Wikipedia:Reference desk/Science

Welcome to the science section
of the Wikipedia reference desk.

skip to bottom

Select a section:

• Computing
• Entertainment
• Humanities
• Language
• Mathematics
• Science
• Miscellaneous
• Archives

Want a faster answer?

Main page: Help searching Wikipedia

   

How can I get my question answered?

• Select the section of the desk that best fits the general topic of your question (see the navigation column to the right).
• Post your question to only one section, providing a short header that gives the topic of your question.
• Type '~~~~' (that is, four tilde characters) at the end – this signs and dates your contribution so we know who wrote what and when.
• Don't post personal contact information – it will be removed. Any answers will be provided here.
• Please be as specific as possible, and include all relevant context – the usefulness of answers may depend on the context.
• Note:
  • We don't answer (and may remove) questions that require medical diagnosis or legal advice.
  • We don't answer requests for opinions, predictions or debate.
  • We don't do your homework for you, though we'll help you past the stuck point.
  • We don't conduct original research or provide a free source of ideas, but we'll help you find information you need.

Ready? Ask a new question!

How do I answer a question?

Main page: Wikipedia:Reference desk/Guidelines

• The best answers address the question directly, and back up facts with wikilinks and links to sources. Do not edit others' comments and do not give any medical or legal advice.

See also:

• Teahouse
• Help desk
• Village pump
• Help manual

June 16

Course of the moon in the sky

From the chair I habitually sit in to watch tv, I can sometimes see the moon in the small area of sky visible through an uncurtained window in the room. I've noticed, when visible, that night after night it moves across the sky in the same direction, but each night it gets lower (or higher, I forget which). And when I see it, it always seems to be a full moon. My questions please 1) Is there a diagram anywhere that shows how the moon moves across the sky, and how this changes night after night? 2) Does the full moon tend to go through the same part of the sky each month? Or can it be anywhere? Thanks 80.0.111.219 (talk) 01:15, 16 June 2008 (UTC)

Most star charts should show the course of the moon - I find http://www.heavens-above.com/ very good, it shows the location of the moon at any date and time you give it (although I don't think it can give comparisons between different times on one chart - you should be able to find a chart that will, though). It will go along pretty much the same course each month, relative to the background stars (there are a few very small changes, but probably nothing noticeable to the human eye over the scale of quite a few years). --Tango (talk) 01:36, 16 June 2008 (UTC)

Thanks, but as I cannot see any stars due to light pollution, it is the course of the moon compared to my fixed view that interests me. 80.2.202.167 (talk) 22:40, 18 June 2008 (UTC)

Stellarium is an excellent sky chart program. Also, YourSky may be a little more user-friendly. --Russoc4 (talk) 02:59, 16 June 2008 (UTC)

For the second part of the question, the moon roughly follows the path of the sun (the ecliptic) as do the planets. However, the ecliptic moves around relative to the observer because of the rotation of the earth. The result is that the moon is lower in the sky in the summer and higher in the winter (unlike the sun), but of course it always rises in the east, culminates in the south (if you live in the northern hemisphere) and sets in the west. The full moon is always opposite the sun, so it will always rise at sunset and appear in the eastern sky in the evening.--Shantavira|^{feed me} 05:58, 16 June 2008 (UTC)

Thanks. So the moon keeps revolving over the same part of the sky, apart from the seasonal tilt, if its full or not? I expect the raising or lowering of the track of the moon must be due to its gradually changing position each night as it revolves around the earth every lunar month. Or have I got it wrong - it a lunar month the time the moon takes to go arounsd the earth, or just the time between full moons, or are these the same? Are there any parts of the sky the moon will never appear in, such as near the star Polaris? 80.2.203.46 (talk) 11:24, 16 June 2008 (UTC)

See Lunar month - there are different definitions. The time it takes to go around the Earth with respect to the background stars is the "sidereal" month, the time between consecutive full moons is "synodic" month, and is just over 2 days longer, due to the Earth orbiting the Sun. The course of the moon relative to the background stars is pretty constant (what phase it will have at each point varies depending on the time of year), and it will always be near the ecliptic. So, it will never go anywhere near Polaris, you're correct. --Tango (talk) 15:26, 16 June 2008 (UTC)

Let's amplify the bit about "the course of the moon relative to the background stars is pretty constant". The plane of the Earth's orbit around the Sun is called the ecliptic. The Moon orbits the Earth in a plane that is inclined by just over 5° relative to the ecliptic, but the direction of this 5° inclination changes, rotating in a cycle 18.6 years long. This change is a type of precession. So if on a certain date the Moon passes in front of a certain star, then if you wait for that date 9 years later and wait for the Moon to get to the same part of its orbit, it may miss that star by as much as 10°. Within a person's lifetime this cycle will happen several times and so the Moon may be seen anywhere within a band of sky 10° wide, relative to the stars, centered on the ecliptic plane.

(The ecliptic is itself inclined at about 23.5° relative to the Earth's equator, and this inclination also precesses on a much slower cycle of about 26,000 years. This motion changes which star is the North Star, for instance. So over thousands of years, the Sun may be seen anywhere in a band about 47° wide and the Moon anywhere in a band about 57° wide, both bands centered on the plane of the Earth's equator.)

One more thing. The intersections of the Moon's orbital plane and the ecliptic determine when solar and lunar eclipses happen. If the Moon happens to be full when it's near the intersection of its orbit with the ecliptic plane, then there is a lunar eclipse. If it's new, there is a solar eclipse. In each case if it's very near the point of intersection, the eclipse is total or annular; if not so near, it's partial. Thus there are "eclipse seasons" about twice a year when a lunar and solar eclipse may happen two weeks apart, and the rest of the year no eclipses are possible. For example, according to Fred Espenak's excellent eclipse web site, the eclipses for 2008 are:

• 2008 Feb 07: Annular Solar Eclipse
• 2008 Feb 21: Total Lunar Eclipse
• 2008 Aug 01: Total Solar Eclipse
• 2008 Aug 16: Partial Lunar Eclipse

The precessional changes in the Moon's orbit mean that the eclipse seasons shift a bit earlier each year. By 2010 they will be in December/January and June/July. After 9 years they will have cycled halfway around and will be in February and August again.

--Anonymous, 22:06 and 22:15 UTC, June 16, 2008.

Hi. Also, the moon tends to rise and set an hour later one day than the last. The full moon will tend to be highest at around midnight, with cresent moons closer in apparent position to the sun. If the moon's cresent forms a C or backwards D, the cresent is becoming smaller ("croaking" or waning), and usually appears in the morning. If the cresent is a D or backwards C, it is growing and usually appears in the evening. If the moon is appearing late at night, usually it will generally be higher in the winter than in the summer, and vice versa if it appears in daytime. Hope this helps. Thanks. ~AH1^(TCU) 22:26, 16 June 2008 (UTC)

The part about C and D shapes would be applicable if you're in the Northern Hemisphere, but reversed in the Southern. --Anon, 17:45 UTC, June 17.

Using very short people as astronauts

If people half average height and one eighth average weight (assuming all dimensions halved) were used as astronauts, could the size of space rockets be reduced proprtionately, so you'd only need a rocket an eighth the usual size? Hence saving a lot of money. 80.0.111.219 (talk) 01:23, 16 June 2008 (UTC)

You could probably make some savings, but nowhere near 7/8. Most of the (non-fuel) weight of the rocket is the engines, structure, whatever is needed for the mission, life support systems, etc. The astronauts are a minute portion of the total mass and you can't just scale down everything else. Making something smaller generally costs a lot more, more than you would save on fuel. It may not even be possible to make some things smaller - they have to be a certain size to do their job. --Tango (talk) 01:30, 16 June 2008 (UTC)

I don't agree. If the stated assumption was correct, that you could have astronauts that weighed 1/8th as much, then you could possibly make a rocket to launch them that would weigh 1/8th (or very close to 1/8th) as much. Let's discuss each of the items Tango listed:

1) Life support systems: I'd expect a person with 1/8th the mass to use around 1/8th the amount of oxygen, produce around 1/8th the amount of carbon dioxide to scrub, urine to process, and feces. It would be reasonable, then, to say that the equipment needed to process these reduced quantities could be reduced accordingly.

2) Structure: The structure can be reduced in proportion to the contents.

3) Engines: They can also be reduced in proportion to the mass they need to lift.

4) "Whatever is needed for the mission": This gets a bit tricky. Some items can't be reduced at all, like the Hubble Telescope, as reducing the diameter of a telescope reduces it's light gathering power. So, if launching the Hubble was the mission, you're out of luck here. However, if the mission was to observe the changes that occur in astronauts in space, then all the equipment, like the treadmill and blood pressure cuff, could also be reduced accordingly. It would depend entirely on the mission whether the items could be scaled down.

Sure, all those things can be reduced, but can they be reduced proportionally? I doubt it. At least, not without a massive increase in cost. --Tango (talk) 15:19, 16 June 2008 (UTC)

Does a model train cost massively more than a full-sized train ? Only when you reach a certain threshhold of "smallness" does cost go up. Half scale wouldn't normally hit that threshold, with the exception of some electronics that are difficult to reduce further in scale as they are already at the minimum size possible using current technology. Also note that many half-scale items already exist, designed for children, like clothes and chairs, so could be purchased "off-the-shelf" for little money. StuRat (talk) 18:15, 16 June 2008 (UTC)

Note, however, that a person half as tall isn't really going to weigh 1/8th as much, since they wouldn't be 1/2 as wide and 1/2 as thick. Dwarves always look "stout" precisely because the reduction in height is not matched by a corresponding reduction in other dimensions. Their heads, for example, tend to be very close to the size of average-sized people's heads. StuRat (talk) 02:00, 16 June 2008 (UTC)

Thanks. The second-ever satellite had a dog in it, which would not have weighed much compared with a human. I do not know what the rocket size was compared to the first astronauts, although the dog-rocket may have been designed with the capacity to lift humans in mind. 80.2.203.46 (talk) 11:09, 16 June 2008 (UTC)

In the infancy of the space age, pre-astronauts and cosmonauts, right after Sputnik, Hugh Walters wrote Blast Off at Woomera (1957), ("Blast off at 0300" in the U.S.) about a moon rocket launched by the "United Nations Exploration Agency" which carried 17 year old Chris Godfrey, an English boy who was only 4 feet 10 1/2 inches tall, making the whole spacecraft able to launch with less booster power than for a 6 foot test pilot. Woomera Australia was the launch site. Walters was a member of the British Interplanetary Society and tried to keep the science accurate. Pretty good juvie sci-fi. Edison (talk) 19:03, 16 June 2008 (UTC)

So how big a rocket would you need to launch a hamster, ant, or bacteria into space? 80.2.207.210 (talk) 20:23, 16 June 2008 (UTC)

There has to be a point of dimishing returns as you make the rocket smaller.I can't picture a rocket the size of a pencil (or toothpick) getting into space at all, even with nanotechnology used to make the pumps, servos, etc. Why does it seem a rocket must be a certain minimum size (V2 or larger) to reach orbit? Edison (talk) 03:16, 17 June 2008 (UTC)

Wind resistance. Cross-sectional area (and to a first approximation, wind resistance) increases as the square of size; available thrust increases as the cube. --Carnildo (talk) 21:27, 17 June 2008 (UTC)

also, alot of fuel needs to be carried along. tiny rocket = tiny fuel volume. Doesn't get you far. --Shaggorama (talk) 05:41, 18 June 2008 (UTC)

Blue skin on a Budgerigar's nose

By what process does the skin on the nose of a male budgerigar become blue? Does it involve an accumulation of copper compounds beneath the surface? I always wondered about that. —Preceding unsigned comment added by 90.242.157.1 (talk) 01:45, 16 June 2008 (UTC)

No. There is no known blue pigment in birds (in fact, blue pigment is extremely rare in the entire animal kingdom with only two species of fish known to have cyanophores). While the basis of the blue colour in male budgerigar cere has not been studied specifically, the way blue colour is generated in birds is well known. In birds (and indeed, in mammals) blue is generated by coherent light scattering: specifically by hexagonally organized arrays of collagen fibers in the dermis. Underneath the fibres are melanocytes (black/brown melanin containing pigment cells) that gives the base colour. The fibres on top create the colour by scattering the light, which effectively "skews" the base colour to our eyes. There is a very nice scientific review of blue colouration in animals: [1] Rockpocket 05:17, 17 June 2008 (UTC)

want to know how to figure out isotope half life

using diagnostic or therapeutic methods of a very old dead like mummy —Preceding unsigned comment added by 70.234.104.170 (talk) 02:35, 16 June 2008 (UTC) only info i have is c14 for isotope and a half life of 5730yrs —Preceding unsigned comment added by 70.234.104.170 (talk) 02:37, 16 June 2008 (UTC)

Have you read our article on radiometric dating? It explains the general concepts, including Carbon-14 dating. — Lomn 03:20, 16 June 2008 (UTC)

Natural sleeping position

I've heard that in the late Middle Ages it became the custom to sleep sitting up. Could it be that how we sleep is determined by culture? 217.168.0.72 (talk) 04:21, 16 June 2008 (UTC)

I understand that in a castle for example, most people did not have bedrooms or beds but slept in the great hall with lots of other people. Hence the sitting up, perhaps because it was crowded and the floor not very nice to lie on (old food, dog-do, spit, vermin etc). Nobody recorded what the peasants did. Monks seemed to have their own beds as far as I am aware. 80.2.203.46 (talk) 11:15, 16 June 2008 (UTC)

OP: Where did you hear that? Wierd. I think there's more to it than culture. I can't speak for everyone, but I find it difficult to sleep sitting up unless I'm watching TV or being lectured, and even then my body tends to find its way downward. I think it's pretty natural to want to sleep lying down; allegedly the impulse was strong enough to kill John Merrick (of course, it's been suggested that his desire to sleep reclining may have been due largely to social pressure). Physiologically, it may have something to do with the increased activity of the brain during sleep: it takes less effort to pump blood to the brain if the head is level with the heart. It's worth noting that many animals also lie down or curl up on the ground to sleep. --Shaggorama (talk) 05:51, 18 June 2008 (UTC)

special relativity

shanu 09:00, 16 June 2008 (UTC) Suppose two twins A, B are on a platform near earth. C is another person of same age but his platform is near mars. B travels from earth to mars. When B starts his journey, all the persons start their clock. when B reaches on platform of C, C should expect that B should measure less time(due to time dilation)then him. But if we see the situation from B^,s reference frame, A and C have done journey. Therefore he expects C measures less time. But B and C both cannot measure less time! How can we resolve this contradiction?

