Jump to content

Haplogroup Q-M242: Difference between revisions

From Wikipedia, the free encyclopedia
Browse history interactively
← Previous editNext edit →
Content deleted Content added
VisualWikitext
BG19bot (talk | contribs)
1,005,055 edits
m WP:CHECKWIKI error fix for #61. Punctuation goes before References. Do general fixes if a problem exists. -, replaced: {{Reflist|colwidth=30em}} → {{Reflist|30em}}
Nusdlog1 (talk | contribs)
105 edits
add information on Norse Q(related to Vikings)
Line 206: Line 206:
In [[Northern Europe]], haplogroup Q comprises about 2.5% of males. According to Swedish Haplogroup Database, 4.1%(27/664, as of Jan 2016) of [[Sweden]] males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. To speak by county, they distribute intensively in the southern region([[Götaland]]: Do not confuse it with Gotland Islands), rarely to the north. The highest frequency of Q is shown at 20% in [[Halland County|Halland]] County, followed by 14.3% in [[Jönköping]], 12.5% in [[Kronoberg]], 12.5% in [[Västmanland]], 8.7% in [[Gävleborg]], 4.3% in [[Västra Götaland]], 4% in [[Stockholm]], 3.9% in [[Skåne]], and so on.<ref>http://dna.scangen.se/index.php?show=stats&stat=haplo2&database=shd&haplo_level=1&lang=en</ref> If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.
In [[Northern Europe]], haplogroup Q comprises about 2.5% of males. According to Swedish Haplogroup Database, 4.1%(27/664, as of Jan 2016) of [[Sweden]] males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. To speak by county, they distribute intensively in the southern region([[Götaland]]: Do not confuse it with Gotland Islands), rarely to the north. The highest frequency of Q is shown at 20% in [[Halland County|Halland]] County, followed by 14.3% in [[Jönköping]], 12.5% in [[Kronoberg]], 12.5% in [[Västmanland]], 8.7% in [[Gävleborg]], 4.3% in [[Västra Götaland]], 4% in [[Stockholm]], 3.9% in [[Skåne]], and so on.<ref>http://dna.scangen.se/index.php?show=stats&stat=haplo2&database=shd&haplo_level=1&lang=en</ref> If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.


In [[Norway]], Q-M242 is found in about 2.6% of males, with Q-L804 being more common than Q-F1161/L527.<ref name=FT-DNA/> It is observed among 1.6% of males in [[Denmark]], 3% in [[Faroe Islands]].<ref>Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.</ref> On the other hand, it is 0.2% in [[Finland]], 4.6% in [[Latvia]], 1.1% in [[Lituania]], 0.5% in [[Estonia]].<ref name=FT-DNA/>
In [[Norway]], Q-M242 is found in about 2.6%(~4%<ref name=Faux2007/>) of males, with Q-L804 being more common than Q-F1161/L527.<ref name=FT-DNA/> It is observed among 1.6% of males in [[Denmark]], 3% in [[Faroe Islands]].<ref>Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.</ref> In an article(Helgason et al.) on the haplotypes of Iceland people, 7.2%(13/181) of [[Iceland]] males are labelled as R1b-Branch A, but they are actually Q-M242.<ref>http://www.davidkfaux.org/shetlandhaplogroupR1a.html</ref> <ref name=Faux2007/> On the other hand, it is 0.2% in [[Finland]], 4.6% in [[Latvia]], 1.1% in [[Lituania]], 0.5% in [[Estonia]].<ref name=FT-DNA/>


====Western Europe====
====Western Europe====


In [[Western Europe]], Q-M242 is observed at very low frequencies around 0.5% in most of the countries such as Germany, France, Britain, etc., but some regions show a little higher. It is 2.1% in [[Swiss]],<ref name=FT-DNA/> and it reaches 5.1% in [[Lyon]]([[Rhône-Alpes]]) region of [[France]].<ref name=Wiik2008>Kalevi Wiik, Where did European Men Come From?, Journal of Genetic Genealogy 4(2008):35-85</ref>
In [[Western Europe]], Q-M242 is observed at very low frequencies around 0.5% in most of the countries such as Germany, France, Britain, etc., but some regions show a little higher. It is 2.1% in [[Swiss]],<ref name=FT-DNA/> and it reaches 5.1% in [[Lyon]]([[Rhône-Alpes]]) region of [[France]].<ref name=Wiik2008>Kalevi Wiik, Where did European Men Come From?, Journal of Genetic Genealogy 4(2008):35-85</ref> It is about 4% in [[Shetland Islands]] of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of [[Vikings]]. And, surprisingly, Q-M242 in Shetland(including some Scandinavia, Faroe Islands, Iceland, and Britain) is turned out to be generically closely linked to the Q-M242 in Central Asia, which means that Norse came from there. Also, Shetland([[Norsemen|Norse]]) Q-M242 is revealed to be linked to the Azeri([[Azerbaijan]]) Q-M242.<ref name=Faux2007>David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf</ref>


====Southern Europe====
====Southern Europe====

Revision as of 15:45, 3 March 2016

Haplogroup Q
Possible time of origin17,000 to 22,000 years ago[1][2](In another data, 31,700YBP)[3]
Possible place of originCentral Asia,[4][5] Siberia[6]
AncestorP
DescendantsQ-P36.2 (P36.2)
Defining mutationsM242
Highest frequenciesKets, Inuit, Selkups, and the indigenous peoples of the Americas

Haplogroup Q-M242 is a Y-chromosome DNA haplogroup.

Origins

Haplogroup Q-M242 is one of the two branches of haplogroup P-M45. Haplogroup Q-M242 is believed to have arisen around the Altai Mountains area(or South Central Siberia),[2] approximately 17,000 to 22,000 years ago.[7] (In another source, 31,700YBP)[3] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of the M242, P36.2, and MEH2 SNPs as defining mutations.

This haplogroup has over a dozen subclades that have been sampled and identified in modern populations. Also, there are very diverse sub-haplotypes.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

Subclades

In Y-chromosome phylogenetics, subclades are the branches of a haplogroup. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q-M242, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.

Phylogenetic trees

There are several confirmed and proposed phylogenetic trees available for haplogroup Q-M242. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.

The Genomic Research Center Draft tree

This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q-M242. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.[8]

  • P
    • Q-M242 M242
      • P36.2, L232, L273.1, L274.1

The Y-Chromosome Consortium tree

This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[7] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[9] The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

The 2015 ISOGG tree

The subclades of Haplogroup Q-M242 with their defining mutation(s), according to the 2015 ISOGG tree are provided below. The first three levels of subclades are shown. Additional detail is provided on the linked branch article pages.

