to add the URL to Adblock Plus and turn the plugin on and off as needed. Anything more elegant? Thanks, Riggr Mortis (talk) 01:12, 4 June 2010 (UTC)[reply]

You can use noscript to enable/disable scripts on the page much easier than turning adblock on and off. -- kainaw ™ 01:51, 4 June 2010 (UTC)[reply]

That would reload the page and turn off all scripts, but if that's fine it's probably the best option. You could also use Firebug and click the "Break On Next" button in the Script panel. That would stop the page's scripts altogether however, not just ajax. You could even use Greasemonkey and create a user script to override and disable the appropriate functions, maybe even having it toggleable somehow. -- Consumed Crustacean (talk) 07:00, 4 June 2010 (UTC)[reply]

Reloading the page would be a problem. I just want it to go "network-quiet" and maintain state -- not talk to the server every few seconds. I could try Firebug but would have to figure out where the breakpoint was I guess. (Or maybe not, now that I reread your comment.) Thanks for the suggestions. Riggr Mortis (talk) 23:25, 4 June 2010 (UTC)[reply]

Running A 2nd Partition in VirtualBox?

I'd just like to say thanks for the answers to my question several days ago regarding removing Ubuntu and resetting my partitions. I've decided to stick with Ubuntu on this dual-boot for now, as I have solved the problem which was causing me to want to remove it in the first place. Now, I have another question. Is it possible to run my Vista partition as a virtual machine, using, for example, Virtual Box? Would it also be possible to run my Ubuntu partition from Vista using Virtual Box? This would save me from rebooting, I guess. --KägeTorä - (影虎) (TALK) 10:59, 4 June 2010 (UTC)[reply]

I used to do that with a Windows NT4 Workstation and VMware Workstation instead of VirtualBox, it was tricky, but possible to get it to run as a VM while still retaining an option to boot it on the real hardware. Newer Windows Versions (starting with XP) will probably complain (in a "fatal" way) about such attempts. For one, it'll invalidate your Windows Activation (and the way I "know" Windows, it'll probably require re-activation each time you reboot the other configuration, leading to a situation where you'll only be able to re-activate via phone - though that is speculation on my part). Also, Vista and Windows 7 are a bit more picky when it comes to drive numbering/lettering, so I doubt you'll be able to get any modern Windows to dual- and VM-boot.

The other way, VM-booting a Linux partition, should work - however, VMware Workstation refuses to do that when the partition shares the same physical hard disk with the currently running Windows, so you might want to check if VirtualBox has a similar limitation. If you're going that route, I'd suggest preparing a virtual floppy disk with Smart Boot Manager and saving the boot loader (most likely GRUB/GRUB2, since you mentioned Ubuntu) to the Linux partition, rather than the MBR. That way, updates to the GRUB package will end up on your disk regardless of the environment you're currently running (physical/virtual), and it won't try to mess with a MBR that might be currently access-blocked by your Windows host. -- 109.193.27.65 (talk) 09:34, 5 June 2010 (UTC)[reply]

Cheers. Actually a search of the Ubuntu forums gave me a number of threads all saying the same thing - use something called 'FS-Driver' to access the files on the Ubuntu partition from within Vista. One person seemed to have negative views about it (couple of friends had unspecified trouble, and it's a security risk apparently), but everyone else seemed perfectly happy. As for actually mounting the drive, still nothing. I find it strange that it's so difficult, considering I can run multiple OSs simultaneously (I had Karmic Koala running inside Lucid Lynx inside Vista on VirtualBox a few nights ago just to make some fun screenshots), but that might be because they are on different disks. --KägeTorä - (影虎) (TALK) 11:30, 5 June 2010 (UTC)[reply]

Page History on Private wiki

When I try accessing the page history on my private wiki I get this come up:

Detected bug in an extension! Hook FlaggedRevsHooks::addToHistLine failed to return a value; should return true to continue hook processing or false to abort.
Backtrace:
#0 C:\xampp\htdocs\mediawiki-1.15.2\includes\PageHistory.php(338): wfRunHooks('PageHistoryLine...', Array)
#1 C:\xampp\htdocs\mediawiki-1.15.2\includes\PageHistory.php(594): PageHistory->historyLine(Object(stdClass), Object(stdClass), 1, false, true, true)
#2 C:\xampp\htdocs\mediawiki-1.15.2\includes\Pager.php(290): PageHistoryPager->formatRow(Object(stdClass))
#3 C:\xampp\htdocs\mediawiki-1.15.2\includes\PageHistory.php(142): IndexPager->getBody()
#4 C:\xampp\htdocs\mediawiki-1.15.2\includes\Wiki.php(523): PageHistory->history()
#5 C:\xampp\htdocs\mediawiki-1.15.2\includes\Wiki.php(63): MediaWiki->performAction(Object(OutputPage), Object(Article), Object(Title), Object(User), Object(WebRequest))
#6 C:\xampp\htdocs\mediawiki-1.15.2\index.php(116): MediaWiki->initialize(Object(Title), Object(Article), Object(OutputPage), Object(User), Object(WebRequest))
#7 {main}

What could be wrong to bring this message up, it happens whenever I try and go to any page history. Also these are my current settings in Local Settings.php file:

Code hidden, click show to see

<?php

# This file was automatically generated by the MediaWiki installer.
# If you make manual changes, please keep track in case you need to
# recreate them later.
#
# See includes/DefaultSettings.php for all configurable settings
# and their default values, but don't forget to make changes in _this_
# file, not there.
#
# Further documentation for configuration settings may be found at:
# http://www.mediawiki.org/wiki/Manual:Configuration_settings

# If you customize your file layout, set $IP to the directory that contains
# the other MediaWiki files. It will be used as a base to locate files.
if( defined( 'MW_INSTALL_PATH' ) ) {
	$IP = MW_INSTALL_PATH;
} else {
	$IP = dirname( __FILE__ );
}