Have you read the Twins paradox article ? SpinningSpark 09:22, 16 June 2008 (UTC)

I know abot twin paradox. But in that excuse is given that one person is 'accelarating'. but in this all are in inertial frames(non-accelarating). Thus we cannot apply this excuse. —Preceding unsigned comment added by Rohit max (talk • contribs) 09:40, 16 June 2008 (UTC)

B and C do both observe the other to have measured less time. There's no contradiction unless B actually slows down to be in C's frame at the end, in which case he's been accelerating and the symmetry breaks. Algebraist 10:04, 16 June 2008 (UTC)

There is no objective "now" in special relativity. The result depends on which point of reference A and C where using to synchronize their clocks. If everyone starts their clocks at the same time from A and C's perspective, then when B gets to C, C's clock will be ahead, but from B's perspective, that's just because C started his too early. Get it? — DanielLC 14:40, 16 June 2008 (UTC)

How does a canon work?

hai friends, can u please tell me as to how a canon, which were being used in wars in olden days, works? And what was/is there inside the iron ball? Bye. Kvees. —Preceding unsigned comment added by 59.178.100.105 (talk) 09:02, 16 June 2008 (UTC)

Take a look at our cannon article. Early cannons did not have any explosive inside the ball. It was solid iron, or even stone in some very old ones. They did damage purely through their kinetic energy. The explosive (gunpowder) is packed into the cannon barrel and propels the cannonball forward under the high pressure caused by the restricted space. It was many centuries after they were invented before the ammunition started to be packed with explosives, compare shrapnel shell with case-shot and canister shot. Don't try this at home. SpinningSpark 09:39, 16 June 2008 (UTC)

There was also hot shot, where a solid cannon ball was heated first, so it would start a fire when it hit the target. The earliest cannons were fired by holding a torch against a small hole in the end so the gunpowder would detonate. There was also the precursor to the handgun, the hand cannon, which was a small, portable cannon. StuRat (talk) 13:13, 16 June 2008 (UTC)

And of course, from the hand cannons came muskets. Or something. But they're the same concept, more or less. --Wirbelwindヴィルヴェルヴィント (talk) 20:40, 16 June 2008 (UTC)

Noble Gases

Can noble gases form compounds under extreme conditions of temprature and pressure? If yes how? —Preceding unsigned comment added by Rohit max (talk • contribs) 10:12, 16 June 2008 (UTC)

Noble gas compound 193.190.253.149 (talk) 10:21, 16 June 2008 (UTC)

Notably, Xenon hexafluoride and Xenon trioxide.

Atlant (talk) 13:36, 16 June 2008 (UTC)

Autism

Does autism affect the age that one lives to? Interactive Fiction Expert/Talk to me 10:40, 14 June 2008 (UTC)

No, not much and not directly. It can affect how one lives their life and make certain causes of death more likely because of their choices but as a disease it will not kill you. Regards, CycloneNimrod ^talk?_contribs? 11:43, 14 June 2008 (UTC)

(edit conflict) Autism absolutely effects the age one lives to. As CycloneNimrod has pointed out, autism does not kill directly, but life expectancy is significantly decreased for autistics [2]. Significant death factors include high susceptibility to accidents, respiratory distress and seizures [3] indicating that in a way the condition does often cause the demise of the individual.

Moreoever, I disagree with the claim that autism is a disease; it is better described as a condition, or disorder: autism is a developmental problem that appears to be genetic[4], it is generally not believed to be caused by external vectors except in the case of factors that increase the chances of birth defects[5]. --Shaggorama (talk) 06:40, 15 June 2008 (UTC)

I'd have to disagree, autism is certainly a disease. Reading the article 'disease' will give you a good reason why. Mental disorders are classed as diseases and although autism is congenital, that does not stop it being a disease. It's a common misconception that diseases have to be contagious, that is not the case. Regards, CycloneNimrod ^talk?_contribs? 14:36, 15 June 2008 (UTC)

Many people would disagree with classifying autism as a disease, or even as a disorder. Condition tends to be more accepted. Of course, there are all sorts of things that some people consider 'mental disorders' and hence diseases which other people consider at most a 'condition' if not normal variation. To say it is 'certainly a disease' is to pick a side in an often contentious debate. 79.66.60.129 (talk) 16:52, 15 June 2008 (UTC)

A disease is defined as "The term 'disease' refers to any abnormal condition of an organism that impairs function." according to Wikipedia, or for other sources try this one: "A condition of the body in which there is incorrect function due to heredity, infection, diet, or environment." or this one "a general term describing a morbid condition which can be defined by objective, physical signs (e.g. hypertension), subjective symptoms or mental phobias, disorder of function (e.g. biochemical abnormality), or disorders of structure (anatomic or pathological change).". Autism is certainly a disease, whether you wish to class it as something as as well is your choice, but it honestly does fit the criteria since autism is an impairment of human functioning. Regards, CycloneNimrod ^talk?_contribs? 17:37, 15 June 2008 (UTC)

I am not a doctor, but I seem to recall that the term "disease" used to only apply to conditions caused by an external organism (ie. bacteria, virus, etc.). That was a much cleaner distinction. The definitions cited above make anything short of physical injury a disease. — The Hand That Feeds You:^Bite 18:04, 15 June 2008 (UTC)

Strictly speaking anything which impairs human function (whether it be a congenital condition, by virus, bacteria etc) is a disease. Condition refers to a state of being, disease means that something is wrong. Look at any dictionary definition you like (assuming its credible) and you'll come up with the same findings. Google 'Define:disease'. Regards, CycloneNimrod ^talk?_contribs? 19:20, 15 June 2008 (UTC)

Talk about opening up a can of worms! Well, after poking around a little at the medline plus dictionary maintained by the US National Library of Medicine, it looks like the problem we've uncovered here is that there isn't any clear distinction between the terms "condition," "disorder," and "disease," although there seems to be a pseudo-consensus here on their meanings relative to each other. For posterity sake, here are the Library of Medicine definitions:

• Disease: an impairment of the normal state of the living animal or plant body or one of its parts that interrupts or modifies the performance of the vital functions, is typically manifested by distinguishing signs and symptoms, and is a response to environmental factors (as malnutrition, industrial hazards, or climate), to specific infective agents (as worms, bacteria, or viruses), to inherent defects of the organism (as genetic anomalies), or to combinations of these factors
• Disorder: an abnormal physical or mental condition
• Condition: a usually defective state of health <a serious heart condition>

By these definitions, it appears to me that autism satisfies the conditions for all three of these. Really I don't think there's a clear difference between these terms, at least not as they are formally defined, although there are more articulated differences in their use. --Shaggorama (talk) 21:50, 15 June 2008 (UTC)

Well, the question I'm really asking is "who is the oldest autistic person ever and how old did they live to?". Interactive Fiction Expert/Talk to me 10:18, 16 June 2008 (UTC)

I think the best answer is 'no one knows'. I don't know if anyone even keeps track of these sort of things and someone's medical conditions is usually consider private. Plus there are obviously many many autistic people who were never identified as being autistic. See for example, people speculated to have been autistic. Nil Einne (talk) 10:59, 16 June 2008 (UTC)

So you're saying cancer and heart disease and diabetes and sickle cell anaemia and rickets and gout are not diseases? Because all our articles describe these as diseases as I suspect would most doctors... Nil Einne (talk)

My point exactly :) Regards, CycloneNimrod ^talk?_contribs? 13:54, 16 June 2008 (UTC)

I really don't want to get into this, as it's an ongoing political debate between various parties, but which word you use to describe various 'conditions', such as being on the autistic spectrum or showing a sexual preference for people of your own gender, is not as straightforward as some have suggested above. Assuming that it is is likely to cause problems if you find yourself discussing these issues with anyone they apply to. If you read the various definitions above, you will notice that some assumptions are necessary to apply these definitions to the situations. I'm not trying to change the mind of anyone who has made theirs up, and I'm not going to discuss this further as I don't think it will be productive or what the desk is for, but I felt I needed to put this here to help people avoid putting their foot in it in certain situations. 79.66.45.237 (talk) 14:50, 16 June 2008 (UTC)

Well I understand why some people dislike the characterisation of autism as a disease, the fact remains, disease are clearly not only things caused by an infective agent, at least I suspect in the eyes of the vast majority of the worlds population Nil Einne (talk) 16:07, 16 June 2008 (UTC)

Nobody was suggesting they are; I think you have missed the point :) 79.66.45.237 (talk) 17:06, 16 June 2008 (UTC)

<outdent> "I am not a doctor, but I seem to recall that the term "disease" used to only apply to conditions caused by an external organism (ie. bacteria, virus, etc.)." That is exactly what somebody was suggesting. Regards, CycloneNimrod ^talk?_contribs? 17:11, 16 June 2008 (UTC)

Yeah, I was just about to go back and edit my last comment because some people do seem to have said that. Sorry about that. None-the-less, my last comment was merely meant to suggest that that is not at all the point when it comes to labelling something like being on the autistic spectrum as a disease. But there we go. 79.66.45.237 (talk) 17:14, 16 June 2008 (UTC)

Except it is entirely the point! It is an impairment of human mental function, this means it is a disease whether you like how that comes across or not. You can call it a disorder, that fits too, or a condition, that also works, but it is a disease. I don't see how anyone can disagree with that since it fits the very definition of disease. Regards, CycloneNimrod ^talk?_contribs? 17:46, 16 June 2008 (UTC)

Oh good Lord. 'Impairment', 'defective', and you don't see the issue? Never mind. Change is slow and there are many people in the world. 79.66.45.237 (talk) 18:59, 16 June 2008 (UTC)

It is not my job to censor the truth. Autism is a defect and causes impairment, there is absolutely no denying that. You can be more sensitive if you wish and call it a disorder or condition, but anything you use will still imply that an autistic person has something different from the norm. I hope to be a doctor and I have no intention of telling anyone that they can't live up to be as good as anyone else but it is the truth that autism is a disease. Regards, CycloneNimrod ^talk?_contribs? 19:55, 16 June 2008 (UTC)

Different from the norm is not the same as defective or diseased or impaired. A gay person is someone different from the norm, and when they live in a society that treats it as a disease it reduces their quality of life. That doesn't make it a disease. Having an exceptionally high IQ is different from the norm, and can reduce someone's chances of 'success' in life. It can impair their ability to interact with others. Doesn't make it a disease. Having an exceptionally low IQ is different from the norm and can make someone's life harder and shorter. Doesn't make it a disease. Certainly you would not expect to see 'high IQ' and 'low IQ' listed as diseases. Being a long way along the autistic spectrum certainly is a disadvantage in terms of achieving success in life and interacting with others, and different from the norm, but it doesn't make autism a disease. Given you are fairly smart, and particularly if you are hoping to be a doctor, I would have expected this to be blindingly obvious. 79.66.45.237 (talk) 22:35, 16 June 2008 (UTC)