Phylogenetic variants

The subclade(under Q-MEH2) proposed by Sharma 2007, which shows polymorphism(ss4bp, rs41352448) at 72,314 position of human arylsulfatase D psuedogene, is not represented in any current trees under Q-MEH2.[10] The most plausible explanation for this could be an ancestral migration of individuals bearing Q-MEH2 to the Indian subcontinent followed by an autochthonous differentiation to Q-ss4bp.[5]

Distribution

Haplogroup Q-M242 is one of the most widely distributed Y-chromosome lineages in the modern world. It is found in Americas, Asia, Europe, and North Africa.

Americas

Further information: Indigenous Amerindian genetics and Y-DNA haplogroups in Indigenous peoples of the Americas

Several branches of haplogroup Q-M242 have been predominant pre-Columbian male lineages in indigenous peoples of the Americas. Most of them are decendents of the major founding groups who migrated from Asia into the Americas by crossing the Bering Strait.[2] These small groups of founders must have included men from the Q-M346, Q-L54, Q-Z780, and Q-M3 lineages. In the North America, two other Q-lineages also have been found. These are Q-P89.1(under Q-MEH2) and Q-NWT01. They may have not been from the Beringia Crossings but instead come from later immigrants who traveled along the shoreline of Far East Asia and then the Americas using boats.

It is unclear whether the current frequency of Q-M242 lineages represents their frequency at the time of immigration or is the result of the shifts in a small founder population over time. Anyway, Q-M242 came to dominate the paternal lineages in the Americas.

North America

In the indigenous people of the North America, Q-M242 is found in Na-Dené speakers at an average rate of 68%. The highest frequency is 92.3% in Navajo, followed by 78.1% in Apache,[2] 87%[2] in SC Apache,[11] and about 80% in North American Eskimo–Aleut populations.(Q-M3 occupies 46% among Q in North America)[12]

On the other hand, a 4000-year-old Saqqaq individual belonging to Q1a-MEH2* has been found in Greenland. Surprisingly, he was turned out to be generically more closely related to Far East Siberians such as Koryaks and Chukchi people rather than native Americans.[13] Today, the frequency of Q runs at 53.7%(122/227: 70 Q-NWT01, 52 Q-M3) in Greenland, showing the highest in East Sermersooq at 82% and the lowest in Qeqqata at 30%.[14]

Q-M242 is estimated to occupy 3.1% of the whole US polulation in 2010 : According to the US National Population Census data(2010),[15] the frequency of White people(xHispaic) is 63.7%, followed by Hispanic 16.3%, Black 12.6%, Asian 4.8%, Native American(Mainland+Alaska, not including the Pacific islands) 0.9%, etc. And haplogroup Q frequencies in each population sectors are Q-P36* 0.6% & Q-M3 0.1% in White American, Q-P36* 3.8% & Q-M3 7.9% in Hispanic American, Q-P36*(xM3) 0.2% in African American, Q-P36* 31.2% & Q-M3 26.9% in Native American.[16] So, recalculated by the population weights of each sector, the frequency of Q-M242 in the US reaches 3.1% as of 2010.(This figure will rise up, as Hispanic population in the US increases.)

Meso and South America

Haplogroup Q-M242 has been found in approximately 94% of Indigenous peoples of Mesoamerica and South America.[17]

Today, in Mesoamerica and South America, the frequencies of Q-M242(mostly M3) in the whole male population of each country run by far higher than in the North. The frequency of Q reaches 61% in Bolivia.[18] It is about 51% in Guatemala,[19] 40.1%(159/397)[20]~50% in Peru, 37.6% in Ecuador,[21] 37.3%(181/485) in Mexico[20] and 30.8%(203/659) in Mexican-Mestizos,[22] 31.2%(50/160) in El Salvador,[23] 15.3%(37/242)~21.8%(89/408) in Panama,[20][24] 16.1% in Colombia,[25] 15.2%(25/165) in Nicaragua,[26] 9.7%(20/206) in Chile,[20] 5.3%(13/246 : 8 provinces in Northeastern, Central, Southern regions)[27]~23.4%(181/775 : 8 provinces in central-west, central, northwest regions)[28] of Argentina, 5% in Costa Rica,[29] 3.95% in Brazil,[30] and so on.

Upon these data, the average frequency in the whole population of Meso & South America is estimated to be about 18%.

Asia

Q-M242 originated in Asia(Altai regions), and is widely distributed across it.[2] Q-M242 is found in Russia Siberia(Altai people,[31] Tuvans,[32] Kets, Selkups, Koryaks, etc.) Mongolia,[33] China,[34][35] Uyghurs,[33] Tibet,[36] Korea, Japan, Vietnam,[37] India,[38] Pakistan,[38] Afganistan, Iran, Iraq, Saudi Arabia, Turkmenistan, Uzbekistan, and so on.(For details, see below.)

North Asia

In Siberia, the regions between Altai and Lake Baikal, which are famous for many prehistoric cultures and as the most likely birthplace of haplogroup Q, exhibit high frequencies of Q-M242. In a study(Dulik2012),[39] Q-M242(mostly Q-M346 including some Q-M3) has been found in 24.3%(46/189 : 45 Q-M346, 1 Q-M25) of all Altaian samples. Among them, Chelkans show the highest frequency at 60.0%(15/25 : all Q-M346), followed by Tubalars at 41%(11/27 : 1 Q-M25, 10 Q-M346) and Altaians-Kizhi at 17%(20/120). In a former study, Q-M242 is found in 4.2% of Southern Altaians and 32.0% of Northern Altaians with the highest frequency of 63.6% in Kurmach-Baigol(Baygol). The frequency reaches 13.7%(20/146) in the whole samples.[31] In another study,[40] the frequency rises up to 25.8%(23/89 : all Q-M346) in Altaians. Upon the results of these studies, the average frequency of Q-M242 in Altaians is about 21%.

Tuva, which is located on the east side of Altai Republic and west of Lake Baikal as well as on the north side of Mongol, shows higher frequency of Q-M242. It is found in 16%[32]~38.0%(41/108)[40] of Tuvans. Also, Todjins in eastern Tuva Republic shows the frequency of 38.5%(10/26, all Q-M346).[40] So, the average frequency of Q-M242 in Tuva is about 31%.

The highest frequencies of Q-M242 in Eurasia are witnessed in Kets(central Siberia) at 93.8%(45/48) and in Selkups(north Siberia) at 66.4%(87/131).[41] Russian ethnographers believe that their ancient places were farther south, in the area of the Altai and Sayan Mountains.[2](Altai-Sayan region) Their populations are currently small in number, being just under 1,500 and 5,000 respectively. However, in linguistic anthropology, Ket is very important in that the ancient Xiongnu( and the Hun) are believed to speak such a Yeniseian language as the Ket one.(cf. L. Lieti, E. Pulleybank, A. Vovin, etc.) Q-M346 is also found at lower rates in Sojots(7.1%, Q-M346), Khakassians(6.3%, Q-M346), Kalmyks(3.4%, Q-M25, Q-M346)[40] and Khanty,[42] and so on.