$path = array( $IP, "$IP/includes", "$IP/languages" );
set_include_path( implode( PATH_SEPARATOR, $path ) . PATH_SEPARATOR . get_include_path() );

require_once( "$IP/includes/DefaultSettings.php" );

# If PHP's memory limit is very low, some operations may fail.
# ini_set( 'memory_limit', '20M' );

if ( $wgCommandLineMode ) {
	if ( isset( $_SERVER ) && array_key_exists( 'REQUEST_METHOD', $_SERVER ) ) {
		die( "This script must be run from the command line\n" );
	}
}
## Uncomment this to disable output compression
# $wgDisableOutputCompression = true;

$wgSitename         = "Testbase";

## The URL base path to the directory containing the wiki;
## defaults for all runtime URL paths are based off of this.
## For more information on customizing the URLs please see:
## http://www.mediawiki.org/wiki/Manual:Short_URL
$wgScriptPath       = "/mediawiki-1.15.2";
$wgScriptExtension  = ".php";

## UPO means: this is also a user preference option

$wgEnableEmail      = true;
$wgEnableUserEmail  = true; # UPO

$wgEmergencyContact = "postmaster@localhost";
$wgPasswordSender = "postmaster@localhost";

$wgEnotifUserTalk = true; # UPO
$wgEnotifWatchlist = true; # UPO
$wgEmailAuthentication = true;

## Database settings
$wgDBtype           = "mysql";
$wgDBserver         = "localhost";
$wgDBname           = "Test";
$wgDBuser           = "wikiuser";
$wgDBpassword       = "myfriend";

# MySQL specific settings
$wgDBprefix         = "";

# MySQL table options to use during installation or update
$wgDBTableOptions   = "ENGINE=InnoDB, DEFAULT CHARSET=binary";

# Experimental charset support for MySQL 4.1/5.0.
$wgDBmysql5 = true;

## Shared memory settings
$wgMainCacheType = CACHE_NONE;
$wgMemCachedServers = array();

## To enable image uploads, make sure the 'images' directory
## is writable, then set this to true:
$wgEnableUploads       = false;
# $wgUseImageMagick = true;
# $wgImageMagickConvertCommand = "/usr/bin/convert";

## If you use ImageMagick (or any other shell command) on a
## Linux server, this will need to be set to the name of an
## available UTF-8 locale
# $wgShellLocale = "en_US.UTF-8";

## If you want to use image uploads under safe mode,
## create the directories images/archive, images/thumb and
## images/temp, and make them all writable. Then uncomment
## this, if it's not already uncommented:
# $wgHashedUploadDirectory = false;

## If you have the appropriate support software installed
## you can enable inline LaTeX equations:
$wgUseTeX           = false;

$wgLocalInterwiki   = strtolower( $wgSitename );

$wgLanguageCode = "en";

$wgSecretKey = "d490b0253a5959c37b55bfd2011d03a27ac49811d5ff151679fff9760f32ba7";

## Default skin: you can change the default skin. Use the internal symbolic
## names, ie 'standard', 'nostalgia', 'cologneblue', 'monobook':
$wgDefaultSkin = 'monobook';

## For attaching licensing metadata to pages, and displaying an
## appropriate copyright notice / icon. GNU Free Documentation
## License and Creative Commons licenses are supported so far.
# $wgEnableCreativeCommonsRdf = true;
$wgRightsPage = ""; # Set to the title of a wiki page that describes your license/copyright
$wgRightsUrl = "";
$wgRightsText = "";
$wgRightsIcon = "";
# $wgRightsCode = ""; # Not yet used

$wgDiff3 = "";

# When you make changes to this configuration file, this will make
# sure that cached pages are cleared.
$wgCacheEpoch = max( $wgCacheEpoch, gmdate( 'YmdHis', @filemtime( __FILE__ ) ) );

/**
 * Permission keys given to users in each group.
 * All users are implicitly in the '*' group including anonymous visitors;
 * logged-in users are all implicitly in the 'user' group. These will be
 * combined with the permissions of all groups that a given user is listed
 * in in the user_groups table.
 *
 * Note: Don't set $wgGroupPermissions = array(); unless you know what you're
 * doing! This will wipe all permissions, and may mean that your users are
 * unable to perform certain essential tasks or access new functionality
 * when new permissions are introduced and default grants established.
 *
 * Functionality to make pages inaccessible has not been extensively tested
 * for security. Use at your own risk!
 *
 * This replaces wgWhitelistAccount and wgWhitelistEdit
 */
$wgGroupPermissions = array();

// Implicit group for all visitors
$wgGroupPermissions['*']['createaccount']    = true;
$wgGroupPermissions['*']['read']             = true;
#$wgGroupPermissions['*']['edit']             = true;
#$wgGroupPermissions['*']['edit-main']             =false;
#$wgGroupPermissions['*']['edit-talk']             = false;
$wgGroupPermissions['*']['createpage']       = true;
#$wgGroupPermissions['*']['createtalk']       = true;
#$wgGroupPermissions['*']['writeapi']         = true;

// Implicit group for all logged-in accounts
$wgGroupPermissions['confirmed']['move']             = true;
$wgGroupPermissions['confirmed']['move-subpages']    = true;
$wgGroupPermissions['confirmed']['move-rootuserpages'] = true; // can move root userpages
//$wgGroupPermissions['user']['movefile']         = true;	// Disabled for now due to possible bugs and security concerns
$wgGroupPermissions['user']['read']             = true;
$wgGroupPermissions['confirmed']['edit-main']             = true;
$wgGroupPermissions['user']['edit-talk']             = true;
$wgGroupPermissions['user']['edit']             = true;
$wgGroupPermissions['confirmed']['createpage']       = true;
$wgGroupPermissions['confirmed']['createtalk']       = true;
$wgGroupPermissions['confirmed']['writeapi']         = true;
$wgGroupPermissions['confirmed']['upload']           = true;
$wgGroupPermissions['confirmed']['reupload']         = true;
$wgGroupPermissions['confirmed']['reupload-shared']  = true;
$wgGroupPermissions['confirmed']['minoredit']        = true;
$wgGroupPermissions['confirmed']['purge']            = true; // can use ?action=purge without clicking "ok"