You are right to an extent. Someone with an exceptionally high or low IQ is not diseased, however, if there is a cause behind that IQ then they may very well be diseased. Mental retardation is listed as a disease and it features a low IQ. A high IQ wouldn't be classed as a disease because, even if it doesn't allow perhaps as good social interaction with others, biologically it makes little difference. Autism on the other hand consists of signs and symptoms, again read the article, and is often in the forefront of the news about research in trying to find a cure. This word cure alone means that it is classed as a disease by the medical profession because it is looking to be fixed. I do see it as blindingly obvious that different to the norm is distinct from being a disease, otherwise all of us would be diseased, but different to the norm BIOLOGICALLY and with signs and symptoms, that is a disease. Regards, CycloneNimrod ^talk?_contribs? 10:58, 17 June 2008 (UTC)

Allright guys, this has gone on long enough. I'm going to reiterate my previous comment: the terms disease, condition, and disorder are ambiguous relative to each other although we do not use them itnerchangeably. Per definition alcohol intoxication could be considered a disease, but that's just stupid. At low levels, it certainly causes significant impairment, but we don't even consider it poisoning. I think the deal is that once one of these three terms is applied to an ailment it becomes convention and sticks. Beyond that, there seems ot be a bit of "I know it when I see it" attitude towards them. That's it. No clear distinctions. --Shaggorama (talk) 06:03, 18 June 2008 (UTC)

Now that I can trust I will write nothing else, I will put this link here. Sociological_and_cultural_aspects_of_autism. 79.66.85.219 (talk) 11:56, 19 June 2008 (UTC)

Ants in my Car

There are ants in my car and I see them every single time I get in my car, near the dash and near the passenger and driver side doors. I assure you there are no food or traces thereof in my car. Nor water. My car is clean and I don't eat in it. How in the heck are they surviving? What could they possibly be eating in order to survive. It's creeping me out! --Anthonygiroux (talk) 13:38, 16 June 2008 (UTC)

They could be eating paper, glue, insulation, etc. This could be quite dangerous as they could distract you while driving and cause an accident. I suggest a bug bomb, which should work well in such an enclosed area. Let the car air out and drive with the windows down after use. StuRat (talk) 18:08, 16 June 2008 (UTC)

Driving Ms Smokesalot

Yesterday I was driving with my cousin who is quite a serious smoker. He was in the front passenger seat and I was driving - nobody in the back. What would be the best way to ensure that I breath as less smoke as possible? It was too cold to open the windows more than three quarters of the way up. But I did notice that when my window was slightly less opened than his, there was a significant difference. Does that make sense? When my window was closed and his open it was - as expected - really bad. Surprisingly, the fan on plus the back windows open didn't make much of a difference. We were travelling at about 110km/h and it wasn't very windy outside. Zain Ebrahim (talk) 13:55, 16 June 2008 (UTC)

Well, the easiest way to breathe the least smoke is to ask your cousin to butt out in your car. If you're too ashamed of your selfish interest in clean lungs, then you can make an appeal to greed—tell her that you don't allow smoking in the car because you're trying to preserve its resale value.

If you're not comfortable with being honest and sticking up for yourself – or your cousin isn't polite enough to delay her smoke – then you're just going to have to fiddle with the windows and vents until you find something tolerable. Airflow inside a moving car is probably a chaotic system that will be sensitively dependent on the position of the windows and vent blowers, as well as on vehicle speed and the presence of any crosswinds. TenOfAllTrades(talk) 14:25, 16 June 2008 (UTC)

I agree with ToAT's first point. Also presuming it was your car, I suggest you reconsider in the future whether he is allowed to travel in it or at least extract a promise before you take him in the future not to smoke. I understand this can be difficult in a family situation but remember it is your car, and your health! Nil Einne (talk) 16:03, 16 June 2008 (UTC)

(ec) Sounds to me as if this is a demonstration of Bernoulli's principle. The air moving relative to the car causes low pressure outside. So smoke tends to get sucked out the window. But if your window is open slightly less, the vacuum on your cousin's side is greater than on your side allowing a smooth flow of air away from you. On the other hand, closing your window or opening it fully is likely to cause turbulence inside. By the way, you refer to your cousin as "he" but the title of the question is "Ms". Is your cousin confused? SpinningSpark 14:33, 16 June 2008 (UTC)

Lol - he's not. The title was a (lame) "play" on Driving Miss Daisy. Thanks for the answers, Zain Ebrahim (talk) 15:33, 16 June 2008 (UTC)

Did you mean "Driving Over Miss Daisy"? Maybe you should see the movie "My Cousin Smokey". I think the easiest way to keep the cousin from making everybody's life miserable is to lock him up in the car's trunk. -- Toytoy (talk) 16:03, 16 June 2008 (UTC)

Second what Spark said. Make sure your window is open less than your cousin's so that airflow will tend away from you, if your cousin's is open less than the smoke will blow toward you and confound your efforts. Another method that may work is turning on the fan of your air conditioner (the air conditioner itself does not need to be on) and cracking your windows (perhaps 1 inch or so). This will create a positive pressure situation inside your car that may force the air out directly without creating much of a cross breeze. EagleFalconn (talk) 15:50, 16 June 2008 (UTC)

I would NEVER allow anyone to smoke in my car. I'd even make them go air the smoke out of their stinky clothes before allowing them in my vehicle. However, if you insist on tolerating this assault on your health and senses, I suggest you crank up the heat to allow you to open the windows further. Either that or get an antique car with a rumble seat for Mr Stinky. StuRat (talk) 18:02, 16 June 2008 (UTC)

You can always negotiate pit stops for him to smoke, but personally, even when I was a smoker, I never smoked in the car, and didn't let anyone else either. --Wirbelwindヴィルヴェルヴィント (talk) 20:35, 16 June 2008 (UTC)

As a current smoker (not proud of it), I would abide by any rules set down by the driver. Family or otherwise. If they said "no smoking" then grand, I wouldn't find it offensive at all to be asked to refrain. So I think you should just ask him; smokers are very accomodating people :-) I would never smoke in anyone's car unless they invited me to (window open, naturally) do so. (but if somebody asked me to air out my clothes before getting into the car, then I'd reconsider my travelling company; sorry StuRat ;-) ). Fribbler (talk) 01:07, 17 June 2008 (UTC)

Speculative probe

Given our current knowledge and allowing for the development of not too hard to reach technology (say in the next 10 or 20 years), how long would it take for an unmanned probe to reach a star 50 light years away? 200.127.59.151 (talk) 17:20, 16 June 2008 (UTC)

A hell of a lot longer than 50 years, that's all I can say. Regards, CycloneNimrod ^talk?_contribs? 17:44, 16 June 2008 (UTC)

I can imagine spaceships with linear particle accelerator drives and nuclear reactors for power that could approach the speed of light, maybe in the 20 year time frame. Those would take a bit over 50 years to make the trip there, and over 100 to send back pics and data. However, I don't expect the desire for short-term return on investments to disappear by then, so I doubt if anyone would pay for a mission with no benefits during their lifetime. A visit to a closer star, say Proxima Centauri, might be more realistic in that time frame, though, with pics and data coming back in a dozen or so years. I agree that such ships would be unmanned. StuRat (talk) 17:51, 16 June 2008 (UTC)

A bit? Surely taken the fact that approaching the speed of light is still likely to be quite far off (otherwise relativity is going to come into play, no?) suggests it's more then a bit? 70 years seems more realistic to me. And where did you get the 100 to send pics and data? Surely the probe is not going to wait for a signal from earth before it sends data? Nil Einne (talk) 18:29, 16 June 2008 (UTC)

I think he was saying that it would take over 50 years to get there and it would take over another 50 years for the data to get back. Zain Ebrahim (talk) 19:17, 16 June 2008 (UTC)

Dreamer. To get a 50 lb (22 kg) mass to half the speed of light requires the energy equivalent of the entire output of 1 GW reactor summed over 15 years. For scale, 1 GW is about the electricity consumption of a little less than 1 million households. No matter what you are imagining, there is no way that foreseeable technology will be able to compress power generation enough to allow near light speed travel for useful masses. Dragons flight (talk) 18:49, 16 June 2008 (UTC)

P.S. The fastest spacecraft ever launched reached 0.02% of the speed of light ... by diving straight at the sun. Dragons flight (talk) 19:22, 16 June 2008 (UTC)

Let's try a little thought experiment. Let's assume for the sake of argument we can launch a probe now (2008) that can reach 10% lightspeed. This means it will take 500 years (2508) to reach it's destination. But in fifty years time we might well have increased that speed to 20% lightspeed - which means a probe launched fifty years later (2058) will arrive before the first (2308) and so on and so forth. Add in the fact that the rate of technological process is accerlerating I'm sure you can see the problem. It's only worth sending such a probe if it can reach the destination faster than we can supercede the speed of it with the next generation of probes. It's the same paradox that renders a generation ship useless. Exxolon (talk) 19:10, 16 June 2008 (UTC)

That assumes a 100% chance a faster technology will be developed. You can't wait 50 years because something better may come along, because then you'd just end up not going. 192.45.72.26 (talk) 20:39, 16 June 2008 (UTC)

But isn't that precisely the problem? No one is going to spend billion or trillions developing a rocket to go somewhere when they resonably expect someone else in 50 years time will develop a rocket that will beat them to the punch. Nil Einne (talk) 01:44, 17 June 2008 (UTC)

The basic formulae are in the article Relativistic rocket. With ²³⁵U fission fragments the I_sp is 0.04 c (and if you stop the fragments and convert the energy to light or use it for accelerating particles to higher speeds, things will get worse). For a single-staged 0.5 c spaceship you need a mass ratio of 920483, which is of course not realistic. Icek (talk) 21:05, 16 June 2008 (UTC)

Don't know about advanced technology, but I'll just note that for current technology the record for fastest man-made object is one of the Helios probes, launched in the '70s, which clock in at 70.2 km/s. At that rate of speed, they would reach the 50ly mark in a tad over 210,000 years. Voyager 1 is the man-made object with the largest absolute velocity away from the sun, at 17.1 km/s. At this rate, it would take a bit more than 875,000 years to make 50ly out. -- 128.104.112.147 (talk) 23:13, 17 June 2008 (UTC)

Helios was the fastest, but accelerated mainly by sun's gravity - doing the math you'll get a speed of about 24 km/s at its aphelion (at about 1 AU, i.e. at Earth's distance from the sun), which means that it needed only about 6 km/s of hyperbolic excess velocity with respect to Earth (Earth is traveling at about 30 km/s). New Horizons was directly launched into a solar system escape trajectory, for which you need more than 12 km/s hyperbolic excess with respect to Earth (sqrt(2) * 30 km/s - 30 km/s, you should be able to find all the formulas in Orbital mechanics), setting a record for the velocity gained by initial rocket propulsion. The solar hyperbolic excess velocities of the 4 Pioneer and Voyager probes are nevertheless larger than New Horizons', because they gained more speed from their encounters with Jovian planets. The solar hyperbolic excess velocity (v_∞ for short) of New Horizons was 12.56 km/s before the Jupiter encounter (according to this source). Assuming that we want a probe with well-tested technology to leave the solar system as fast as possible, we can assume the 12.56 km/s initial v_∞ and a swing-by at Jupiter and Saturn (I think we don't want to wait for more planets "lining up" ideally, that would last to long). The initial eccentricity would be 1.178, leading to an angle of 77° with the orbit of Jupiter (assumed to be circular). The probe's speed would be 22.3 km/s at Jupiter, and relative to Jupiter (itself at 13.1 km/s) the speed would be 23.2 km/s. This velocity vector is rotated to be parallel to Jupiter's direction of motion by an optimal swing-by, and the departure speed from Jupiter would thus be 36.3 km/s, with the new v_∞ = 31.3 km/s. The new eccentricity would be 5.743, leading to an angle of nearly 85° with an assumed circular orbit of Saturn. The speed at Saturn would be 34.1 km/s, the relative velocity 34.6 km/s, the outgoing velocity 44.2 km/s and the new (and final) v_∞ = 42.1 km/s. Icek (talk) 16:24, 19 June 2008 (UTC)

Which, if I've done the sum right, would take about 30,000 years to reach the nearest star. I think rockets are out of the question! You need something which can maintain thrust for a long time, like an ion drive to get even close to interstellar velocities. --Tango (talk) 16:43, 19 June 2008 (UTC)

No, doing all the acceleration close to massive objects would be better, because you get more v_∞ for the same Δv, but the higher specific impulse of ion drives would help. Icek (talk) 17:06, 19 June 2008 (UTC)

If you could get the same cumulative thrust as an ion drive gets over the span of years all at once, then great, but I don't know of any way to do that. --Tango (talk) 19:02, 19 June 2008 (UTC)

Another problem with ion thrusters is that they need much power, so you'd need many RTGs, adding mass to the spacecraft (I assume a low mission lifetime here compared to the actual travel time to another star). If we assume that with inner solar system gravity assists similar to the ones the Cassini probe used you could get the 42.1 km/s v_∞ after Saturn for a larger probe (Cassini was about 5600 kg), and you have sufficient power and the ion thruster of SMART-1 (or maybe several of them) with an exhaust velocity of about 16 km/s and you have 2/3 of the probe's mass being xenon propellant, and, for simplicity, the ion thruster acceleration is mainly done far from the sun, so that the Δv can be (as a reasonable approximation) simply added to the v_∞, then you get nearly 60 km/s. Not much for interstellar travel, but at least more than 3.5 times the v_∞ of Voyager 1. Icek (talk) 21:27, 20 June 2008 (UTC)

Theory of disease

As I understand germ theory is the basis on which the modern medicinal treatment is done. What are the theories which form the basis of other systems of health care for example Unani, Ayurvedic, homeopathy etc. Thanks--Shahab (talk) 17:46, 16 June 2008 (UTC)

I would tend to argue that in modern medical practice, the guiding principles are those of evidence-based medicine, rather than simply the germ theory. While many ailments are caused by germs (bacteria and viruses, mostly), modern medicine also includes treatments for diseases and conditions not brought on by pathogenic organisms. (Cancer, for instance, is the result of genetic mutation, which in turn may be caused by environmental factors, lifestyle choices, infectious disease, or bad luck. Alzheimer's disease is linked to the accumulation of naturally-occuring proteins in the brain. A number of autoimmune diseases drive the body's immune system to attack healthy tissues and organs.)