In Far East Siberia, Q-M242 is found in 35.3% of Nivkhs(Gilyaks) in Lower Amur River, and 33.3% of Chukchi people and 39.2% of Siberian Eskimos in Chukotka(Chukchi Peninsula).[43] It is found in 30.8% of Yukaghirs who live in the basin of the Kolyma River, which is located northwest of Kamchatka.[32] It is also found in 15%(Q1a* 9%, Q-M3 6%) of Koryaks in Kamchatka.[44]

East Asia

In some studies, various subgroups of Q-M242 are observed in Mongolia. Q1a2-M346(mostly Q-L330) occupies 1.4[20]~3.1%[44] of Mongol people(1/2~2/3 among Q samples), followed by Q1a1a1-M120(0.25[20]~1.25%[44]), Q1a1b-M25(0.25[20]~0.63%[44]), Q1b-M378. In another study, Q is found in 4% of Mongol people.[17] Upon these studies, the average frequency of Q-M242 in Mongol is estimated to be about 4~5%.

However, most of Q-M242 people in East Asia belong to subclade Q-M120, which distributes most intensively across northern China. Q-M242 ranged from 4~8% in northwest China(Xinjiang, Gansu, Shaanxi), north China(Shanxi, Hebei), central China(Henan, Hubei), and upper east China(Anhui, Shandong, Jiangsu) to 3~4% in northeast China(Manchuria). The average frequency of Q-M242 in northern China is around 4.5%. But, it decreases to about 2% in southern China.[34][35] In a study published in 2011, researchers have found Q-M242 in 3.3% (12/361) of the samples of unrelated Han-Chinese male volunteers at Fudan University in Shanghai with the origins from all over China, though with the majority coming from East China.[45]

Q-M242 is found in about 9.5% of Uyghurs,[46] with Q-M346 occupying the half and followed by Q1*, Q-M120, Q-M346, Q-M25. It is also found in approximately 3.2%(5/156 : 2 Q-M120, 3 Q-M346) of males in Tibet.[36]

It is found in about 1.9% of South Koreans,[47][48][49] showing the highest frequency in Seoul&Gyeonggi Province at 2.7% and decreasing ones to the south(Kim 2010). It is about in 0.5% of Japanese [50] and in 0.3%[51]~1.2%[52] of Taiwanese.

Subclade Q1b-M378 is also found in China and its neighboring countries at very low frequencies. It exists throughout all Mongolia, with rare examples in Japan.[53]

Southeast Asia

Haplogroup Q shows low frequencies in Southeast Asia. In a study,[54] the frequencies of haplogroup Q is 5.4%(2/37) in Indonesia, 3.1%(2/64) in Philippines, 2.5%(1/40) in Thailand. But, other studies show 0% or near 0% frequencies in those countries.[51] In case of Vietnam, the frequency is 7% in a study,[55] but 0% or under 1% in other studies.[51][54] So, it is hard to define average friquencies. But, it is safer to say that southeast Asia generally shows very low frequency(about 0.5%~1%) of Q-M242, and Mainland regions show higher frequencies than Island ones.

Only some regions and ethnic groups in the Mainland show high frequencies. Q-M242 is found in 2.8%(3/106, all Q-M346) in Myanmar, and all the Q samples are concentrated in Ayeyarwady(2/11) and Bago(1/14) regions in southwest Myanmar.[56] And, Q-M242 is found in 55.6%(15/27) in the Akha tribe in northern Thailand.[51] The Akha are known to have moved from southern China(east Tibet and Yunnan) to Southeast Asia over the past centuries, and to have originated from a northern area such as Mongolia or Manchuria long time ago.[57]

Central Asia

In central Asia, the southern regions show higher frequencies of Q than the northern ones. In the northern regions, Q-M242 is found in about 2%[58]~6%[59][60](average 4%) of Kazakhs. It is found in about 2% of Kyrgyz people.[44][59][60]

In the southern regions, Q-M242 is found in 5%[61]~6%[59][60] of Tajiks(Tajikistan), and in about 8.3% of Uzbeks[44][62] In case of Turkmenistan, the frequency is not clear, but it can reach about 40% in light of the frequencies(34%~43%) in Turkmens of Afganistan and Iran who live in the areas adjacent to Turkmenistan.

Southwest Asia

Southwest Asia exhibits high frequencies of Q in northern Iran, and gradually lowering ones to the southwest.

Q-M242 accounts for 5.5%(52/938) in Iran according to Grugni 2012, which shows a large and well allocated sampling. The Q samples(52) in the study consist of various subclades such as Q*(3), Q-M120(1), Q-M25(30), Q-M346(8), Q-M378(10). The highest frequency is at 42.6%(29/68, all Q-M25) in Turkmens of Golestan, followed by 9.1% in Isfahan, 6.8% in Khorasan, 6% in Lorestan(Luristan), 4.9% in Azarbaijan Gharbi, 4.5% in Fars, and so on.[63] Turkmens are known as the descendants of Oghuz Turks who built many Turkic empires and dynasties. Other studies also show similar frequencies.[64][65][66]

In a study(Zahery 2011), the frequency of Q is 1.9%(3/154: all Q-M378) in Iraqis(x Marsh Arabs), and 2.8%(4/143: 1 Q-M25, 3 Q-M378) in Marsh Arabs who are known as the descendants of ancient Sumerians.[67]

Approximately 2.5%(4/157: 3 Q*, 1 Q-M346) of males in Saudi Arabia belong to haplogroup Q. It also accounts for 1.8%(3/164: 2 Q*, 1 Q-M346) in the United Arab Emirates and 0.8%(1/121: Q*) in Oman peoples.[68][69]

Haplogroup Q-M242 has also been found in 1.1%(1/87, Q-P36) Syrians[55] and 2.0%(18/914, 14 Q*, 4 Q-M25) in Lebanese.[70]

Approximately 2%(10/523: 9 Q*, 1 Q-M25) of males in Turkey belong to haplogroup Q.[71] In a study(Gokcumen 2008), it was found that among Turks who belong to the Afshar tribe(one of Oghuz Turks) haplogroup Q-M242 is seen with a prevalence of 13%.[72]

South Asia

Q-M242 accounts for 6.9% of Afghans in a study (Haber 2012). In this study, 18.4%(9/49: 8 Q*, 1 Q-M346) of Pashtuns, the largest ethnic group in Afghanistan, are turned out to be haplogroup Q.[73] In another study(Cristofao 2013) with a large sampling, the frequency of Q rises to 8.9%(45/507). In this study, Turkmens of Jawzjan province which is neighboring to Turkmenistan show the highest frequency at 33.8%(25/74: 23 Q-M25, 2 Q-M346), followed by Uzbeks at 8.7%(11/144: 6 Q*, 1 Q-M25, 4 Q-M346).[44] If the results of these studies are aggregated and recalculated by population weights of each ethnic group, the frequency of Q in Afghan males will be 6.3%.[74]