// Implicit group for accounts that pass $wgAutoConfirmAge
$wgGroupPermissions['autoconfirmed']['autoconfirmed'] = true;

// Users with bot privilege can have their edits hidden
// from various log pages by default
$wgGroupPermissions['bot']['bot']              = true;
#$wgGroupPermissions['bot']['autoconfirmed']    = true;
$wgGroupPermissions['bot']['nominornewtalk']   = true;
$wgGroupPermissions['bot']['autopatrol']       = true;
$wgGroupPermissions['bot']['suppressredirect'] = true;
$wgGroupPermissions['bot']['apihighlimits']    = true;
$wgGroupPermissions['bot']['writeapi']         = true;
#$wgGroupPermissions['bot']['editprotected']    = true; // can edit all protected pages without cascade protection enabled

// Most extra permission abilities go to this group
$wgGroupPermissions['sysop']['edit-main']             = true;
$wgGroupPermissions['sysop']['edit-talk']             = true;
$wgGroupPermissions['sysop']['edit']             = true;
$wgGroupPermissions['sysop']['block']            = true;
$wgGroupPermissions['sysop']['createaccount']    = true;
$wgGroupPermissions['sysop']['delete']           = false;
$wgGroupPermissions['sysop']['bigdelete']        = false; // can be separately configured for pages with > $wgDeleteRevisionsLimit revs
$wgGroupPermissions['sysop']['deletedtext']   = true; // can view deleted revision text
$wgGroupPermissions['sysop']['deletedhistory']   = true; // can view deleted history entries, but not see or restore the text.
$wgGroupPermissions['sysop']['undelete']         = false;
$wgGroupPermissions['sysop']['editinterface']    = true;
$wgGroupPermissions['sysop']['editusercssjs']    = true;
$wgGroupPermissions['sysop']['import']           = true;
$wgGroupPermissions['sysop']['importupload']     = true;
$wgGroupPermissions['sysop']['suppressredirect'] = true;
$wgGroupPermissions['sysop']['move']             = true;
$wgGroupPermissions['sysop']['move-subpages']    = true;
$wgGroupPermissions['sysop']['move-rootuserpages'] = true;
$wgGroupPermissions['sysop']['patrol']           = true;
$wgGroupPermissions['sysop']['autopatrol']       = true;
$wgGroupPermissions['sysop']['protect']          = true;
$wgGroupPermissions['sysop']['proxyunbannable']  = true;
$wgGroupPermissions['sysop']['rollback']         = true;
$wgGroupPermissions['sysop']['trackback']        = true;
$wgGroupPermissions['sysop']['upload']           = true;
$wgGroupPermissions['sysop']['review'] = true; //allow administrators to review revisions
$wgGroupPermissions['sysop']['validate'] = true;
$wgGroupPermissions['sysop']['autoreview'] = true;
$wgGroupPermissions['sysop']['unreviewedpages'] = true;
$wgGroupPermissions['sysop']['reupload']         = true;
$wgGroupPermissions['sysop']['reupload-shared']  = true;
$wgGroupPermissions['sysop']['unwatchedpages']   = true;
$wgGroupPermissions['sysop']['autoconfirmed']    = true;
$wgGroupPermissions['sysop']['upload_by_url']    = true;
$wgGroupPermissions['sysop']['ipblock-exempt']   = true;
$wgGroupPermissions['sysop']['blockemail']       = true;
$wgGroupPermissions['sysop']['markbotedits']     = true;
$wgGroupPermissions['sysop']['apihighlimits']    = true;
$wgGroupPermissions['sysop']['browsearchive']    = true;
$wgGroupPermissions['sysop']['noratelimit']      = true;
$wgGroupPermissions['sysop']['movefile']         = true;
$wgGroupPermissions['sysop']['mergehistory']     = true;

$wgGroupPermissions['bureaucrat']['edit-main']             = true;
$wgGroupPermissions['bureaucrat']['edit-talk']             = true;
$wgGroupPermissions['bureaucrat']['edit']             = true;

$wgGroupPermissions['rightsapplier']['read']             = true;
$wgGroupPermissions['rightsapplier']['edit']             = false;
$wgGroupPermissions['rightsapplier']['edit-main']             =false;
$wgGroupPermissions['rightsapplier']['edit-talk']             = false;
$wgGroupPermissions['rightsapplier']['createpage']       = false;
$wgGroupPermissions['rightsapplier']['createtalk']       = false;
$wgGroupPermissions['rightsapplier']['writeapi']         = false;

// Permission to change users' group assignments
$wgAddGroups['sysop'] = array('bot', 'confirmed', 'Rollbacker');
$wgRemoveGroups['sysop'] = array('bot', 'confirmed', 'Rollbacker');
$wgGroupPermissions['sysop']['userrights'] = false;

$wgAddGroups['bureaucrat'] = array('bureaucrat', 'sysop');
$wgGroupPermissions['bureaucrat']['userrights'] = false;
$wgGroupPermissions['bureaucrat']['noratelimit'] = true;

$wgAddGroups['steward'] = array('bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'steward', 'sysop' );
$wgRemoveGroups['steward'] = array( 'bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'sysop' );
$wgGroupPermissions['steward']['userrights'] = false;
#$wgGroupPermissions['steward']['deleteuser'] = true;

$wgAddGroups['Staffleader'] = array('Staff');
$wgRemoveGroups['Staffleader'] = array('Staff');
$wgGroupPermissions['Staffleader']['userrights']  = false;
$wgAddGroups['Staff'] = array('bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'steward', 'sysop');
$wgRemoveGroups['Staff'] = array('bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'steward', 'sysop');
$wgGroupPermissions['Staff']['userrights']  = false;