Evidence-based medicine employs the scientific method to develop and evaluate medical treatments. The germ theory of disease in an important part of evidence-based medicine's foundation, as specific germs have been identified through controlled scientific experiments as the causative agents for a number of diseases. TenOfAllTrades(talk) 18:10, 16 June 2008 (UTC)

You might want to read the articles on Chiropractic, homeopathy, ayurvedic, Traditional Chinese medicine and others listed at Category:Alternative medical systems to gain an understanding of how their followers believe they work. 79.66.45.237 (talk) 18:56, 16 June 2008 (UTC)

One of the core principles you need to understand when investigating alternative medical theories is that they often have different approaches to understanding and even defining human anatomy and disease (such as new age chakra theory or TCM meridian theory). In some cases, they may even implement verification methods that don't overlap with the scientific method; historically, chinese medicine relies much more strongly on induction from dogmatic principles than deduction from empirical evidence (not to say it is entirely unempirical). --Shaggorama (talk) 06:10, 18 June 2008 (UTC)

Germ theory is certainly not the "basis on which modern medicinal treatment" is conducted. It describes the 19th century discovery that certain diseases are caused by infectious microorganisms. Many others are not, and germ theory has nothing to do with the many thousands of diseases that are caused by other factors such as injury, genetic defects, poisoning, etc. See our disease article for more exaples of diseases unrelated to microorganisms. Dalembert (talk) 20:36, 18 June 2008 (UTC)

HIV+ People who don't develop the AIDS Virus

I think I read some story somewhere that a large group of women in Southern Africa who were HIV+ for decades but never developed AIDS. They also did not take any medicines or any of the sort to treat the HIV status. It was speculated that these women are either naturally immune to this virus or they contracted a type of HIV virus that can't do any damage. Has anyone heard of this story and where can I find it? --Anthonygiroux (talk) 19:05, 16 June 2008 (UTC)

If the the above is true, could that mean that some people are naturally (meaning born with) an immunity to some viral diseases? --Anthonygiroux (talk) 19:05, 16 June 2008 (UTC)

There are people with a natural genetic resistance to the AIDS virus. To be overly simplistic, the virus plugs into certain cells in the body to replicate itself. In a minority of people, the socket on those cells is slightly different, but not enough to inhibit the normal function of those cells. That slight difference in the socket means that the virus isn't able to plug into them and cannot replicate. Because this is genetic, the chance of spreading this from parents to children is much higher than a child sporadically forming the mutation. Therefore, finding a group of genetically related people with the same mutation is not abnormal. As for your specific question, the women were from Nairobi. So, googling for "Nairobi women hiv aids" should turn up the articles you want. -- kainaw™ 19:41, 16 June 2008 (UTC)

Just to be clear, HIV *is* the AIDS virus. AIDS is a syndrome, not one disease. --70.167.58.6 (talk) 19:48, 16 June 2008 (UTC)

As I understand it, those with an immunity to bubonic plague also have partial immunity to AIDS. Since Europe was decimated by the Plague over centuries, many of those Europeans who survived passed on at least a partial immunity. This might be one factor to explain why AIDS is so widespread in Africa, but not in Europe. Based on the large portion of people dying in Africa, I'd expect to see an increased level of immunity soon among the survivors, just like in Europe. StuRat (talk) 20:47, 16 June 2008 (UTC)

I don't understand how the "partial" immunity would work. I may have misunderstood Kainaw but if the socket is different then it's different. How could one be partially immune? Zain Ebrahim (talk) 20:57, 16 June 2008 (UTC)

There's a group of people who appear to be natural carriers of HIV: they can get infected with the virus, but even after 20+ years, it hasn't developed into AIDS. --Carnildo (talk) 22:34, 16 June 2008 (UTC)

I think the wording "natural carriers" could be misconstrued - it's not a "typhoid mary" situation, they just seem to have an inborn relative resistance to HIV disease progression. The majority in cohorts of these long-term non-progressors eventually suffer disease progression and require treatment, for reasons that are currently being studied intently. There is a group of "elite suppressors" who have viral levels below the limit of commercial assays, but even some of these people eventually develop higher levels of viremia and have CD4 depletion. Scray (talk) 02:17, 17 June 2008 (UTC)

To better understand this, I suggest you read HIV#The clinical course of infection. As was described earlier, AIDS is a condition that can result from HIV infection. It is possible to be HIV+ and be asymptomatic. Basically, once you have the virus in your body, your immune system is constantly undergoing a tug-of-war with the viral population: CD4 T-cells vs. virus particles. If the balance shifts too far towards the virus, then it overcomes your body's immune capabilities and effectively destroys your immune system. Then you have AIDS: a lethal susceptibility to opportunistic diseases which your body could otherwise handle with a normal immune system, which HIV annihilated. --Shaggorama (talk) 06:23, 18 June 2008 (UTC)

Archaeopteryx / dromaeosaur scaly muzzle?

I've been wondering about this for a while. Archaeopteryx and dromaeosaurs in general are depicted with scaly muzzles. 90% of the time their muzzles are described as scaly, and the other 10% of the time they are described as having horny beaks, which is incorrect. Fossils like Archaeopteryx and Sinornithosaurus show that at least part of the muzzle was featherless, and the skulls show anchor points for some kind of lips, but is there a specific reason for assuming that these lips were scaly in particular, as opposed to smooth skin or something else? I know one could look at the taxonomic relationships and logically assume that since Archaeopteryx/dromaeosaurs were intermediate between theropods and birds, and did not have beaks yet, they probably still had scaly theropod lips, but is there any reason other than that? Have they found skin impressions, or is there some feature of the bones in the snout that implies scaly skin in particular? 70.212.190.196 (talk) 20:58, 16 June 2008 (UTC)

First, the presence of lips is still debated, and I'd say a majority of researchers prefer a lipless, bird/crocodile arrangement, or only very simple lips that only partially cover the top of the teeth (anything more would be problematic in species where the teeth protrude past the bottom of the lower jaw, like tyrannosaurs). I also wouldn't say it's incorrect that they had some kind of horny beak, there's no evidence one way or the other right now for most species. As far as I know, there are no skin impressions from the very end of the snout known. This would require a really, exceptionally well-preserved specimen, as skin impressions usually lie at the margin of the body, not on top of the bones themselves, and whatever integument theropods had on their heads, it apparently didn't protrude enough to leave a mark (or wasn't noticed and was destroyed in preparation, as has happened to some portions of the Archaeopteryx feather impressions).

So to answer your question, no, there's no reason to think the snouts were scaly, they very well could have had naked skin, or been completely covered in feathers. Sinornithosaurus, as you pointed out, had a feathered snout save for (apparently) the very tip, but that could just as well be a preservation artifact. Based on living analogues, in my opinion, scale-less snouts would probably be more likely. Many birds have naked skin between the beak and start of feathers, despite retaining scales on the feet. Not sure if this would hold for fingers as well, I wonder if hoatzin chicks have feathers, scales, or naked skin on their fingers... Dinoguy2 (talk) 04:24, 18 June 2008 (UTC)

This is a really helpful reply, thank you. I didn't mean real thick lips, just the sort of thin covering that keeps the gums from showing. I guess I could have said "snout", but I was trying to find some word that would denote the non-fuzzy portion. As for fingers, I don't know about hoatzins, but emus and baby cathartids have semi-naked, semi-fuzzy/feathery fingers, so I can imagine hoatzins would be the same. 75.208.3.255 (talk) 04:58, 18 June 2008 (UTC)

dogs and cats

Why do dogs (and cats) tend to sleep with their butts near your (and each others) head? —Preceding unsigned comment added by 69.77.185.91 (talk) 21:09, 16 June 2008 (UTC)

I'd say it's just that they lack the taboo we have on doing that. Therefore, they will sleep in any random orientation with regards to one another and/or you. You probably don't take much notice unless one has it's butt in someone's face. This draws our attention, since it's unusual. So, that's what we remember. StuRat (talk) 03:32, 17 June 2008 (UTC)

Yes, I'd say it's more a result of memory bias, or a specific individual difference of the dog(s)/cat(s) in question. --Mark PEA (talk) 20:08, 17 June 2008 (UTC)

Any possibility that this is a deliberate group act so that they face out away from you (thus being able to look out for danger or better able on being disturbed to do so). ? David Ruben ^Talk 00:23, 18 June 2008 (UTC)

Or because they dislike human breath. Dogs certainly seem to, at least. 75.208.3.255 (talk) 04:02, 18 June 2008 (UTC)

Dog: "Geez, what's with your breath ? It smells like flouride, as if you've never even licked your butt or privates or even eaten any decaying road-kill. Do you need me to show you how ?" StuRat (talk) 13:27, 18 June 2008 (UTC)

My cat always sleeps facing me, and if I turn away she immediately moves around to my face again. Jessica - N10248 (talk) 18:02, 20 June 2008 (UTC)

Hot humid wet vs. Dry desert climate, overheating which more dangerous on the human body

Once, I was taught in high school biology that for a human, a hot climate but with high humidity (ie. tropical wet climate) is more dangerous than a similarly dry one, because humans can't sweat and overheat more easily, while, in the dry climate, the water can evaporate, cooling you off. But I argued that always thought that it would be the contrary, the desert clime makes you lose water faster, and its sun is stronger. With all health affects considered, which is more dangerous for a human being, especially for travelling long distances or strenous exercise, risk collapsing and death? —Preceding unsigned comment added by 192.30.202.21 (talk) 23:54, 16 June 2008 (UTC)

I live in a hot and humid place and I think the humidity problem is more of an irritant (it makes you feel greasy and uncomfortably warm) rather than a problem.--Lenticel ^(talk) 00:17, 17 June 2008 (UTC)

I have lived in hot-dry (Twentynine Palms, CA) and hot-humid (Charleston, SC). I haven't heard of many deaths from overheating in the hot-humid environment, but I heard of many deaths in the hot-dry environment. This could easily be because of population. If you overheat in a hot-humid city, someone will notice. If you overheat in the desert, you could be there for weeks before you are found. -- kainaw™ 00:50, 17 June 2008 (UTC)

(EC) I agree with Lenticel. With a hot & humid place, you very easily feel uncomfortable. The difficulty your body has in sweating can also make an equivalent temperature seem hotter. 'More dangerous' seems unnecessarily broad and will surely depend on your situation. If you have lots of electrolytically balanced water then a humid place is likely to be more of a problem on the whole. If you have little water then a dry place is more likely to be a problem. Both of these are presuming we are talking about similar temperatures and that you know what you are doing, i.e. you don't take too much water. Clearly a 30C humid place is rather different from a 45C dry place. In any case, if you are smart enough to pace yourself properly, don't overexert yourself and ensure you have sufficient practice for whatever you are attempting, I suspect the likelihood of death is low. For references, see Craig Barrett (athlete) who for some strange reason was seen as a hero in NZ after he collapsed during the 1998 Commonwealth Games (in Kuala Lumpur, therefore a hot and humid place), although IMHO he was really just an idiot. I've seen various suggestions he was close to death, I don't know how true it is but it wouldn't surprise me if it was. Obviously the chance of him dying given that he was taking part in the Commonwealth Games and would have had access to excellent medical care is very low but I think it does emphasise what happens when you are stupid and push yourself too hard (he was 6 minutes ahead of the person behind him when he collapsed, so it's not as if he had to go that hard) in a situation you presumuably haven't practice enough for; and potentially do other stupid things (the article suggests the was drinking pure water and probably suffered from water intoxication). Nil Einne (talk) 01:24, 17 June 2008 (UTC)

If you're in a hot place (low or high humidity), you're going to sweat a lot. It's what your body does to try to cool you down. If you don't have copious amounts of fresh water to drink, you're going to get dehydrated, which can lead to health problems real quick. If you're exercising, it's worse, because you're generating that much more metabolic heat that you have to get rid of.