In Pakistan at the eastern end of the Iranian plateau, the frequency of haplogroup Q-M242 is about 2.2% (14/638)[75]~3.4% (6/176).[76]

In a study(Sharma2007), Q-M242 is observed in 2.38%(15/630) of Indian people belonging to different regions and social categories. What is interesting is 14/15 samples do not belong to any known subgroups of Q-M242, with 4 among them showing novel(Indian-specific) ‘ss4bp’ allele under Q-MEH2. This study also reflects the results of some former studies(Sengupta 2006, Seielstad 2003). And, the accumulated result(frequency) of 3 studies is turned out to be 1.3%(21/1615), with 11 out of 21 Q samples ranked as high Caste in social category.[5] In another regional studies on India, Q-M242 is found in 2.8%(8/284, all Q-M346) of Gujarat(west India) people[77] and in 6.1%(3/49) of Hindus in New Delhi, the capital of India.[78]

1.2% of Nepalese people in Kathmandu,[36] the capital of Nepal, are in Q-M242.

In a study in which Q-M242 is just classified in P* group, P*(x R1, R2) accounts for 9.7%(23/237: Chakma 13/89, Marma 4/60, Tripura 6/88) in 3 ethnic groups of Bangladesh.[79] In many cases, all or most of P*(x R1, R2) means Q-M242, and thus most of P*(9.7%) samples in that study can be estimated to be Q-M242.

3.3% of Sri Lankans[55] are also in Q-M242.

Europe

Q-M242 distribute across most of European countries at low frequencies, which decrease to the west and to the south.

Eastern Europe

In Eastern Europe, Q-M242 comprises about 1.7% of males. Q-M242 is found in about 2% of Russians,[80] 1.5% of Belarusians,[81] 1.3% of Ukrainians[82] 1.3% of Poles(Poland),[82] 2% of Czechs,[83] 1.5% of Slovakians,[82] about 2.2% of Hungarians,[82][84] 1.2% of Romanians,[82] 0.8% of Moldavians,[85] and 0.5%(4/808: 2 Q-M378, 1 Q-M346, 1 Q-M25) of Bulgarians[86] On the other hand, 3.1% of Szeklers from Transylvania(who have claimed descendants of Attila’s Huns) are turned out to be P*(xR1-M173),[87] which virtually means Q-M242. In a related DNA Project of FT-DNA, the frequency of Q-M25 in Szekelys(Szeklers) reaches 4.3%.[88][89]

Caucasus Region shows the frequency at 1.2% in a study,[65] but It may reach over 4% in Azarbaijan, in that 4.8% of the neighboring Azeris in Iran harbor Q-M242.[64] It is 1.3% in Georgians and Armenians respectively, and Armenian subclades consist of Q-M378(L245), Q-M346, and Q-M25.[82]

Northern Europe

In Northern Europe, haplogroup Q comprises about 2.5% of males. According to Swedish Haplogroup Database, 4.1%(27/664, as of Jan 2016) of Sweden males belong to Q-M242. About 2/3 of the samples analyzed subclades in detail belong to Q1a2b-F1161/L527 and about 1/3 are in Q1a2a-L804. To speak by county, they distribute intensively in the southern region(Götaland: Do not confuse it with Gotland Islands), rarely to the north. The highest frequency of Q is shown at 20% in Halland County, followed by 14.3% in Jönköping, 12.5% in Kronoberg, 12.5% in Västmanland, 8.7% in Gävleborg, 4.3% in Västra Götaland, 4% in Stockholm, 3.9% in Skåne, and so on.[90] If recalculated by county-population weights, the frequency of Q in Sweden reaches 4.7%.

In Norway, Q-M242 is found in about 2.6%(~4%[91]) of males, with Q-L804 being more common than Q-F1161/L527.[82] It is observed among 1.6% of males in Denmark, 3% in Faroe Islands.[92] In an article(Helgason et al.) on the haplotypes of Iceland people, 7.2%(13/181) of Iceland males are labelled as R1b-Branch A, but they are actually Q-M242.[93] [91] On the other hand, it is 0.2% in Finland, 4.6% in Latvia, 1.1% in Lituania, 0.5% in Estonia.[82]

Western Europe

In Western Europe, Q-M242 is observed at very low frequencies around 0.5% in most of the countries such as Germany, France, Britain, etc., but some regions show a little higher. It is 2.1% in Swiss,[82] and it reaches 5.1% in Lyon(Rhône-Alpes) region of France.[94] It is about 4% in Shetland Islands of northernmost Britain, with a place in it showing the highest figure at 8%. Shetland has been known to be a settlement of Vikings. And, surprisingly, Q-M242 in Shetland(including some Scandinavia, Faroe Islands, Iceland, and Britain) is turned out to be generically closely linked to the Q-M242 in Central Asia, which means that Norse came from there. Also, Shetland(Norse) Q-M242 is revealed to be linked to the Azeri(Azerbaijan) Q-M242.[91]

Southern Europe

Southern Europe also shows low frequencies of Q around 0.5%~1%, but some regions exhibits different figures. It is 1.9% in mainland Croatia, but it reaches 14.3%(13/91) in Hvar Islands and 6.1%(8/132) in Korcula Islands.[94] Also, it is about 0.6% in Italy, but it rises to 2.5%(6/236) in Sicily, where it reaches 16.7%(3/18) in Mazara del Vallo region, followed by 7.1%(2/28) in Ragusa, 3.6% in Sciacca,[95] and 3.7% in Belvedere Marittimo.[96]

On the other hand, according to a study(Behar 2004), 5.2%(23/441) of Ashkenazi Jewish males belong to haplogroup Q-P36.[97] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245. Also, 2.3%(4/174)[98]~5.6%(3/53)[99] of Sephardic Jews are in haplogroup Q.

Africa

Haplogroup Q is rarely found across North Africa. It is observed in 0.7%(1/147),[69] of Egyptians and in 0.6%(1/156)[65] of Algerian people. Surprisingly, it is also witnessed in 0.8%(3/381, all Q-M346) of males from Comoros which is located in between East Africa and Madagascar.

To combine the data above, Q-M242 is estimated to be in about 3.1% of males of the world.