#$wgGroupPermissions['bureaucrat']['deleteuser'] = false;

$wgAddGroups['rightsapplier'] = array('bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'Staff', 'steward', 'sysop');
$wgRemoveGroups['rightsapplier'] = array('bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'Staff', 'steward', 'sysop');
$wgGroupPermissions['rightsapplier']['userrights']  = false;
#$wgGroupsRemoveFromSelf['steward'] = array( 'bureaucrat', 'bot', 'checkuser', 'confirmed', 'developer', 'oversight', 'Rollbacker', 'sysop' );
// Permission to change users' groups assignments across wikis
#$wgGroupPermissions['bureaucrat']['userrights-interwiki'] = true;
// Permission to export pages including linked pages regardless of $wgExportMaxLinkDepth
#$wgGroupPermissions['bureaucrat']['override-export-depth'] = true;

// To hide usernames from users and Sysops
$wgGroupPermissions['sysop']['hideuser'] = true;

/**
 * The developer group is deprecated, but can be activated if need be
 * to use the 'lockdb' and 'unlockdb' special pages. Those require
 * that a lock file be defined and creatable/removable by the web
 * server.
 */
# $wgGroupPermissions['developer']['siteadmin'] = true;
require_once("$IP/extensions/Nuke/SpecialNuke.php");
$wgGroupPermissions['sysop']['nuke'] = true;
include_once('extensions/CheckUser/CheckUser.php');
$wgGroupPermissions['developer']['siteadmin'] = true;
$wgGroupPermissions['Rollbacker']['rollback']  = true;
require_once("$IP/extensions/Oversight/HideRevision.php");
$wgGroupPermissions['oversight']['hiderevision'] = true;
$wgGroupPermissions['oversight']['oversight'] = true;
$wgGroupPermissions['oversight']['suppressionlog'] = true;
$wgGroupPermissions['oversight']['deleterevision']  = true;
$wgGroupPermissions['oversight']['hideuser'] = true;
$wgGroupPermissions['oversight']['suppressrevision'] = true;

$wgNamespaceProtection[NS_MAIN]      = array( 'edit-main' );
$wgNamespaceProtection[NS_TALK]      = array( 'edit-talk' );

require_once("extensions/Deleteuser/SpecialDeleteuser.php");
#require_once( "$IP/extensions/CentralNotice/CentralNotice.php" );
require_once("$IP/extensions/UserRightsList/UserRightsList.php");
#$wgGroupPermissions['sysop']['centralnotice_admin_rights']  = true;
require_once( "$IP/extensions/GroupPermissions/settings.php");
require_once( "$IP/extensions/GroupPermissions/GroupPermissions.php" );
include_once('extensions/FlaggedRevs/FlaggedRevs.php');

$wgShowExceptionDetails = true;

Thanks Paul 2387 12:25, 4 June 2010 (UTC)[reply]

windows XP installation

Hi! Today I installed windows xp from the CD in Pentium-III and Pentium-IV Pc. Windows are working properly in P-III but giving problem in P-IV.I again installed the OS in P-IV but it didnt work properly. The problem is that when i checked by going to device manager window, Ethernet Controller and PCI simple communicatiion controller is not installed. Moreover it gives the info that modem is removed, unavailable device COM1 for dial-up. So i'm unable to have dial-up connection and LAN connection too. Are there any drivers missing? I dont know much about it. Can anyone help me to sort out the problem? Moreover, as i did the installation of windows xp twice. So how can i delete the previous one. Cheers 221.120.250.83 (talk) 14:28, 4 June 2010 (UTC)[reply]

Windows doesn't always ship with device drivers for everything. It sounds like you don't have drivers for both the modem and the ethernet adapter. You can get drivers from their manufacturers, or from a disk that came with your computer. You may have to determine their model numbers (the device manager should tell you), go to the manufacturer's website (with another, network-working PC), download the drivers, move them over to the bad PC using a USB stick or a CD-R, and install from there. -- Finlay McWalter • Talk 14:35, 4 June 2010 (UTC)[reply]

ok Thanks.221.120.250.83 (talk) 14:43, 4 June 2010 (UTC)[reply]

Another alternative is to dig out a usb-wireless controller (one for which you have the disk), get it working and online, and then let the windows device manager search online for drivers. Once it's succeeded with that you can change to a wired connection. -- Finlay McWalter • Talk 14:49, 4 June 2010 (UTC)[reply]

Online sex talk with fire

I remember a transcription of an online or telephone sex chat which ended up with candles setting light to a room. It was funny rather than sexy. Can anybody give me a URL please? Kittybrewster ☎ 17:03, 4 June 2010 (UTC)[reply]

Weather site that doesn't hurt my eyes

The most popular weather websites all are terrible to look at. Is there a cleaner looking one out there somewhere? My current one is weather.com, but I affirmatively hate looking at it. The nicest solution so far is just googling my zip code and "weather," but it would be good to have something with hourly and 10-day forecasts. Thoughts? Calliopejen1 (talk) 19:08, 4 June 2010 (UTC)[reply]

Go straight to the source - NOAA!! You can get there by http://weather.gov or http://nws.noaa.gov - both of these websites are full of both "user-friendly" forecasts and data, and also full-blown scientific climate/weather databases and data dumps. They also have the best quality NEXRAD radar tools - http://radar.weather.gov/ - where you can get raw radar data for science, or more conventional "animations" like the always-updated National RADAR overlay animation. They are also responsible for the satellite imagery from GOES (see our article). You might be interested to know that all the commercial weather services are getting their forecasts, radar, imagery, and other weather data from the national weather service - and then they muck up the forecasts with cartoon animations, cartoon-drawings over the maps, advertisements, and "local flair" - but why use a middleman? The data is freely available from the National Weather Service. Nimur (talk) 19:48, 4 June 2010 (UTC)[reply]