If the humidity is high, your sweat doesn't evaporate as well, so doesn't cool you as well, so it's easier to overheat, and that can lead to health problems, too. Plus, of course, the stickiness makes you way uncomfortable.

If the humidity is high and you don't have any water, you're going to be sticky and uncomfortable on top of being seriously overheated on top of being dehydrated. Triply bad news.

Me, I'd much rather be in a hot, dry place than a hot, humid place. Your sweat cools you very well when it's dry. If you've got water, you won't get dehydrated. If you've got sun protection, you won't get sunburned.

(I fondly remember summers at my grandparents' house in Palm Springs, which is where my dad grew up after they moved from, as it happens, Twentynine Palms. So I know what Kainaw's talking about. I've also lived in St. Louis, and I absolutely hated it.)

When I hear about people dying in heat waves, my impression (contrary to Kainaw's above) is that it tends to be in humid, inland, non-desert climates. You hear about the old and the infirm being relocated to public places where there's good air conditioning, because that can be the only way to survive under hot and humid conditions. When there's a heat wave in (say) Phoenix, Arizona, on the other hand, I suspect that what's most important is just to stay in the shade, drink lots of water, avoid exerting yourself, and maybe fan yourself gently to goose the evaporative process that little bit further. I don't think people are nearly as prone to heat-related death in the absence of air conditioning in Phoenix as they are in Chicago or St. Louis. So I'm inclined to think that, everything else being equal, humid heat is more dangerous than dry heat.

If a desert climate is more "dangerous" overall I think it's because there's less likely to be water, and there's less likely to be shade. But I wouldn't say it's dangerous because of losing water faster there, because as I said, you sweat just as much when it's humid. (The difference is that when it's dry, your sweat evaporates immediately and cools you as it's supposed to. In the desert, you hardly realize you're sweating profusely -- which can, it's true, make it easier to forget to drink enough water to rehydrate yourself. Oh, and you can remember your name, 'cause there ain't no one for to give you no pain. :-) ) —Steve Summit (talk) 01:13, 17 June 2008 (UTC)

Obviously it depends on your situation and thus to compare the two one must eliminate other variables. In a typical house with no air conditioning in a city with plenty of water a person would be at more risk of heat stroke in a humid climate as the body will over heat more. In the same situation but without water I am unsure of the relative rates of water loss, more evaporation does not necessary mean more sweat. It would be impossible to comment on whether it is 'safer' to be lost in the wilderness in dry climate vs a humid one without going into specifics such as; avaliablity of water (you can't claim there is more potable water in humid climates); shade; actual temperature; actual humidity etc--Shniken1 (talk) 01:47, 17 June 2008 (UTC)

There would definitely be more water loss from breathing etc, although the quantity lost is probably small enough that it is insignificant Nil Einne (talk) 01:52, 17 June 2008 (UTC)

That's a very good point, and I'm not sure it's insignificant. —Steve Summit (talk) 02:08, 17 June 2008 (UTC)

A couple points:

1) Our sweat glands are rather stupid: They don't seem to know that if it's 100% humidity out there's no point in sweating as it will just drip in your eyes instead of evaporating. Therefore, you can lose a lot of water by sweating, even in humid climates.

2) Being uncomfortable is a good thing: In that it causes you to take actions to cool yourself, like taking a cool bath. If high humidity makes you uncomfortable earlier, that may convince you to act before it's too late. StuRat (talk) 03:29, 17 June 2008 (UTC)

June 17

Male orgasm and analgesic chemicals

Are any chemicals with known analgesic effect released during male orgasm? 99.227.1.49 (talk) 05:43, 17 June 2008 (UTC)

The male orgasm results in the release in endorphins (and probably most of the other hormones with an analgesic effect too), as does sex in general I think but to a lesser degree, although surprisingly neither our orgasm article nor our male ejaculation article mentions this (the endorphins article does mention they are released during an orgasm). Nil Einne (talk) 06:13, 17 June 2008 (UTC)

I thought it was not really known, since it's hard to measure what chemicals are being released when someone is having sex, it would be great if they could ejaculate and then be killed instantly and slice their brain up. Anyway, don't forget oxytocin, and I'm sure a heck of a lot of other neurotransmitters, polypeptides and hormones. Oh... just read the title, not sure about analgesics. --Mark PEA (talk) 20:06, 17 June 2008 (UTC)

Ibotenic acid

Does anyone here know how ibotenic acid got its name? I have a guess but it's probably wrong ;) . Does anyone know for sure who named it and why was it named this way? Thanks, --Dr Dima (talk) 06:05, 17 June 2008 (UTC)

From a quick Google (second page) leading to [6] "The name is derived from Ibotengu-take, the Japanese designation for A. strobiliformis (Paul.) Qu?l. Eugster and Müller [ 24] , who originally discovered this compound, provisionally called it &alpha-toxin and later [ 25] named it premuscimol. After an agreement between Eugster and Takemoto (26), the name ibotenic was retained". N.B. Anyone is welcome to use the source which appears to be an RS to improve the article Nil Einne (talk) 06:19, 17 June 2008 (UTC)

Well done Nil Einne! Thanks a lot. I missed that ref... --Dr Dima (talk) 06:40, 17 June 2008 (UTC)

Formation of peptides

The wikipedia article on Abiogenesis states that: "Polyphosphates cause polymerization of amino acids into peptides" Can anyone please state a chemical equation which serves an example verifying this fact?Leif edling (talk) 06:45, 17 June 2008 (UTC)

Can't find an exact equation bit I found some papers describing the "mix" and conditions they used, but I can't access the rest of the full article... (https://doi.org/10.1007%2FBF01732355) (https://doi.org/10.1007%2FBF02100094) Try checking the who this paper cites function if one exists and you probably be able to track down the seminal works. 71.77.4.75 (talk) 19:52, 17 June 2008 (UTC)

North

Is north existing on other planets than Earth? --Kr-val (talk) 08:13, 17 June 2008 (UTC)

Yes, in both the magnetic and geographic (rotational axis) senses. In fact there's an earlier question on this page (which will soon go to the archives) about the Martian north pole. The relevant article seems to be Poles of astronomical bodies. -- Coneslayer (talk) 11:32, 17 June 2008 (UTC)

But not all other planets. Some lack a significant magnetic field, for example. It seems less likely that a planet would not have any rotation, but it's possible, I suppose. StuRat (talk) 14:34, 17 June 2008 (UTC)

allopathy

what are the uses of allopathy —Preceding unsigned comment added by 59.98.34.248 (talk) 12:31, 17 June 2008 (UTC)

Have you read our article on allopathy? You can find articles in Wikipedia by using the 'search' box in the panel on the left side of the screen. TenOfAllTrades(talk) 12:55, 17 June 2008 (UTC)

Allopathic medicine is often referred to as "western" medicine. Osteopathy could also be considered western because it has come to incorporate alot of allopathic theory, but most allopathic folk consider it to be quackery so it has been largely marginalized as an alternative medicine theory. If you have ever been to a major hospital, internist, or general pracitioner then chances are high you've experienced allopathic medicine first-hand. --Shaggorama (talk) 06:32, 18 June 2008 (UTC)

Allopathy is a 19th century term that was introduced by homeopaths to describe practitioners of all other healing methods besides homeopathy. It was inaccurate then and is even more inaccurate now when used to describe scientific, western, conventional, or non-placebo medicine. Dalembert (talk) 20:28, 18 June 2008 (UTC)

From the medline medical dictionary [7]:

• Allopathy: 1. a system of medical practice that aims to combat disease by use of remedies (as drugs or surgery) producing effects different from or incompatible with those produced by the disease being treated. 2 : a system of medical practice making use of all measures that have proved of value in treatment of disease.
• Homeopathy: a system of medical practice that treats a disease especially by the administration of minute doses of a remedy that would in healthy persons produce symptoms similar to those of the disease.
• Osteopathy: a system of medical practice based on a theory that diseases are due chiefly to loss of structural integrity which can be restored by manipulation of the parts supplemented by therapeutic measures (as use of medicine or surgery).

--Shaggorama (talk) 06:35, 20 June 2008 (UTC)

Photons

Hi! I'm a high school student and I'll be grateful if anyone can clear this doubt of mine- Does photons have mass(any mass at all, however negligible)? According to the De-Broglie's equation, λ= h/mv, it should have mass, or wavelength will be infinite, won't it?(correct me if I'm wrong). And again, if it has any mass at all, substituting in the equation, m= m₀/ sqrt(1- v2/c2), light will have infinite velocity, as light travels at the speed of light..................So, can anyone explain to me if photons ahve mass?? Thanks in advance. 116.68.76.173 (talk) 14:33, 17 June 2008 (UTC) 15-year-old

Photons are funny creatures. By definition, they have no rest mass, but a photon does have momentum p = hν/c. In the de Broglie relations, the formula you've provided is a derivation that applies to and works only for particles with mass. The original formulation, λ = h/p, gives the correct wavelength for photons (λ=c/ν). TenOfAllTrades(talk) 14:50, 17 June 2008 (UTC)

Well, it's not by definition that they have zero rest mass. It's an observed contingent fact about the world. There's a reasonably well-developed theory of how things such as Maxwell's equations would be different if photons had nonzero rest mass. Comparing this with observations leads to an extremely small (but positive) upper bound on the photon rest mass. --Trovatore (talk) 00:14, 18 June 2008 (UTC)

You might also be interested in division by zero. --Sean 16:36, 17 June 2008 (UTC)

See Mass in special relativity and Photon. --Prestidigitator (talk) 23:57, 17 June 2008 (UTC)

The equation you gave for wavelength, λ= h/mv, is incorrect, that is the non-relativistic approximation. The correct equation, given in our article on the de Broglie hypothesis is

$\lambda ={\frac {h}{mv}}{\sqrt {1-{\frac {v^{2}}{c^{2}}}}}$

With this equation, the term under the square root sign is zero, and the mass is zero too, so you end up with zero divided by zero, which is indeterminate. So the wavelength is not infinite, it's just not specified by that equation. It is specified by other equations, as TenOfAllTrades pointed out. -- Tim Starling (talk) 17:48, 18 June 2008 (UTC)

That's equivalent to using the original equation, but with relativistic mass, right? Light does have relativistic mass, so that would get an answer. — DanielLC 19:04, 19 June 2008 (UTC)

Safest, Richest Country in the World?

What is the safest, smartest, healthiest, happiest country in the world with a high GDP? And, how hard would it be for a US citizen to move there? --Anthonygiroux (talk) 17:33, 17 June 2008 (UTC)

You'll need to better define your terms if you want a definite answer. "Safest" and "smartest" are particularly vague, and you've given no indication as to the weight assigned each. — Lomn 17:37, 17 June 2008 (UTC)

"safest" - low crime; "smartest" - superior educational system compared to the US. --Anthonygiroux (talk) 17:39, 17 June 2008 (UTC)

• List of countries by homicide rate
• List of countries by literacy rate
• List of countries by life expectancy
• Quality-of-life index
• List of countries by GDP (nominal)

You may also be interested in the list of countries by Human Development Index, an amalgam that may be similar to what you're looking for. Incidentally, all these lists are cross-linked from each other, along with many other such measures, in the relevant infobox. — Lomn 18:04, 17 June 2008 (UTC)

And List of countries by GDP (nominal) per capita as the non-per-capita figures don't really relate well to standard of living. Fribbler (talk) 18:17, 17 June 2008 (UTC)

True, though I don't know that either is strictly relevant to an individual. One's own salary would seem to be of greater import. — Lomn 19:04, 17 June 2008 (UTC)

Relative salary is what's important. In the US, $50,000 a year would be middle-class in most of the country. In India, it would make you upper-class, and in some parts of Africa, it would make you one of the richest people. --Carnildo (talk) 21:36, 17 June 2008 (UTC)

Canada might be a good choice for someone in the US, as it's close, relatively easy to move to, the culture shock isn't that much to overcome, and they speak English. They also rate reasonably well in all those categories listed above. StuRat (talk) 21:22, 17 June 2008 (UTC)

For that matter, simply moving within the US is likely to meet all the specified criteria, and is certainly the easiest way to accomplish the move. — Lomn 21:52, 17 June 2008 (UTC)

If you want a city, check out World's Most Livable Cities. You have to go a long way down to find an American city, however. Further to the above this goes into more detail about methodolgy and discusses safety rankings. Gwinva (talk) 08:19, 18 June 2008 (UTC)

Note that Vancouver, Canada is 4th on the list, and the first city on the list where English is the native language. StuRat (talk) 13:18, 18 June 2008 (UTC)

There's also the Global Peace Index which delivered rankings in May this year. A report here in Oz claimed we came 10th – they lied! For a non-gun culture nation, we came a lousy 27th and dropping. Very disappointing. :( Julia Rossi (talk) 00:01, 19 June 2008 (UTC)