Subclade distribution

Y-DNA Q samples from Ancient sites

- Atai(South Siberia)

- North America

- Altai(West Mongol)

  • Tsagaan Asga & Takhilgat Uzuur-5 Kurgan sites, Westernmost Mongol Altai, 2900YBP-4800YBP: 4 R1a1a1b2-Z93(B.C. 10C, B.C. 14C, 2 period unknown), 3 Q1a2a1-L54(period unknown), 1 Q-M242(B.C. 28C), 1 C-M130(B.C. 10C)[115]

- Greenland

- China

  • Hengbei site (Peng kingdom cemetery of Western Zhou Dynasty), Jiang County, Shanxi, 2800-3000YBP: 9 Q1a1-M120, 2 O2a-M95, 1 N, 4 O3a2-P201, 2 O3, 4 O*[117]
    • In another paper, the social status of those human remains of ancient Peng kingdom are analyzed. aristocrats: 3 Q1a1(prostrate 2, supine 1), 2 O3a(supine 2), 1 N(prostrate) / commoners : 8 Q1a1(prostrate 4, supine 4), 3 O3a(prostrate 1, supine 2), 3 O*(supine 3) / slaves: 3 O3a, 2 O2a, 1 O*[118]
    • (cf)Pengbo(倗伯), Monarch of Peng Kingdom is estimated as Q-M120.
  • Pengyang County, Ningxia, 2500YBP: all 4 Q1a1-M120[117](with a lot of animal bones and bronze swords & other weapons, etc.)
  • Heigouliang, Xinjiang, 2200YBP: 6 Q1a*(not Q1a1-M120, not Q1a1b-M25, not Q1a2-M3), 4 Q1b-M378, 2 Q*(not Q1a, not Q1b: unable to determine subclades):[119]
    • Over the past decade, Chinese archaeologists have published several reviews regarding the results of excavations in Xinjiang. The reviews suggest who the Xiongnu's supreme ruling class were. Particularly interesting are the samples from the ancient cemetery in Heigouliang of Xinjiang (Black Gouliang cemetery, also known as the summer palace of Xiongnu king), which is east of Barkol basin and near the city of Hami. Y-DNAs of 12 men excavated from the site are turned out to be as the above. All Q1b-M378 men among them are turned out the hosts of the tombs, while half of Q1a* men are regarded as hosts and the other half are regarded as sacrificial victims. They date back to the time of early (Western) Han (2nd-1st Century BC).
  • Hunnu(Xiongnu) site in Barkol, Xinjiang, all 3 Q-M3(This site is near Heigouling site mentioned above) :
    • Summarizing the data from available evidences, it is concluded that the tomb belongs to the representatives of the Xiongnu/Hunnu aristocracy and Hunnu language was in the Yeniseian linguistic family.[120][121]
  • Mongolian noble burials in the Yuan Dynasty, Shuzhuanglou Site, northernmost Hebei China, 700YBP: all 3 Q(not analysed subclade, the principal occupant Gaodangwang Korguz(高唐王=趙王 阔里吉思)’s mtDNA=D4m2, two others mtDNA=A)[122] (cf) Korguz was a son of a princess of Kublai Khan(元 世祖), and was the King of Ongud tribe. He died in 1298 and was reburied in Shuzhuanglou in 1311 by his son.(Do not confuse this man with Uyghur King Korguz died in 1242.) Ongud tribe(汪古部) was a descendant of Shatuo tribe(沙陀族) which was a tribe of Gok-Turk(Western Turkic Khaganate) and was prominent in the Five Dynasties and Ten Kingdoms period of China, building 3 Dynasties. His two queens were all princesses of Yuan Dynasty(Kublai Khan's granddaughters). It was very important for Yuan Dynasty to maintain marriage alliance with Ongud tribe which had been a principal assistant since Genghis Khan's period. About 16 princesses of Yuan Dynasty got married to kings of Ongud tribe.