I also prefer the NOAA's site because it doesn't exaggerate. When a big snow storm is approaching, all the local outlets compete to see who can predict the most snow and still keep a straight face. "We might be seeing Two to three Feet!" says one, "We're predicting twenty to forty inches!" says another. I just go to weather.gov and learn that they're predicting a modest 13 inches. That way I'm the only one not surprised when we only get about a foot of snow. APL (talk) 21:04, 4 June 2010 (UTC)[reply]

Lovely! I'd found weather.com rather annoying too. I'd never thought to go with anything else though. I'll be using this from now on too. -Amordea (talk) 14:27, 5 June 2010 (UTC)[reply]

Guide to changing from XP to Ubuntu

I've used XP for two or three years. Are there any quick guides that help a Windows user begin to use Ubuntu please? The things I'm interested in are firstly, copying and pasting files, creating new folders and so on. Secondly installing and uninstalling freeware software from the internet. Thirdly security like firewalls, anti-virus, and so on. Fourthly removing garbage as Ccleaner does. Thanks 92.15.21.188 (talk) 19:27, 4 June 2010 (UTC)[reply]

First of all, here is the Switching to Ubuntu from Windows guide. It is helpful and technical, but probably not the best "welcome to Ubuntu" guide. Check out the Ubuntu Desktop System Tour for an introduction to the basic system features. Now to address your points directly: (1) Copy/paste in Ubuntu is exactly like Windows - it works via the graphic interface and even shares the same default keyboard shortcuts ("ctrl-c" and "ctrl-v", among others, but you can change them if you prefer other shortcuts). Ubuntu uses the GNOME desktop by default, though you can change to KDE or other systems easily. GNOME provides familiar menus, similar to the Windows interface, so you can "right-click" and create folders, files, and so forth. Linux also provides powerful, built-in terminal (command line) support for technically proficient users - many options are available for your terminal. (2) Installing free software is easy using Ubuntu's built-in package manager, Synaptic. This "how-to" guide shows exactly how it works - you open it up, search for the program by name or by "functionality", and Ubuntu manages the package installation very seamlessly. Literally tens of thousands of free and open-source programs are available through this interfacing, providing "one-click installation" for all kinds of general purpose computing, audio/video/multimedia, technical/engineering/programming computing, graphic design, and so on. If Canonical (the company that distributes Ubuntu) does not provide that package directly, you can manually install using either a Debian package or a source build, but these are more difficult. (3) Security in Ubuntu is a little "different" than Windows, because Ubuntu is a Linux system. This means that "by default" the system is secured - it is already firewalled and protected from intrusion, as long as your login password is secure and you do not manually install a malicious program. This Ubuntu Security guide will walk you through how to install additional tools if you so desire - firewall management, "virus detection", and so forth are available for Ubuntu, but are "generally" redundant because the operating system already handles these details pretty well. Caveat - there is no substitute for careful, competent management of your computer system - it does not matter what operating system, security software, firewall, or other protection scheme you are using. I am not familiar with Ccleaner, so I'm not sure how to address your last point; but you can manage privacy settings in Ubuntu; if you so desire, you can set up encryption and strongly password your user account and hard-disk drive - this will render your private data totally impenetrable to the state-of-the-art attacks. Nimur (talk) 20:05, 4 June 2010 (UTC)[reply]

Typically novice users use Ubuntu Software Center rather than Synaptic, as it's organised thematically, and hides some of the technical details. A few things aren't available that way (often things that are freeware but not free software, like Skype and Google Earth) can easily be downloaded from their respective web pages (just like the Windows versions), and are easily installed using the package installer thingy that pops up when you double click them. All of this is as easy as doing the same task on Windows, and often easier. -- Finlay McWalter • Talk 21:01, 4 June 2010 (UTC)[reply]

free downloads of visual studio for C++

Can anyone please provide me with a safer link to free download Microsoft visual studio for C++?? On googling I found several links but these gave me mere viruses and trojans and nothing more. Thanks 221.120.250.83 (talk) 20:44, 4 June 2010 (UTC)[reply]

Microsoft calls it Microsoft Visual Studio Express C++ edition, and you get it from them. -- Finlay McWalter • Talk 20:52, 4 June 2010 (UTC)[reply]

Your entry, Finlay, made me reasilse that I mixed up two products. God bless edit conflicts ;) cheers, Ouro (blah blah) 20:55, 4 June 2010 (UTC)[reply]

Thanks but yaeh, Exactly! This is the first link on googling that gifted me the trojans.Thanks to my anti-virus, otherwise my system would have been corrupted. Can anyone give me **really** safer link please? 221.120.250.83 (talk) 21:18, 4 June 2010 (UTC)[reply]

That's Microsoft's own page; it doesn't have a virus. Either your anti-virus program is wrong, or you have a virus already. -- Finlay McWalter • Talk 21:27, 4 June 2010 (UTC)[reply]

Agreed. That is the official link for Microsoft's Visual Studio Express. If your antivirus is flagging it, it is your antivirus software that is incorrect or has been compromised by a previous infection. It's possible that your antivirus overzealously flags all unknown programs as "potential" hazards. Nimur (talk) 01:07, 5 June 2010 (UTC)[reply]

I'm having trouble with downloading it from microsoft website. when i reach its page and click the "Download" tab. It redirects to another page where i click "Visual C++ 2010 Express" afterwards it asks for the language selection. As soon as i select the language, it redirects to another page saying " Thanks for downloading". And nothing more. And then no setup on my PC at any location.What's wrong? 221.120.250.83 (talk) 12:07, 5 June 2010 (UTC)[reply]

When you pick the language, it should automatically start a download. If it doesn't, you may have script execution disabled, or the download may being blocked by anti-virus or personal firewall software. -- Finlay McWalter • Talk 13:08, 5 June 2010 (UTC)[reply]

You could select the All - Offline Install ISO image file option to download an iso without a downloading binary.Smallman12q (talk) 14:18, 5 June 2010 (UTC)[reply]

June 5

How are animations like this synced?