Well, if you're throwing that into the equation, there's one clear answer: Auckland, New Zealand: the only place in the top five in each list. English speaking, too. (Julia: the 10th ranking might refer to Sydney, on the Cities list??) Gwinva (talk) 00:12, 19 June 2008 (UTC)

Ah, that's better, though Sydney strangely tops a list of other Australian cities I would have thought were safer, smaller, friendlier including others that weren't listed like the nation's capital. Julia Rossi (talk) 02:01, 19 June 2008 (UTC)

Some european countries have a higher per-capita GDP than the US, particularly the micro-countries, and (being european) very much lower murder rates. As far as I recall Luxembourg has the highest GDP per capita (PPP) I think. See List of countries by GDP (PPP) per capita 80.0.101.122 (talk) 22:41, 19 June 2008 (UTC)

If it is important to you, you might want to also consider the Index of freedom. Mac Davis (talk) 02:47, 20 June 2008 (UTC)

future in biotech ???

i need help regaridng biotech program,wat courses does it offers and is there any good future in india or any other countries ?please let me know. i am student and wanted to take biotecnology course ,so ,kindly suggest me to take or not , thanks . —Preceding unsigned comment added by 123.176.45.2 (talk) 18:30, 17 June 2008 (UTC)

Please see the Wikipedia article on Biotechnology to see what biotechnology is. Biotechnology is a very "hot" field with many career opportunities. India's market in biotechnology seems to be growing from the information I see here. A little ways down in the same article, they indicate that many Indian biotech companies are lacking qualified employees, so it seems there are probably many well paying careers. Biotechnology covers a lot of different subfields such as development of Pharmaceutical products, Genetic testing, Creating special crops for higher yield or parasite resistance, genetic engineering, bioinformatics, biomaterials, stem cell research, and many, many others. Classes in genetics, cell biology, molecular biology, biochemistry, and developmental biology are relevant to Biotechnology. Before you can take these classes though, make sure you have taken basic level science courses. If you need specific advice you should consult professors, advisor, or professionals. 71.77.4.75 (talk) 19:08, 17 June 2008 (UTC)

You may want to speak to a college counselor. --Shaggorama (talk) 06:34, 18 June 2008 (UTC)

kidney transplant

My cousin is A- blood group and i am B+ blood group is there a way i can still donate my kidney to cousin —Preceding unsigned comment added by Shelleytes (talk • contribs) 20:09, 17 June 2008 (UTC)

Kidney transplantation#Compatibility discusses blood types and compatibility. We are unable to provide medical advice here; you should check with your doctor (or your cousin's doctor) about the particulars of your case. Best of luck. -- Coneslayer (talk) 20:15, 17 June 2008 (UTC)

Has it been done? Sure:[8]. Is it common. Not by a long shot, ABO incompatability transplants are still experimental. Would the surgeon consider using the technique in this case? Thats up to him/her. Theres no harm in asking their opinion. Fribbler (talk) 20:24, 17 June 2008 (UTC)

"In 2004 the FDA approved the Cedars-Sinai High Dose IVIG protocol which eliminates the need for the donor to be the same blood type." - It can be done, not sure about the statistics of rejection with this method, though. You really need to consult your physician on this one, pal. Regards, CycloneNimrod ^talk?_contribs? 20:26, 17 June 2008 (UTC)

You'll need to consult with your cousins doctors on this one, not just because we can't give medical advice here but because there's more involved than blood type. I hope your cousin gets better and/or finds a kidney. --Shaggorama (talk) 06:38, 18 June 2008 (UTC)

Einstein and the Atomic Bomb

What's the relationship between Einstein's work on general relativity and the development of the atomic bomb? Is it unlikely that the bomb could have been created without the theory of general relativity as a foundation? E^robson (T^alk) 22:31, 17 June 2008 (UTC)

Does this help? Fribbler (talk) 23:24, 17 June 2008 (UTC)

It does, thanks! This is interesting: "According to Szilard, Einstein said the possibility of a chain reaction 'never occurred to me', although Einstein was quick to understand the concept." E^robson (T^alk) 23:37, 17 June 2008 (UTC)

Einstein was always a bit slow! ;-) Fribbler (talk) 23:51, 17 June 2008 (UTC)

You could have created the atomic bomb without General Relativity—none of its effects fall under General Relativity's auspices (they are too small). The specific mass-energy equivalence formulae (E=MC^2) itself does fall under Special Relativity, but fission itself is non-relativistic. See E=MC2#Nuclear_energy_and_popular_culture. As Robert Serber put it:

Somehow the popular notion took hold long ago that Einstein's theory of relativity, in particular his famous equation E=mc2, plays some essential role in the theory of fission. Albert Einstein had a part in alerting the United States government to the possibility of building an atomic bomb, but his theory of relativity is not required in discussing fission. The theory of fission is what physicists call a non-relativistic theory, meaning that relativistic effects are too small to affect the dynamics of the fission process significantly.

Einstein had a small role in the development of the atomic bomb—the little bit of work that was done because of his letter was not much, and its main significance is that it got Roosevelt interested in the possibility in the first place, which paved some of the way for others (esp. Vannevar Bush and Ernest Lawrence) to push Roosevelt towards making it a much bigger project in 1942. --98.217.8.46 (talk) 16:49, 18 June 2008 (UTC)

^Pretty much. He just wrote a letter to the president saying atomic weapons would be useful. While the theory of general relativity is of minor importance to the atomic bomb, the theory of special relativity is of importance to the relativistic bomb, especially when calculating the amount of energy released. ScienceApe (talk) 17:51, 18 June 2008 (UTC)

Coriolis effect and cyclones

Question moved from Reference Desk Talk Page. Fribbler (talk) 22:38, 17 June 2008 (UTC)

Can the coriolis effect be explained as an effect of conservation of angular momentum with respect to Earth's axis (or any other rotating system)? I understand that the acceleration of cyclones and hurricanes is due to conservation of angular momentum with respect to the center of the cyclone itself, as air close to the ground moves inwards. /Yvwv (talk) 22:34, 17 June 2008 (UTC)

Enough Data?

Hello. My school year ended. This reference desk is one of the few places where I can ask questions. I pulled the following question from a physics textbook:

Some sea birds, such as the royal tern, dive from considerable heights into the water to catch fish.

a) By how much does the velocity of a royal tern increase each second, ignoring air resistance?

b) How long, in seconds, does it take a falling royal tern to increase its velocity by 15 m/s?

c) What is the final velocity of a royal tern just before it hits the water after falling from rest for 1.75 s?

My book earlier mentions that the acceleration due to gravity is 9.81 m/s². I doubt that it has anything else relevant. Do I have enough data to answer the question above? Thanks in advance. --Mayfare (talk) 23:46, 17 June 2008 (UTC)

Yes. WilyD 23:49, 17 June 2008 (UTC)

Here's a hint... While the classic gravity experiment involved dropping a large and a small ball from the tower of Pisa, it may as well have involved dropping a royal tern and a common tern from a seaside cliff. If air resistance is ignored, which would fall faster? -- kainaw™ 00:54, 18 June 2008 (UTC)

It should be noted that the popular belief about the experiment is apocryphal; in reality, Galileo rolled balls down inclined planes (see Galileo Galilei#Physics). As for the original question, 9.81 m/s^2 can be written as 9.81 m/s/s. --Bowlhover (talk) 05:36, 18 June 2008 (UTC)

The use of a bird is actually a bad one. You also need to assume that the bird is falling like a rock -- no wing flapping, and no horizontal component of motion. — Lomn 01:38, 18 June 2008 (UTC)

Spherical bird in a vacuum, it's a physics problem. WilyD 01:52, 18 June 2008 (UTC)

See also Spherical cow. -- Coneslayer (talk) 14:43, 18 June 2008 (UTC)

Don't try to make this more complicated than it is, nothing more than multiplication and division is needed here. (Now, if you want to answer some questions here in return for the answers you've been given, that would be great, since, after all "one good tern deserves another".) StuRat (talk) 02:46, 18 June 2008 (UTC)

Is it carrying a coconut? If it is it may not be able to maintain minimum flight velocity.--Shniken1 (talk) 03:27, 18 June 2008 (UTC)

Equations of motion may help you here (at least for part c). AlmostReadytoFly (talk) 08:52, 18 June 2008 (UTC)

June 18

Metal detectors and gold

I'm watching Law & Order: Criminal Intent, and the detective says gold doesn't set of (security) metal detectors. Is that true? Thanks. Imagine Reason (talk) 03:30, 18 June 2008 (UTC)

Pretty sure all conductors set off metal detectors. My high school physics teacher (who had a Ph.D. in physics, actually) did tell us before 9/11 that you can theoretically make a gun from lead and walk extremely slowly through and not trigger it though. --Wirbelwindヴィルヴェルヴィント (talk) 03:48, 18 June 2008 (UTC)

Security metal detectors use alternating current to detect conductive metals. Gold is a conductor. Please see metal detector#Security screening for more details. By the way, I should mention before other Wikipedians start embarassing me that I am learning the art of sucking up to StuRat. --Mayfare (talk) 04:03, 18 June 2008 (UTC)

Metal_detector#Discriminators mentions gold, but I've little idea what it says. Imagine Reason (talk) 05:44, 18 June 2008 (UTC)

It sounds to me like it's referring to metal detectors for detecting old treasure or lost valuable items. For those sort of metal detectors, you probably want them to detect gold, but not necessarily iron or other metals likely to be used in items that you are not interested in finding. You therefore need to discriminate between these sort of metals. The trouble is, according to the article tinfoil is close to gold from what the metal detector sees, therefore there is a strong risk you will make a metal detector that misses out not only tinfoil, but gold as well. However presuming you are referring to the types used in airports, my guess is they want to detect most metals. The primary discrimination is probably in size. You don't want them to detect any tiny bits of metal as you may end up wasting too much time having to manually search people for any such tiny bits of metal and/or may get too complacent. Nil Einne (talk) 10:26, 18 June 2008 (UTC)

Question about inventors/mechanical engineers.

Hello,

Does anyone have any information about Henry Boltrek? He is the man who invented the modular escalator and many other people-moving items. I have been able to find information on some of his patents, and on his service record during WWII in Normandy and the Battle of the Bulge. However, there does not seem to be much on him specifically as an inventor. Thanks in advance.

Cheers,

Josh —Preceding unsigned comment added by 123.200.254.253 (talk) 04:26, 18 June 2008 (UTC)

Bees & Orangutans

What is the specific term used for male bees? What are female & male orangutans called? Thanks.Macmayi (talk) 06:42, 18 June 2008 (UTC)

Male bees are drones. Mac Davis (talk) 08:27, 18 June 2008 (UTC)

As far as I'm aware, there are no specific male/female names for most or all primates. They're simply male/female. [9] However you could call them 'orangutan jantan' for males and 'orangutan betina' for females I guess since the name originates from Malay... Nil Einne (talk) 10:19, 18 June 2008 (UTC)

Thank you Mac Davis & Nil Einne. Info & website given was helpful.Macmayi (talk) 10:45, 18 June 2008 (UTC)

I am searching for a circuit of blood pressure monitoring machine

Dear Sir I am searching for a circuit which is used in making blood pressure monitoring devices. if you have any information about such type of circuit can you please send it on my email-id removed i will be really thankful to you warm regards Devinder —Preceding unsigned comment added by Tvmteleshopping (talk • contribs) 06:45, 18 June 2008 (UTC)

Hi, I've taken the liberty of removing your email address from your post, to prevent spam. We answer questions here on this board. AlmostReadytoFly (talk) 08:47, 18 June 2008 (UTC)

Are you searching for a circuit board or circuit diagram ? StuRat (talk) 13:11, 18 June 2008 (UTC)

What is the SPF of hair?