See also

Populations

3

Genetics

3

Y-DNA Q-M242 subclades

3

Y-DNA backbone tree

References

Citations

  1. ^ Fagundes, Nelson J. R.; Kanitz, Ricardo; Eckert, Roberta; Valls, Ana C. S.; Bogo, Mauricio R.; Salzano, Francisco M.; Smith, David Glenn; Silva, Wilson A.; Zago, Marco A.; Ribeiro-Dos-Santos, Andrea K.; Santos, Sidney E. B.; Petzl-Erler, Maria Luiza; Bonatto, Sandro L. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19. Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
  2. ^ a b c d e f g Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2004). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.
  3. ^ a b v4.01, http://www.yfull.com/tree/Q/
  4. ^ Y-DNA Haplogroup Q and its Subclades - 2010
  5. ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q-M242 in India". BMC Evol. Biol. 7 (1): 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.{{cite journal}}: CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link)
  6. ^ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21. Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present
  7. ^ a b Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  8. ^ Krahn, Thomas. "FTDNA Draft Y-DNA Tree (AKA YTree)". Family Tree DNA. Retrieved 2012. {{cite web}}: Check date values in: |accessdate= (help)
  9. ^ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
  10. ^ That is because it is a value for the STR DYS435 with a value of 8--> 9 within haplogroup Q-M242 and the trend is to include only binary markers in phylogenetic trees. However, these are from studies where all current branches of the Q-M242 tree have not been tested. The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
  11. ^ R. S. Malhi et al.,2008, 'Distribution of Y chromosomes among Native North Americans: A study of Athapaskan population history', http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2584155/
  12. ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30.
  13. ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
  14. ^ Jill Katharina Olofsson et al., Peopling of the North Circumpolar Region – Insights from Y Chromosome STR and SNP Typing of Greenlanders, DOI: 10.1371/journal.pone.0116573
  15. ^ //[1]
  16. ^ Hammer et al., 2005, 'Population structure of Y chromosome SNP haplogroups in the United States and forensic implications for constructing Y chromosome STR databases', Forensic Sci Int. 2006 Dec 1;164(1):45-55. Epub 2005 Dec 5
  17. ^ a b Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
  18. ^ Vullo, Carlos; et al. (2014). "'Association between Y haplogroups and autosomal AIMs reveals intra-population substructure in Bolivian populations'". Int J Legal Med. 129: 673–680. doi:10.1007/s00414-014-1025-x.
  19. ^ Jens Söchtig et al. 2015 Genomic insights on the ethno-history of the Maya and the ‘Ladinos’ from Guatemala, doi:10.1186/s12864-015-1339-1 => Guatemala population consists of about 40% Natives(Mayans)+60% Ladinos. According to this paper, 89% of Mayan and 25% of Ladinos belong to Y-DNA Q. Thus, 40*0.89+60*0.25=50.6%
  20. ^ a b c d e f g Battaglia; et al. (2013). "The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q". PLOS ONE. 8: e71390. doi:10.1371/journal.pone.0071390.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  21. ^ Gaviria, A.; et al. (2013). "Characterization and Haplotype analysis of 11 Y-STR loci in Ecuadorian population". Forensic Sci. Int. Gene. Suppl. doi:10.1016/j.fsigss.2013.10.15.
  22. ^ Martínez-Cortés, G; et al. (2012). "Admixture and population structure in Mexican-Mestizos based on paternal lineages". J. Hum. Genet. 57: 568–74. doi:10.1038/jhg.2012.67. PMID 22832385.
  23. ^ Lovo-Gómez J et al., 'The genetic male legacy from El Salvador', Forensic Sci Int. 2007 Sep 13;171(2-3):198-203
  24. ^ Grugni (2015). "Exploring the Y Chromosomal Ancestry of Modern Panamanians". PLOS ONE. 10: e0144223. doi:10.1371/journal.pone.0144223.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  25. ^ Win Rojas et al., 2010 'Genetic Make Up and Structure of Colombian Populations by Means of Uniparental and Biparental DNA Markers', AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 143:13–20 doi:10.1002/ajpa.21270 => (DANE, 2006): 86% of the whole Colombian population self-reported as of Mixed Ancestary, 3.4% as Native American, 10.5% as African-Columbian. In this paper, 12%(114/954) of MA, 95.7%(135/141) of NA, and 23.8%(5/21) of AC are turned out to be Y-DNA Q. Thus, 86*0.12+3.4*0.957+10.5*0.238=16.1%
  26. ^ Carolina Núñez et al., 'Y chromosome haplogroup diversity in a Mestizo population of Nicaragua', Forensic Sci. Int. Genet.(2012), http://dx.doi.org/10.1016/j.fsigen.2012.06.011. The author revised his previous paper, genotyping 2 more samples as haplogroup Q by Y-SNP test.
  27. ^ Daniel Corach et al.,2010, 'Inferring Continental Ancestry of Argentineans from Autosomal, Y-Chromosomal and Mitochondrial DNA', Annals of Human Genitics, V.74, I1, pp65-76, http://onlinelibrary.wiley.com/doi/10.1111/j.1469-1809.2009.00556.x/full
  28. ^ Ramallo et al., 2009, 'Comparison of Y-chromosome haplogroup frequencies in eight Provinces of Argentina', Forensic Science International Genetics Supplement Series 12/2009; 2(1):431-432, doi:10.1016/j.fsigss.2009.08.047
  29. ^ http://www.fsigeneticssup.com/article/S1875-1768(08)00138-8/fulltext, 5 out of 100 samples in the table can be classified as haplogroup Q-M3.
  30. ^ T. Palha et al., 'Disclosing the Genetic Structure of Brazil through Analysis of Male Lineages with Highly Discriminating Haplotypes', PLoS One. 2012;7(7):e40007.doi: 10.1371/journal.pone.0040007 => about 80 out of 2,024(3.95%) samples in the paper collected from all the regions of Brazil can be classified as Y-DNA Q.
  31. ^ a b Kharkov, V. N.; Stepanov, V. A.; Medvedeva, O. F.; Spiridonova, M. G.; Voevoda, M. I.; Tadinova, V. N.; Puzyrev, V. P. (2007). "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups". Genetika. 43 (5): 675–687.
  32. ^ a b c Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541.
  33. ^ a b Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
  34. ^ a b c Wen B, Li H, Lu D, et al. (September 2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031. Supplementary Table 2: NRY haplogroup distribution in Han populations {{cite journal}}: External link in |quote= (help)
  35. ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; et al. (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
  36. ^ a b c d e Tenzin Gayden et al., 'The Himalayas as a Directional Barrier to Gene Flow', Am J Hum Genet. 2007 May; 80(5): 884–894.doi:10.1086/516757
  37. ^ a b Karafet, Tatiana M.; Hallmark, Brian; Cox, Murray P.; et al. (2010). "Major East–West Division Underlies Y Chromosome Stratification across Indonesia". Mol. Biol. Evol. 27 (8): 1833–1844. doi:10.1093/molbev/msq063. PMID 20207712.
  38. ^ a b c The Y Chromosome Consortium 2008
  39. ^ M C Dulik, 'Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaian, Am J Hum Genet. 2012 Feb 10; 90(2): 229–246. doi: 10.1016/j.ajhg.2011.12.014
  40. ^ a b c d Boris Malyarchuk et al., 'Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a', Journal of Human Genetics (2011) 56, 583– 588; doi:10.1038/jhg.2011.64
  41. ^ T. M. Karafet, 'High Levels of Y-Chromosome Differentiation among Native Siberian Populations and the Genetic Signature of a Boreal Hunter-Gatherer Way of Life', Human Biology, December 2002, v. 74, no. 6, pp. 761–789