See this:

http://www.hoopsandyoyo.co.uk/pages/ecards.php?action=view&code=43&history=5

Out of curiosity, I decided to measure how many thank you's are coming out per second. I got:

12.00 +- 0.01 per second 11.970 +- 0.001 per second 11.983 +- 0.001 per second

Why would the rate vary? I used the computer clock for time, so if it's synced with the computer's clock, the rate should stay constant within experimental error. --Bowlhover (talk) 02:55, 5 June 2010 (UTC)[reply]

You should note that you can write

12.00 ± 0.01

instead of 12.00 +- 0.01.

Or if you must write plus followed by minus, you can write

12.00 + − 0.01

i.e. a minus sign is not just a stubby little hyphen. Michael Hardy (talk) 04:04, 5 June 2010 (UTC)[reply]

What a useful reply, Michael! Aaadddaaammm (talk) 08:47, 5 June 2010 (UTC)[reply]

There are a number of possible sources of timing jitter (which is responsible demands a considerable degree of analysis of a specific case). Disk, cpu-cache, memory, memory cache, system bus, video, and audio transactions are all prone to jitter, as they involve physically distinct electronic objects communicating asynchronously across a (comparatively) large distance. Your operating system is a major cause: dozens or hundreds of other activities are also vying for the CPU's time (and for other resources like those I listed above), which while invisible and mostly trivial still cause timing jitter. The specific thing you linked to is written in Adobe Flash, which uses a garbage collector to manage and reclaim memory - GCs are a common cause of (these days generally small) delays, the nature and pattern of which is quite complex (it depends on the allocation strategy of the program(s) using it, and the often quite intricate collection scheme). All of this happens because, for cases like this, the jitter doesn't matter. Where cases where precise timing is necessary, a real time operating system is used (or the RTOS-like features that some full-featured OSes have), with software that is similarly strict about adhering to a rigid timebase. -- Finlay McWalter • Talk 14:01, 5 June 2010 (UTC)[reply]

reporting a bug in google

Where do I report a bug in the Google search engine? Michael Hardy (talk) 04:02, 5 June 2010 (UTC)[reply]

A bug? Probably best to make a post at Google's Unexpected Results forum.Smallman12q (talk) 14:10, 5 June 2010 (UTC)[reply]

Single Vs Dual Core Processors

A game I want to play requires a 3 GHz Intel Pentium 4 processor. My laptop has an Intel Pentium Dual Core CPU at 2.16 GHz and 2.17 GHz.

Does that mean my laptop would be able to play the game?

My laptop meets all other requirements about operating system, RAM, ROM and video card memory.

Does my dual core processor equate to a 2.16 GHz + 2.17 GHz = 4.33 GHz single core processor?

•• Fly by Night (talk) 12:37, 5 June 2010 (UTC)[reply]

The short answer is yes, your CPU can handle it.

There is a misunderstanding that the higher the clock rate, the faster the CPU. This is called the megahertz myth. However it also has to do with the architecture and what techniques are used to handle the data. The Pentium Dual Core is considerably newer technology and has several new instructions that the Pentium 4 does not.

The technology is such that growth has been more horizontal than vertical in the past few years, as around 4GHz or so, the heat buildup becomes so dramatic that it is not cost-effective to come up with cooling solutions to deal with it.

To answer your other question regarding a comparison of dual-core and single core, the short answer is: not exactly. It's very hard to draw a comparison because the programs running in a dual-core setup have to be programmed to make use of those two or more cores (most modern software has this functionality if needed, such as almost any modern game). So how well it functions on multiple cores really depends on the program itself. Ideally, it should, but in reality it is often not as quick in terms of clock speed. Remember, though, that the architecture is superior in the newer Pentiums, and so that will absolutely make your processor much faster than a Pentium 4 with 4.33GHz. -Amordea (talk) 13:29, 5 June 2010 (UTC)[reply]

Doing a little bit more research reveals the article Multi-core processor which will explain things better than I did. -Amordea (talk) 13:54, 5 June 2010 (UTC)[reply]

Thanks a lot; that was a perfect answer! •• Fly by Night (talk) 14:02, 5 June 2010 (UTC)[reply]

I would, however, still be concerned: not about the CPU but the GPU. Graphics memory is one thing, but which graphics controller the laptop has is an issue. Many laptops ship with an integrated GPU, which can lag dedicated desktop GPUs by a generation of performance - that's because many laptops are just targeted at business people using Word and email and the web, who have no business case for performant 3d graphics. Some laptops do ship with pretty decent video adapters (as they recognise that many laptop uses do care about games). So check whether the GPU is sufficient too. In practice most games suffer worse if the GPU is sub-par than if the CPU is. -- Finlay McWalter • Talk 14:11, 5 June 2010 (UTC)[reply]

That's a very good point and I should have thought about that. If the OP returns, could he relay to us what graphics chipset he's using? -Amordea (talk) 14:20, 5 June 2010 (UTC)[reply]

I have a Mobile Intel 965 Express Chipset Family. I have 128 MB System Video Memory and 230 MB of Shared System Memory; giving 358 MB of Total Available Graphics Memory. The game asks for 128 MB of Video Card Memory. I am using a Dell Inspiron 1525. •• Fly by Night (talk) 14:36, 5 June 2010 (UTC) Come to think of it; I have managed to play Spore perfectly on my laptop, and it too asks for 128 MB of Video Card Memory. (But only a 2 GHz processor). •• Fly by Night (talk) 14:41, 5 June 2010 (UTC)[reply]