A coworker came back from a skiiing trip and got a short haircut and beard trim after he got back. I could clearly see a tan line around his forehead and neck where the hair once was. It made me wonder what SPF does hair have and at what density? For example, does body hair ever reach the density to provide protection or is it just on the head where hair is densest? --69.149.215.102 (talk) 12:47, 18 June 2008 (UTC)

I believe dark hair is completely opaque to ultraviolet light, so you just need enough to block the sunlight and that provide's an infinite Sunlight Protection Factor. I'm not sure about blonde and/or white hair, that may not be completely opaque to UV. StuRat (talk) 13:08, 18 June 2008 (UTC)

Sorry to nitpick, Sturat, but the entire point of SPF is to quantify opacity, beyond the binary "opaque"/"transparent". Nothing is "opaque" if the incident radiation is of sufficient intensity. Unfortunately I have no idea what the relative opacity of hair would be with respect to standard commercially available sun-block. Nimur (talk) 14:48, 20 June 2008 (UTC)

Nothing is opaque ? I beg to differ, but a meter thick wall of steel is rather opaque to UV, unless you have enough of it to melt the steel. StuRat (talk) 05:41, 21 June 2008 (UTC)

Vegetable oil in diesel motor

May I use vegetable oil in the diesel motor of a car? Would be a mixture 50/50 be possible? 80.58.205.37 (talk) 14:32, 18 June 2008 (UTC)

Have you read our articles on biodiesel and vegetable oil used as fuel? — Lomn 14:40, 18 June 2008 (UTC)

New vegetable oil will likely cost more than diesel, even at today's inflated prices. However, if you get used oil from a restaurant and filter it, that makes for cheap fuel, and, unlike diesel, it smells good. StuRat (talk) 15:16, 18 June 2008 (UTC)

Many diesel engines (especially the older ones) are quite satisfied with running used vegetable oil. You may want to check with the manufacturer of your vehicle, and more-so if it is currently under warranty. That said, my family owns and 1964 Mercedes-Benz diesel pontoon-style station wagon (former ambulance) that runs with used vegetable oil from a local restaurant. We are happy to take their waste oil as fuel, and they are happy because they no longer must pay to dispose of it. Depending on your climate (notably, the cold areas), you may need to heat your oil before combustion to lower the viscosity. Because we live in northeast USA where there are often below 0^•C temperatures, we still use regular #2 diesel in the stock fuel tank and have constructed an alternate tank with heated pipes for the vegetable oil. The car is started on diesel and run until the oil system has heated, and the fuel is then drawn from the oil tank by way of a solenoid fuel switch and pump.

By using 50/50 oil/diesel, and depending on climate, you may reduce the need to heat your oil. Good luck. Freedomlinux (talk) 15:33, 18 June 2008 (UTC)

I'm not sure about that. Wouldn't the part that congeals just separate out and clog up the plumbing ? StuRat (talk) 16:27, 18 June 2008 (UTC)

Yes. Same problem with mixing diesel and unleaded gasoline, or mixing ethanol and gasoline, or mixing... About the only thing I've ever found to mix well for a reasonable amount of time is 10W40 oil and gasoline - primarily used in 2-stroke engines. It doesn't work as well as proper 2-stroke oil, but it is good enough if you mix, pour, and ride right away. -- kainaw™ 00:29, 19 June 2008 (UTC)

One liter cooking oil costs 0.79 euros and one liter diesel 1.45 euros. I suppose that the cooking oil has less energy than the diesel, but it is still much cheaper. 80.58.205.37 (talk) 12:27, 19 June 2008 (UTC)

Wow, I guess that's due to higher fuel taxes in Europe. I don't think vegetable oil is cheaper in the US. StuRat (talk) 14:14, 20 June 2008 (UTC)

Specifically to the original question, depending on your vehicle yes you can mix veggie oil directly with diesel, and use it as fuel. You may run into difficulties with particular model, but I have on several occasions added cooking oil directly to my the tank of my 82 Mercedes Diesel. These models years are notorious durable (78-83). Yes, generally veg oil does gel at lower temps than diesel, especially the weather treated diesel you find in cold climates, during the winter months. In some countries this may be illegal, in that Environmental laws may limit the fuels that are permissible in cars to the ones that are government approved. If you are going to make a habit of running Veg Oil in your car, you may still want to filter it, as inline fuel filters are far to permissive to filter raw fuels, and although I don't know for a fact the raw oils are going to pose a problem, it seems possible/likely that the are not filtered down to the level of engine fuel - Will K Jan 22 2010

reaction torque

i want to know about reaction torques , where can i find some detailed and relaible account?? like the first 2 laws of motion can be extended to rotational dynamics as well, is it always right to say that to evry torque there's an equal and opp torque???--scoobydoo (talk) 15:06, 18 June 2008 (UTC)

No, because linear motion can be changed into rotational motion and vice versa. For example, after a cue stick hits a pool ball, the ball has a torque, although the cue stick had none. This is similar to the laws of conservation of mass and conservation of energy, which aren't conserved under E=mc², but freely converted into one another.StuRat (talk) 15:12, 18 June 2008 (UTC)

Yes, for every torque there is an equal and opposite torque. The conservation of linear momentum means that forces in a closed system sum to zero, and similarly, the conservation of angular momentum means that torques in a closed system sum to zero. Note that to calculate torque or angular momentum, you need to pick an axis. If you change the axis halfway through the calculation, you'll find that the torques don't sum to zero anymore.

In response to StuRat: there is no physical difference between linear and rotational motion, it's just two ways of looking at motion. Movement in a straight line can be broken down into angular and radial velocity with respect to an axis. -- Tim Starling (talk) 18:09, 18 June 2008 (UTC)

Male animals killing young

Was just watching in a documentary how male lions (when a new alpha takes over as dominant in the pack) kill any cubs hanging around, so that his genes will be dominant and so wiping out genes from rivals (was so sad to see the little lion cubs trying to uselessly defend themselves, it broke my heart). I have also read that bears do too, but I don't think canines like wolves do, or herbivores like elephants, or whales/dolphins.Not sure if there are cases of humans doing this. In which kind of animal species do this occur then? (I can only think of lions and bears). Thanks for info, --AlexSuricata (talk) 15:31, 18 June 2008 (UTC)

I'm pretty sure cats do it sometimes (see [10]) Nil Einne (talk) 16:12, 18 June 2008 (UTC)

I think it's rather common in the mammalian world. Infanticide (zoology) has lots of info and this link does, too. — Scientizzle 16:15, 18 June 2008 (UTC)

There is some analogy with a new leader in a hereditary monarchy killing off all close contenders to the throne, including brothers, cousins, and uncles. I think this was popular during some periods in Byzantine history, and in the Osman empire (must be the water of the Bosporus ;-). --Stephan Schulz (talk) 16:35, 18 June 2008 (UTC)

Isn't that fairly different because he's killing off those closely related to him (becuase they may kill him before he kills them) rather then those not at all related to him (which is why lions etc do it). The lion equivalent is like Scar trying to kill Simba and Mufasa (except lions don't actually have hereditary monarchies in practice...) Nil Einne (talk) 17:32, 18 June 2008 (UTC)

There are certainly past examples, such as the Russian Revolution (1917), where new leaders gained power that they had no heriditary right to and consequently feel it is useful/necessary to exterminate everyone with a bloodline claim to the power they are trying to preserve. Dragons flight (talk) 23:09, 18 June 2008 (UTC)

We see a usually more muted version of this genetic competition in humans, whose step-parents and step-children find it hard sometimes to be even genial to each other. On a tangential topic, humans (eg Spartacus) and other animals are known to kill weak offsprings. Some wonder if abortions are a technological implementation of that desire sometimes. Imagine Reason (talk) 05:10, 19 June 2008 (UTC)

Abortions in response to a detected abnormality in the foetus, certainly. The usually stated goal is to avoid the child suffering, but avoiding the "waste" of resources involved in bringing up a child that probably won't survive to carry on the bloodline probably does go through people's minds. --Tango (talk) 12:08, 19 June 2008 (UTC)

Surely you mean Spartans, not Spartacus? Algebraist 15:52, 19 June 2008 (UTC)

LOL, yes. Thanks for the correction. Imagine Reason (talk) 03:06, 21 June 2008 (UTC)

Coefficient of restitution

Hi! What does the coefficient of restitution depend on? I know that it's the ratio of velocity of separation of 2 bodies after collision to the velocity of approach, but how can we determine e, if we just know all the properties of the body, including initial velocity? It will only be of use, if we could determine it without knowing the final velocities, so that we may predict the velocities after collision using the value of e for 2 bodies, right? 116.68.77.43 (talk) 15:46, 18 June 2008 (UTC) A 15-year old HELLO?? Is there anybody to answer this question???? This is about inelastic collisions, what you have in school-level physics..................116.68.75.162 (talk) 14:10, 20 June 2008 (UTC) A 15-year old

aircraft carriers

aircraft carriers with a flat deck must have their bridge, conning tower, etc on one side. Now if you look here (image thumbnailed to reduce size -- TenOfAllTrades(talk)), these are all on the starboard (right hand) side. Why? Are there any with it all on the left hand side?

Early aircraft carriers varied wildly in design, with the British going so far as to retain the center superstructure on early efforts like HMS Furious. HMS Eagle appears to have been the first carrier to sport the starboard island design, and in lieu of evidence to the contrary, it seems reasonable to assume it was an arbitrary choice that became convention. Note, though, that many other early carriers, such as the USS Langley, used no superstructure, and the Japanese aircraft carrier Akagi used a port-side superstructure. — Lomn 17:08, 18 June 2008 (UTC)

A correction: our article on flight decks notes that rotary engines on early carrier aircraft tended to cause yaw to port, so a starboard-side superstructure reduced the odds of collision on takeoff and landing. — Lomn 17:23, 18 June 2008 (UTC)

Another possibility is that the photo is inexplicably reversed, as many images everywhere are sometimes. You may have noticed this in places like the internet or TV. 75.171.250.184 (talk) 20:40, 18 June 2008 (UTC)

The pennant numbers painted on the side of the ships disagree with your hypothesis. —Preceding unsigned comment added by 86.166.234.157 (talk) 21:52, 18 June 2008 (UTC)

Additionally, the article specifically notes that the Akagi and Hiryu were constructed with port-side superstructures in an attempt to improve multi-carrier flight operations. — Lomn 22:40, 18 June 2008 (UTC)

Just speculating here, but wouldn't the starboard-side superstructure let the signal-flag people hide where it's safe and use their right hand for signalling? That's assuming take-off goes forward and landing comes from the stern. Franamax (talk) 23:07, 19 June 2008 (UTC)

Assuming you're talking about the landing signal officer, in the US Navy they've always stood on the port side of the flight deck. --Carnildo (talk) 20:56, 20 June 2008 (UTC)

Juniper Trees

If I cut off the top 10 feet on a 40 foot Juniper tree, will that kill the tree, or will it just stop the growth upward of the main trunk, with the remaining branches with green leaves, etc., continuing to live and grow ? —Preceding unsigned comment added by 66.220.120.183 (talk) 17:09, 18 June 2008 (UTC)

Googling for "topping trees" has nothing nice to say about that practice. --Sean 20:27, 18 June 2008 (UTC)

Catching seagulls

According to the SAS Survival Guide, seagulls can be caught by tying a rock to some food and throwing it up into the air. Apparently they will catch it midair in their mouths and drop to the ground, too heavy to fly, where they can be caught and presumably consumed. My question is a) does this actually work and if possible, b) how heavy of a rock would you need? bibliomaniac15 22:33, 18 June 2008 (UTC)

I've read the same survival guide, and consider it a reliable source, so I expect it works. I don't imagine a particularly large rock is required, but I don't really know. A small (and, importantly, unexpected) change in weight ought to be enough to confuse the gull. You would need to kill it (club it, probably) very quickly once it crashes, since it may be able to take off again once it's prepared for the extra weight. At the very least, it could escape on foot. --Tango (talk) 23:05, 18 June 2008 (UTC)

I think you should just use the heaviest rock you can throw at least as long as it can stay in the air long enough for the seagull to snatch the bait.--Apollonius 1236 (talk) 00:14, 21 June 2008 (UTC)

I'll get slapped for original research, but here goes anyway...

As a kid, before the advent of peta and environmentalism and all that, every now and then we'd go down to the beach (in Seattle), buy an order of Fish & Chips with extra chips, and go across the street to eat it. One order of F&C was a plenty good lunch portion; the extra order of french fries was to break into inch-long pieces and toss into the air, the sole purpose of which was to provoke a Seagull Fight.

So, in answer to part of the question, the seagulls definitely have the flight skills to pick off pieces of airborne food.

That said, I just can't imagine it working by wrapping a piece of cheese around a rock, for example. You'd have better luck tying a length -- 10 feet? -- of string or fishline around the cheese or frenchfry, and hold the rock in your hand; the bird will typically swallow the bait whole. The trick, then, would be to reel in the bird before he disgorges it.

Yeah, that could work... --Danh, 70.59.79.230 (talk) 23:36, 18 June 2008 (UTC)

If you want to be sure of catching your meal, use a fishing hook on the end of the line (or fashion a hook yourself). Anglers sometimes to have to reel bait-snatching gulls in to free them - once the hook goes in, they're completely stuck. They usually panic and entangle themselves in the line too - which would be a plus for a prospective hunter.