  42. ^ Mirabal S, Regueiro M, Cadenas AM, et al. (March 2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.
  43. ^ The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups in the paper, R1-M173 is harbored only in some eastern Siberian Udegeys and Koryaks and Native Americans. Also, R2(distributed in India and its neighbours) cannot be found in far east Siberia. Thus, P-M45 except some samples mentioned above virtually means Q-M242(xM3). In the paper, 35.3% of Nivkhs and 20.8% of Chukchi people and 18.2% of Siberian Eskimos are shown in P-M45, and 12.5% of Chukchis and 21.2% of Siberian Eskimos are in Q-M3. All of them can be estimated to be in haplogroup Q.
  44. ^ a b c d e f g Cristofaro et al., 2013, Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge, •DOI: 10.1371/journal.pone.0076748
  45. ^ Yan, Shi; Chuan-; Wang, Chao; Li, Hui; et al. (2011). "An updated tree of Y-chromosome Haplogroup O and revised phylogenetic positions of mutations P164 and PK4". European Journal of Human Genetics. 19 (9): 1013–1015. doi:10.1038/ejhg.2011.64. PMC 3179364. PMID 21505448.
  46. ^ Shan et al., 2014, 'Genetic polymorphism of 17 Y chromosomal STRs in Kazakh and Uighur populations from Xinjiang, China', Int J Legal Med. 2014 Sep;128(5):743-4. doi: 10.1007/s00414-013-0948-y
  47. ^ Soon-Hee Kim et al., 'Y chromosome homogeneity in the Korean population, Int J Legal Med. 2010 Nov;124(6):653-7. doi: 10.1007/s00414-010-0501-1.
  48. ^ Myung Jin Park et al., Understanding the Y chromosome variation in Korea-relevance of combined haplogroup and haplotype analyses, International Journal of Legal Medicine Volume 126, Issue 4, pp. 589-599, July 2012.
  49. ^ The frequencies of Q-M242 shown in both studies(Kim2010, Park2012) are 1.4%(7/506, Kim) and 1.8%(13/706, Park) respectively. But, if recalculated by regional population weights, the adjusted frequencies reach 1.87%(Kim) and 1.91%(Park) respectively, converging to 1.9%.
  50. ^ a b Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (4): 480–495. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.
  51. ^ a b c d J.A.Trejaut, Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia, BMC Genetics201415:77, DOI: 10.1186/1471-2156-15-77
  52. ^ a b Wang C-C, Wang L-X; Shrestha, R; Zhang, M; Huang, X-Y; et al. (2014). "Genetic Structure of Qiangic Populations Residing in the Western Sichuan Corridor". PLoS ONE. 9 (8): e103772. doi:10.1371/journal.pone.0103772.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  53. ^ Y-chromosome lineage in five regional Mongolian populations Toshimichi Yamamotoemail, Tomoki Senda, Daiki Horiba, Masayoshi Sakuma, Yuuka Kawaguchi, Yuuichi Kano
  54. ^ a b Soon-Hee Kim et al., High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea, Investigative Genetics Volume 2 Page 10, April 2011) doi: 10.1186/2041-2223-2-10
  55. ^ a b c Karafet TM et al., Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders. Hum Biol. 2005 Feb;77(1):93-114
  56. ^ Min-Sheng Peng et al., Retrieving Y chromosomal haplogroup trees using GWAS data, Eur J Hum Genet. 2014 Aug; 22(8): 1046–1050. Eur J Hum Genet. 2014 Aug; 22(8): 1046–1050, 2013. doi: 10.1038/ejhg.2013.272
  57. ^ ”The Akha are an Asian indigenous group originally from Mongolia.” [2] The Akha’s legend says that their ancestors came to southern China across many mountains and large rivers. So, their original place is believed as Mongolia or Manchuria.
  58. ^ Turspekov et al., The Kazakhstan DNA project hits first hundred Y-profiles for ethnic Kazakhs, The Russian Journal of Genetic Genealogy 01/2012; 2(1)
  59. ^ a b c d e Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236. Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region {{cite journal}}: External link in |quote= (help)
  60. ^ a b c Mark Seielstad et al., A Novel Y-Chromosome Variant Puts an Upper Limit on the Timing of First Entry into the Americas, Am J Hum Genet. 2003 Sep; 73(3): 700–705. doi: 10.1086/377589
  61. ^ Malyarchuk B et al., Y-chromosome variation in Tajiks and Iranians, Ann Hum Biol. 2013 Jan;40(1):48-54. doi: 10.3109/03014460.2012.747628
  62. ^ Karafet et al., Paternal Population History of East Asia: Sources, Patterns, and Microevolutionary Processes, Am J Hum Genet. 2001 Sep; 69(3): 615–628. doi: 10.1086/323299
  63. ^ Viola Grugni et al., Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians, Published: July 18, 2012. DOI: 10.1371/journal.pone.0041252
  64. ^ a b c Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  65. ^ a b c Asmahan Bekada et al., Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape, PLoS One. 2013; 8(2): e56775. doi:10.1371/journal.pone.0056775
  66. ^ The frequency of Q is 4%(6/150, all Q-M25) in Regueiro 2006, in which it is 9.1%(3/33) in north Iran and 2.6%(3/117) in south Iran. But, since more people live in the northern regions, if recalculated by population weights, the frequency will reach about 6%. It is also 6.2%(35/566) in Bekada 2013 with a large-scale sampling.
  67. ^ Nadia Al-Zahery et al., In search of the genetic footprints of Sumerians: a survey of Y-chromosome and mtDNA variation in the Marsh Arabs of Iraq, BMC Evolutionary Biology201111:288 DOI: 10.1186/1471-2148-11-288
  68. ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (March 2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  69. ^ a b c Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10 (1): 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  70. ^ Zalloua PA, Xue Y, Khalife J, et al. (April 2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  71. ^ a b Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
  72. ^ Gokcumen, Omer (2008). Ethnohistorical and Genetic Survey of Four Central Anatolian Settlements. University of Pennsylvania. ISBN 978-0-549-80966-1. Retrieved May 13, 2014.
  73. ^ a b Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012). "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events". PLoS ONE. 7 (3): e34288. doi:10.1371/journal.pone.0034288. PMC 3314501. PMID 22470552.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  74. ^ To aggregate the results of Haber 2012 and Cristofaro 2013, the frequency of each ethnic group is 33.3%(25/75) in Turkmens, followed by 8.1%(11/136) in Pashtuns, 7.6% in Uzbeks(11/144), 4.4% in Hazara, 3.0% in Tajiks. Currently, Afghans consist of Pashtun 42%, Tajik 27%, Hazara 9%, Uzbek 9%, Turkmen 3%, others 10%. Thus, if recalculated by population weights of ethnic groups, the frequency of Q in Afghans will be 6.3%.
  75. ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
  76. ^ a b c d e Sengupta, Sanghamitra; Zhivotovsky, Lev A.; King, Roy; Mehdi, S.Q.; Edmonds, Christopher A.; Cheryl-, Cheryl-Emiliane T.; Chow, Emiliane T.; Lin, Alice A.; et al. (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–221. doi:10.1086/499411. PMC 1380230. PMID 16400607.
  77. ^ P Khurana et al., 2014, "Y Chromosome Haplogroup Distribution in Indo-European Speaking Tribes of Gujarat, Western India", DOI: 10.1371/journal.pone.0090414
  78. ^ Simona Fornarino et al., Mitochondrial and Y-chromosome diversity of the Tharus (Nepal): a reservoir of genetic variation, BMC Evol Biol. 2009; 9: 154. Published online 2009 Jul 2. doi: 10.1186/1471-2148-9-154
  79. ^ Nurun Nahar Gazi et al., Genetic Structure of Tibeto-Burman Populations of Bangladesh: Evaluating the Gene Flow along the Sides of Bay-of-Bengal, Published: October 9, 2013. DOI: 10.1371/journal.pone.0075064