This game may or may not be playable on your system (it's not officially supported). The Intel GMA series is definitely not intended for gaming, although can run some less intensive games acceptably. You may have a X3100 graphics adapter, which seems roughly equivalent to some of the low-budget GeForce 6-series (like a 6100 or a 6200, which is right near the minimum requirement). It may run, but I would not be surprised by some chop and slowdown when a lot of rendering is required at once. -Amordea (talk) 15:29, 5 June 2010 (UTC)[reply]

Just beware, being as it's not officially supported it may simply crash. I had this experience with my dad's old Dell which had an Intel chipset. When I tried to install Portal for him to play, it would load up and render but then crash always when trying to step through a portal, making the game unplayable. A driver update did not fix this problem. -Amordea (talk) 15:33, 5 June 2010 (UTC)[reply]

You're exactly right: my Adapter String is Mobile Intel GMA X3100. I paid to download the game before Finlay McWalter mentioned the GPU problems. I've finished the download, and even with the graphics detail set to low, it is really jerky. It's a scrolling landscape type game, and so is constantly rendering. It's really annoying, and almost unplayable. It's my own fault; I should have waited. Thanks for all your help. •• Fly by Night (talk) 16:03, 5 June 2010 (UTC)[reply]

Ach! My apologies. I wish I had thought of that sooner. Didn't even pass through my mind when you mentioned that all the other specs were clear, but should have as the GPU has a far greater effect on the performance of games than the CPU. -Amordea (talk) 16:15, 5 June 2010 (UTC)[reply]

No need to apologise! Like I said: it was my fault. Thanks again for all of your help :-) •• Fly by Night (talk) 16:21, 5 June 2010 (UTC)[reply]

Easy backing up to a writeable CD

I use XP. I would like to be able to put a writeable CD in the drive, click on something, and have the program backup to that without any further bother. Is there any free software that can do that, that people would recommend please? Thanks 92.15.0.59 (talk) 12:46, 5 June 2010 (UTC)[reply]

Difference between Windows and Linux

Are there any very brief online guides that describe the differences between Windows and Linux please? I use XP, I'm thinking of migrating to Ubuntu. Thanks. 92.15.0.59 (talk) 12:48, 5 June 2010 (UTC)[reply]

You could start with Comparison of Windows and Linux. --Tagishsimon (talk) 13:04, 5 June 2010 (UTC)[reply]

Interesting, and I will read it thanks, but I was thinking more of what the fundamental system differences are about file organisation and so on. 92.15.0.59 (talk) 13:10, 5 June 2010 (UTC)[reply]

Filesystem Hierarchy Standard describes, at a very basic level, the structure of how things are generally laid out in a Linux system; it links to vaguely equivalent stuff for Windows. This will probably seem very uninformative; frankly I don't think the organisation of either file system is terribly enlightening, and doesn't address whether one should run Linux. I'd hazard that most Windows users have little idea where various kinds of files are stored, and one need not in Linux either. A modern Linux distribution has "home" "desktop" "music" "photos" etc. folders that are so strongly analogous to their Windows counterparts that you can think of them as being the same. -- Finlay McWalter • Talk 13:33, 5 June 2010 (UTC)[reply]

Is the hard drive file system the same? If you for example took a second drive out of a Windows XP computer and put it inside a Linux computer, would it be accessable, or would you have to reformat it? I remember reading that you had to "mount" drives in Linux, what was all that about? Thanks 92.24.182.48 (talk) 16:08, 5 June 2010 (UTC)[reply]

Linux uses a variety of file systems but you'll probably end up with ext4 or maybe ext3 as your main partition. The good news is that Linux will read and write Windows' NTFS and fat32 file systems too. Windows will not natively read Linux partition formats, although (apparently) limited support is available from third-party plugins. See Comparison of file systems#Supporting operating systems for the compatibility matrix. -- Finlay McWalter • Talk 16:24, 5 June 2010 (UTC)[reply]

"mount" sounds fancier, and perhaps scarier, than it really is. It just means the process of making the filesystem on a disk visible in Linux. The setup program will make sure that other filesystems on fixed disks are automatically mounted at bootup time, and another system makes sure that filesystems on removable media (memory sticks, mp3 players, cameras, CDs, DVDs) are automatically mounted when they're plugged in or inserted. Things pretty much "just work". -- Finlay McWalter • Talk 16:54, 5 June 2010 (UTC)[reply]

Star ratings in YouTube

YouTube used to have star ratings by users for all its videos, which I found interested and useful. Some time ago they disapeared - at least for me. I cannot see any, either using Internet Explorer or using Firefox with everything disabled. Why cannot I see them please? The approve or disaprove buttons are still there, but not the red star ratings anymore. I run XP. Thanks. 92.15.0.59 (talk) 13:27, 5 June 2010 (UTC)[reply]

Lol...this isn't a bug...but apparently an "upgrade". Youtube removed the stars after coming to the conclusion that its ratings weren't working. Although the stars are officially gone, you can install addons/scripts that will put them back.14:15, 5 June 2010 (UTC) —Preceding unsigned comment added by Smallman12q (talk • contribs)

Thanks, I've installed the Firefox addon that shows them. I prefer the earlier version of YouTube, and I prefer the earlier version of Wikipedia too. 92.24.182.48 (talk) 16:03, 5 June 2010 (UTC)[reply]

Ye...you're not alone... To use the earlier version of wikipedia though, you'll need to log in.Smallman12q (talk) 16:07, 5 June 2010 (UTC)[reply]

Win Vista Not Booting

Since last night, Vista has been playing up. For around 2 hours the CPU started going crazy, jumping between 0% and 100% and any point in between very randomly. I looked at the processes, and everything was 'normal'. Only the CPU had gone haywire. Then, for some reason, my HDD space magically went down to 2.6GB. TreeSize told me there was 7.1GB left, and something else said there was 6GB. In actual fact there should be around 18GB left (there was last time I looked). Anyway, I uninstalled a few programs (all games), and - as very often happens with Vista - I got one which refused to finish uninstalling. Basically, after everything is done uninstalling the entry remains in my list of programs and when I try to uninstall another program I just get the message 'Wait until the last program has finished uninstalling'. I left it on and went to bed. Waking up this morning, I still got the same message, so I switched off Vista and went into Ubuntu. After trying to go back into Vista this afternoon, I have been unable to. After the Microsoft loading bar, I get an extremely brief flash of the blue screen of death (so brief I can only just make out the colour), and I am sent back to the menu to choose my OS. I have tried the StartUp Repair option, and it didn't fix anything. I have booted from my RepairDisk Partition (whatever it's called - this computer didn't come with a disk, just a partition with some repair options on it), to no avail. I tried System Restore, but for some reason I don't have a restore point (I alwys have one - but now I don't....). I am back in Ubuntu now. I am wondering what there is I can do. Backing Up is not an option - no disk space and no external HD to put everything, and no disk to get Windows off anyway - plus I don't want to reinstall, I want to fix the problem. Any ideas? TIA! (PS A look at my recent earlier posts will reveal what I have been planning to do, i.e. get Ubuntu and Vista working together, but please do not misunderstand - I haven't even had the chance to start trying this yet, so this problem is unrelated to that.) --KägeTorä - (影虎) (TALK) 13:53, 5 June 2010 (UTC)[reply]

Not knowing what you have altered on your system, precisely, it is hard to say if the problem is software or hardware related. The reason the BSoD message is so brief is because by default, Windows is set to automatically restart upon crashing. Technibble has an article on how to turn off the automatic restart (hopefully you can still get into Safe Mode so you don't have to do this the long way) so you can read the error it generates and then report it to someone who can better assist you. -Amordea (talk) 16:12, 5 June 2010 (UTC)[reply]

Excellent, thanks. That's got me a step closer. I was able to get the blue screen to stay on, and the 'STOP' message was: 0x000000F4 (0x00000003, 0x8738DD90, 0x8738DEDC, 0x8202E710). I hope this helps..... Oh, and booting into SafeMode yields the same result as trying to boot normally. --KägeTorä - (影虎) (TALK) 16:30, 5 June 2010 (UTC)[reply]

"STOP Error 0x000000F4: CRITICAL_OBJECT_TERMINATION

STOP error 0xF4 means that a process or thread crucial to system operation has unexpectedly exited or been terminated. STOP code 0x000000F4 may also display "CRITICAL_OBJECT_TERMINATION" on the same STOP message."

Well that doesn't help a whole heck of a lot. It was pretty obvious that your OS wasn't booting properly. I'm going to go out on a limb and say that you may have deleted something you should not have, based on what you've told us about what you were doing before the crash occured. The HowTo Geek has an article on how to make a Vista Repair Disk, which may assist you in getting your operating system running again. Be sure you have the right one for your hardware's architecture, x86 or x64.

If you've been fiddling with any of your hardware recently, there was some indication on various forums that improperly-seated hardware or setting the jumper wrong on your hard drive could cause this error. If you haven't touched your hardware, then this is very unlikely to be a problem. -Amordea (talk) 17:04, 5 June 2010 (UTC)[reply]

open source software

What are the benefits of using open source software in an office? —Preceding unsigned comment added by Freddie ashlee (talk • contribs) 16:51, 5 June 2010 (UTC)[reply]

Lan Internet Protocol (IP) Address

What is LAN ip ?? What role does it play in comparision to your actual ip address?? How do we find out our Lan IP ?? —Preceding unsigned comment added by Sushil shenoy (talk • contribs) 17:18, 5 June 2010 (UTC)[reply]

How do i make my Laptop a WIFI Hotspot?

How do i make my Laptop (TOSHIBA SATELLITE PRO A100) a Wifi Hotspot so as to be able to browse the net on my mobile (NOKIA N 97) ?? I tried AD-HOC, and it didn't work ..... Is there any other method ???

Details OS : Windows XP Professional SP2

Wireless Card: Intel(R) PRO/Wireless 3945ABG

Specs: 2.00 GHz, 2.50 GB RAM

Is there any other information you need ?? —Preceding unsigned comment added by Sushil shenoy (talk • contribs) 17:32, 5 June 2010 (UTC)[reply]

May 31

Partitioning NTFS Drive

AUTOCAD 2009

Firefox bookmarks toolbar

Using Graphics in Java

Environment Variables in Windows Shortcuts

The boot partition in XP seems to have been changed...

Port forwarding in Ubuntu II

Supercomputers for financial services, not banking

Quick compact operating system

Google Desktop - Deleting

read more

Password

ITV rugby

Netbook running XP

June 1

Computer graphics

Problems with Ubuntu Live CD

Enough power for USB 2?

"In the news" archive

Socially engineered malware

rss

Excel - Inserting a link, programatically

June 2

Round corners for IE

Safari 'Tabs'

Why Mac Address alone is not Sufficient ? why do we need IP Address ?

Windows Server Update Services

Poppler binary for Windows

Code cracking...

/dev/random and OpenBSD

creating or assmebling a Pdf document using free software

problem adding to a home network

Find the contents of a div in arbitrary html using javascript

Citation highlighting

Program with Templates

June 3

File Association

Do intel cores automatically have centrino inside?

cryptography- software to analyse code?

Lian Li power supply not turning on

June 4

CPU Temperatures

Craigslist

Resting web pages - blocking AJAX requests

Running A 2nd Partition in VirtualBox?

Page History on Private wiki

windows XP installation

Online sex talk with fire

Weather site that doesn't hurt my eyes

Guide to changing from XP to Ubuntu

free downloads of visual studio for C++

June 5

How are animations like this synced?

reporting a bug in google

Single Vs Dual Core Processors

Easy backing up to a writeable CD

Difference between Windows and Linux

Star ratings in YouTube

Win Vista Not Booting

open source software

Lan Internet Protocol (IP) Address

How do i make my Laptop a WIFI Hotspot?