  80. ^ B. A. Malyarchuk et al., Gene Pool Structure of Russian Populations from the European Part of Russia Inferred from the Data on Y Chromosome Haplogroups Distribution, Russian Journal of Genetics, 2008, Vol. 44, No. 2, pp. 187–192. DOI: 10.1134/S1022795408020105
  81. ^ Khar'kov VN et al., Frequencies of Y chromosome binary haplogroups in Belarussians, Genetika. 2005 Aug;41(8):1132-6, http://www.ncbi.nlm.nih.gov/pubmed/16161635
  82. ^ a b c d e f g h i https://www.familytreedna.com/groups/
  83. ^ Edvard Ehler et al., Y-chromosomal diversity of the Valachs from the Czech Republic: model for isolated population in Central Europe, Croat Med J. 2011 Jun; 52(3): 358–367. doi: 10.3325/cmj.2011.52.358
  84. ^ Kristiina Tambets et al., The Western and Eastern Roots of the Saami—the Story of Genetic “Outliers” Told by Mitochondrial DNA and Y Chromosomes, Am J Hum Genet. 2004 Apr; 74(4): 661–682. Published online 2004 Mar 11. doi: 10.1086/383203
  85. ^ Alexander Varzari et al., Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights from the Y Chromosome, Published: January 16, 2013 DOI: 10.1371/journal.pone.0053731
  86. ^ Sena Karachanak et al., Y-Chromosome Diversity in Modern Bulgarians: New Clues about Their Ancestry, PLoS One. 2013; 8(3): e56779, doi: 10.1371/journal.pone.0056779 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0056779
  87. ^ B. Csányi et al., Y-Chromosome Analysis of Ancient Hungarian and Two Modern Hungarian-Speaking Populations from the Carpathian Basin, Annals of Human Genetics Volume 72, Issue 4, pages 519–534, July 2008. DOI: 10.1111/j.1469-1809.2008.00440.x
  88. ^ https://www.familytreedna.com/groups/hungarian-bukovina-surnames/about/background
  89. ^ https://www.familytreedna.com/groups/ydna-q-l-712/about/background
  90. ^ http://dna.scangen.se/index.php?show=stats&stat=haplo2&database=shd&haplo_level=1&lang=en
  91. ^ a b c David K. Faux, 2007, The Genetic Link of the Viking – Era Norse to Central Asia: An Assessment of the Y Chromosome DNA, Archaeological, Historical and Linguistic Evidence, http://www.davidkfaux.org/CentralAsiaRootsofScandinavia-Y-DNAEvidence.pdf
  92. ^ Allison Mann, Vikings, merchants, and pirates at the top of the world : Y-chromosomal signatures of recent and ancient migrations in the Faroe Islands, MA Thesis of University of Louisville, 2012.
  93. ^ http://www.davidkfaux.org/shetlandhaplogroupR1a.html
  94. ^ a b Kalevi Wiik, Where did European Men Come From?, Journal of Genetic Genealogy 4(2008):35-85
  95. ^ Cornelia Di Gaetano et al., Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome, Eur J Hum Genet. 2009 Jan; 17(1): 91–99. doi: 10.1038/ejhg.2008.120
  96. ^ Brisighelli F, Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage, PLoS One. 2012;7(12):e50794. doi: 10.1371/journal.pone.0050794. In Table S4, #BEL50 is estimated to be Q-M378 by haplotype, though it is shown as just P*(xR1).
  97. ^ a b Behar DM et al., Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations, Hum Genet. 2004 Mar;114(4):354-65. http://www.springerlink.com/content/xvj2jwclptvrvmer/
  98. ^ Susan M. Adams et al., The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula, Am J Hum Genet. 2008 Dec 12; 83(6): 725–736. doi: 10.1016/j.ajhg.2008.11.007
  99. ^ Alain Farhi et al., Preliminary Results of Sephardic DNA Testing, AVOTAYNU Volume XXIII, Number 2 Summer 2007, p.10
  100. ^ Grugni, Viola; Battaglia, Vincenza; Hooshiar Kashani, Baharak; Parolo, Silvia; Al-Zahery, Nadia; Achilli, Alessandro; Olivieri, Anna; Gandini, Francesca; Houshmand, Massoud; Sanati, Mohammad Hossein; Torroni, Antonio; Semino, Ornella (2012). "Ancient Migratory Events in the Middle East: New Clues from the Y-Chromosome Variation of Modern Iranians". PLoS ONE. 7 (7): e41252. doi:10.1371/journal.pone.0041252. PMC 3399854. PMID 22815981.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  101. ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
  102. ^ a b c d e f g Di Cristofaro, J; Pennarun, E; Mazières, S; Myres, NM; Lin, AA; et al. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLoS ONE. 8 (10): e76748. doi:10.1371/journal.pone.0076748.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  103. ^ Cai, X; Qin, Z; Wen, B; Xu, S; Wang, Y; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui (2011). "Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum Revealed by Y Chromosomes". PLoS ONE. 6 (8): e24282. doi:10.1371/journal.pone.0024282. PMC 3164178. PMID 21904623.{{cite journal}}: CS1 maint: unflagged free DOI (link)
  104. ^ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
  105. ^ "Learn about Y-DNA Haplogroup Q". Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21.
  106. ^ Bortolini MC, Salzano FM, Thomas MG, et al. (September 2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
  107. ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; et al. (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20=15% of a sample of Yemenite Jews.
  108. ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
  109. ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.
  110. ^ The First Peopling of South America: New Evidence from Y-Chromosome Haplogroup Q Vincenza Battaglia, Viola Grugni, Ugo Alessandro Perego, Norman Angerhofer, J. Edgar Gomez-Palmieri, Scott Ray Woodward, Alessandro Achilli, Natalie Myres, Antonio Torroni, Ornella Semino
  111. ^ http://snag.gy/S1RSQ.jpg, https://genetiker.wordpress.com/2014/05/28/y-snp-calls-for-afontova-gora-2/, http://www.anthrogenica.com/showthread.php?2645-Afantova-had-haplogroup-Q1a1-and-some-type-of-R-derived-mtdna
  112. ^ Rasmussen, M.; Anzick, S.; et al. (February 2014). "The genome of a Late Pleistocene human from a Clovis burial site in western Montana". Nature. 506: 225–229. doi:10.1038/nature13025. PMID 24522598.
  113. ^ Jennifer A. Raff & Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162–163.
  114. ^ http://www.nature.com/nature/journal/v523/n7561/full/nature14625.html
  115. ^ Hollard et al., Strong genetic admixture in the Altai at the Middle Bronze Age revealed by uniparental and ancestry informative makers, Forensic Science International: Genetics, published online 4 June 2014
  116. ^ Rasmussen, M.; et al. "Ancient human gonome sequence of an extinct Palaeo-Eskimo". Nature. 463: 757–762. doi:10.1038/nature08835.
  117. ^ a b On Henbei, Pengyang, and Heigouliang, Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China(2012)
  118. ^ Yong-Bin Zhao et al., Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixture into the Han Chinese 3,000 years ago, American Journal of Human Biology(Aug 2014).
  119. ^ Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China(2012)
  120. ^ LL. Kang et al., Y chromosomes of ancient Hunnu people and its implication on the phylogeny of East Asian linguistic families(2013)
  121. ^ Knowing the Xiongnu Culture in Eastern Tianshan Mountain from Tomb Heigouliang and Dongheigou Site at the Beginning of Xihan Dynasty, RenMeng, WangJianXin, 2008
  122. ^ Qui, Y; et al. (2015). "Identification of kinship and occupant status in Mongolian noble burials of the Yuan Dynasty through a multidisciplinary approach". Phil. Trans. R. Soc. B370: 20130378. doi:10.1098/rstb.2013.0378.

Bibliography

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_Q-M242&oldid=708090838"