You could also have a fellow survivor bury you horizontally in the sand, leaving only your face exposed (which they would then cover with a towel or similar). Sprinkle some bait atop your shallow grave, wait until you feel a gull land in the area of your chest, then grab it from below in true ant lion style. There are loads of videos on YouTube of people doing this - the gulls never, ever seem to expect an attack from beneath. --Kurt Shaped Box (talk) 23:54, 18 June 2008 (UTC)

Hydrogen cars

Sheik Yamani predicted a few things about oil, cost of, etc years ago according to a recent interview. In the light of oil reserves lasting the next 20 to 30 years, he now predicts cars will run on hydrogen. How will that work? Julia Rossi (talk) 23:45, 18 June 2008 (UTC)

You can use hydrogen as fuel in an internal combustion engine. I don't know the details, but the wankel engine used in the RX8 was designed to also run on hydrogen. Obviously this would require some changes, such as to the fuel system, but I believe the engine internals don't need to change for this. One problem ecologically is coming up with ways of getting hydrogen fuel that don't screw up the environment. See also Hydrogen economy. Friday (talk) 23:50, 18 June 2008 (UTC)

Using hydrogen in internal combustion engines is possible. But if you have clean hydrogen, it's much better to use in in fuel cells to create electricity and drive your electric car, with less noise, better torque, fewer moving parts, and, usually, higher efficiency. --Stephan Schulz (talk) 12:22, 19 June 2008 (UTC)

Thanks Friday, there's probably nothing that wouldn't screw up the environment – even if it was plain water. Why wouldn't someone like Yamani suggest hydrogen and not, say canola oil? (which yes, would also probably wreck things). Julia Rossi (talk) 00:04, 19 June 2008 (UTC)

If you pretend that hydrogen is freely available from the hydrogen fairies from gumdrop forest and only look at the cars, hydrogen is a clean fuel. When it burns, it creates water. Oil (regardless of the kind of oil used in combustion engines) is a hydrocarbon. The hydro part of the hydrocarbon is hydrogen - nice and clean. The carbon part is, as is easy to guess, carbon. It creates carbon dioxide, carbon monoxide, and can even mix with pollutants to get a few more creative things going. So, the dream of a clean fuel continually points to hydrogen. Of course, the problem is getting the hydrogen. Those damn hydrogen fairies haven't done their part to make this all work yet. -- kainaw™ 00:10, 19 June 2008 (UTC)

Ironically hydrogen isn't scarce. It's the most abundant element in the universe. It's just rare on Earth (when not bonded in a molecule). You can extract it from water through Electrolosis though. ScienceApe (talk) 02:53, 19 June 2008 (UTC)

Yep. Find a clean industrial-scale source of electricity and you can generate all the hydrogen you need. It's just a problem of finding that power -- in effect, the environmental problem has only been shoved upstream. — Lomn 02:50, 19 June 2008 (UTC)

Nuclear power plants seem to be the solution. ScienceApe (talk) 02:55, 19 June 2008 (UTC)

I concur, and from a global warming perspective, nuclear is ideal. That consensus has not yet emerged, however, from a general environmental perspective. — Lomn 12:57, 19 June 2008 (UTC)

Note however if your hydrocarbon is produced by plants then effectively it all comes the atmosphere, there is no net addition of carbon dioxide provided you don't use non biofuel sources to grow the plants, or process the biofuels. Of course, if you are using petroleum to power your car or make fertilisers then there is... The other problem is that the efficiency can be low since you produce a lot of waste that you don't use, which means you need a lot of land. And there may be a high initial cost of greenhouse gas emission to the atmosphere, if you are clearing existing forests or swamps, although this is only a one time thing. There is also the additional cost of loss or primary forest or swamps and the associated ecological cost. Then there are the potential additional polutants you mentioned and the potential competition with food. But from a purely carbon dioxide POV, you can't really argue hydrogen is 'cleaner' then biofuels provided the conditions I mentioned are met (post land-cleared, no use of petroleum or other 'unclean' sources to produce the biofuels) Nil Einne (talk) 10:38, 19 June 2008 (UTC)

I think he means that since oil reserves will be exhausted, the world will turn to its second-favourite energy source, coal. Hydrogen can be used to store energy from the coal, for use in cars. Thus we can continue polluting the environment unabated for perhaps another 200 years, despite the exhaustion of oil reserves. -- Tim Starling (talk) 06:16, 19 June 2008 (UTC)

I'm not so sure. AFAIK, there are no significant coal reserves in Saudi Arabia. Remember who Yamani is, I suspect his hope/belief is that solar power would be used to produce a big proportion of the hydrogen. Deserts are of course excellent places for solar power... So the Middle Eastern economies including Saudi Arabia will go from being all about oil to being all about hydrogen. This also partially speaks as to why he thinks hydrogen and not biofuels. Growing plants in deserts is never easy. Producing hydrogen is no problem in a desert since you only need water and even sea water is fine. Of course there are various problems to solve including the efficient production of hydrogen and transport of hydrogen (which is going to be more difficult then biofuels). Nil Einne (talk) 10:31, 19 June 2008 (UTC)

Noone linked Hydrogen vehicle so I thought I should. Zain Ebrahim (talk) 10:05, 19 June 2008 (UTC)

I'll predict here that hydrogen will turn out to be a bad idea, at least in the gaseous form. It's such a small molecule that it creeps into everything and corrodes it, you need stainless steel to contain it, the welds have to be perfect, it's not sustainable as an infrastructure. We'll go down that path and then discover how immensely reactive it is. You think breaching a gasoline tank causes an explosion? Just wait until car crashes split open a tank of hydrogen. I'm just sayin'. Franamax (talk) 23:26, 19 June 2008 (UTC)

Hydrogen embrittlement is a problem, but plain corrosion is not that bad. And hydrogen will burn, but is usually well-behaved in doing so. Remember, we have used large amounts of hydrogen in traffic before. It was not perfect, but surprisingly safe. --Stephan Schulz (talk) 23:42, 19 June 2008 (UTC)

Gotta love that blue "before" link, and scrolling down to the "Oh, the humanity" picture - although most of the deaths were from jumping to the ground, and the fire was on the canopy glue, not the hydrogen contents. You're right that embrittlement is the major problem, although as I recall from my refinery days, the cracks and crevices were corrosion initiators. Hydrogen can find the least flaws and exploit them. Ten years distant and no sources to hand, so I'll leave it go. I'll hold back my commentary until a tank of pressurized hydrogen is released into the midst of a vehicle accident. Highly reactive reducing substance meets abundant oxidator, i.e. the atmosphere. Just like the concept of pumping CO2 underground, it all works fine - until it breaks. Just sayin' is all... Franamax (talk) 05:03, 20 June 2008 (UTC)

Is hydrogen embrittlement as much of a problem if liquid hydrogen is used? Intuitively if the H2 is not under such high pressure, it would not penetrate metal so easily. But I don't know if that's true.Fletcher (talk) 13:58, 20 June 2008 (UTC)

I don't think anyone is seriously considering storing compressed gaseous hydrogen in production cars. The weight of the pressure vessel would be prohibitive. See Hydrogen storage for lots of more practical ideas. -- Tim Starling (talk) 14:00, 20 June 2008 (UTC)

June 19

Less moon near summer solstice

Maybe I'm confused, but I've long had the notion that when the moon is full, as it is today, it rises more or less as the sun sets, and it sets more or less as the sun rises. But now that we are near the summer solstice and the days are extra long (up here near 49 degrees north), it occurred to me this would mean the full moon would be up for fewer hours in the summer and more in the winter. That didn't seem right -- shouldn't the full moon be up for about 12 hours regardless? Or if the Earth's tilt matters, wouldn't it mean the moon, like the sun, was up for longer in the summer? But, in checking the sun and moon rise and set times for today and tonight, it appears that today's full moon does rise more or less as the sun sets, and sets more or less as the sun rises (give or take about 30 minutes). This means that today, where I live, the sun is up for about 16 hours and full moon for only slightly more about 6.5 hours. Somewhere my common sense is confused. Where'd I go wrong? Pfly ([[User talk:Pfly|talk]]) 03:37, 19 June 2008 (UTC)

The moon is up less than 12 hours for the same reason the sun is up more. Geometrically, the earth is now in between the two. The axis is tilted towards the sun, meaning a point north of the equator will have to rotate more than 180 degrees through the sunlit area, and less than 180 degrees through the moonlit areas (at the pole, the sun will be visible during the whole 360 degrees, and the moon not at all). --Stephan Schulz (talk) 07:40, 19 June 2008 (UTC)

There's a lot to be said for blacking out a room and shining a torch at a globe (or any other spherical object if a globe isn't available). You can add the moon to the demonstration by just holding a ping pong ball on the opposite side than the torch - the moon is in roughly the same plane as the sun (IIRC, it's about 5 degs off, but that's significantly less than the Earth's axial tilt, so that's what has the major contribution). --Tango (talk) 12:03, 19 June 2008 (UTC)

Oh I think I get it now. When the Earth is tilted toward the sun it is also tilted away from the moon when the moon is full or near full. I just couldn't picture it correctly in my head yesterday. So, this also means, doesn't it, that near new moon crescents are out for more than 12 hours around the summer solstice? I suppose I can look that up easily enough. Thanks for answering! Pfly (talk) 15:11, 19 June 2008 (UTC)

Yes, quite right. --Anonymous, 17:00 UTC, June 19, 2008.

why only rock salt prism is used instead of glass prism for obtaining infrared spectrum ?

Bold text —Preceding unsigned comment added by 124.253.200.194 (talk) 04:21, 19 June 2008 (UTC)

Because salt is transparent in IR and glas is not!--Stone (talk) 06:52, 19 June 2008 (UTC)

It's generally not true that glass is not transparent in IR; but its dispersion is low. Icek (talk) 21:14, 19 June 2008 (UTC)

Why do dogs wag their tails?

How does it happen that dogs wag their tails, while their ancestors the wolves do not? What might be behind this selective advantage? --Halcatalyst (talk) 14:28, 19 June 2008 (UTC)

I'm just guessing, but do wolf cubs do it? It's not unusual for domesticated animals to show juvenile behaviour in adulthood, see Pedomorphosis. --Tango (talk) 14:36, 19 June 2008 (UTC)

This page] suggests tail wagging is merely to get rid of excess energy. Most scientist agree that dogs wag their tails to express emotion. As a matter of fact, wolves do wag their tails, though not as often. A wolf may wag it's tail submissively when approaching the Alpha male (or female). Also, sometimes wolf cubs wag their tails when they realise dinner is about to be served. = )

I always thought it was to express emotion. A dog wagging tail is usually friendly or excited, probably running after a ball or something, but an aggressive dog might hold its tail high, while a submissive or scared dog might hold its tail low. This is also true for cats, as a happy cat will hold it's tail high in the air, while a submissive cat will lower it. Also in cats a wagging tail is a sign of conflict, like when it can't decide if it wants to go in or out of the house, or if it twitches it from side to side at the end it means it angry. Could it also be for balance? When a dog is running and turns quickly, the front part of its body goes in the direction it wants to go, but it's back continues in the original direction. So the tail might act as a counterweight. Jessica - N10248 (talk) 18:21, 20 June 2008 (UTC)

I heard from the Scientific American magazine that dogs wag their tails when they are nervous.--Apollonius 1236 (talk) 18:29, 20 June 2008 (UTC)

• Just hazarding a guess, could the behavior be due to the fact that the animal was acclimatizing to close interaction with a new species, man, as well as with the now more complicated relationships with others of its species? --Halcatalyst (talk) 20:51, 21 June 2008 (UTC)

Soybean based Biodiesel processing

I have read that using excess catalyst (alkali) in the transesterification process will cause the bonds of methyl esters to break, thus, leaving higher FFA's and free glycerin. Are you aware of any studies, research, white papers, etc. regarding this matter.14:41, 19 June 2008 (UTC)Knowwhat4 (talk)

The reaction is

(soybeancarboxylic-acid)₃glyceride + 3 methanol >>> 3 soybeancarboxylic-acid methyl ester + gylcerin

The reaction you are thinking of is (soybeancarboxylic-acid)₃glyceride + 3 water >>> 3 soybeancarboxylic-acid (FFA) + gylcerin

trans-esterification means swapping the R-OH groups (alcohols) see - Transesterification

To obtain FFA (free fatty acid) you need to do hydrolysis

Adding more catalyst may speed up the reaction..87.102.86.73 (talk) 17:04, 19 June 2008 (UTC)

Hydroxide is the catalyst for the transesterification, but it's also the reactant for the saponification (hydrolysis). So you need "enough" catalyst to make the reaction you want happen efficiently, but not so much that the alternative reaction happens substantially. DMacks (talk) 18:39, 19 June 2008 (UTC)

Just realised I didn't properly answer - the answer is 'YES' adding alkali will cause production of the fatty acid salt - which can be converted to the fatty acid by acidification - it's a slightly different reaction, and does require addition of the alkali in non-catalytic amounts.

eg (soybeancarboxylic-acid)₃glyceride + 3 sodium hydroxide >>> 3 sodium soybeancarboxylate + gylcerin

Link to saponification or just web search for the same term.87.102.86.73 (talk) 21:36, 19 June 2008 (UTC)

Hemimetabolism vs Exopterygota

What are the diffrence between the two? —Preceding unsigned comment added by 192.115.235.2 (talk) 17:00, 19 June 2008 (UTC)

By reading the articles, I can see that one is a group of animals and one is a mechanism by which certain animals mature. Again, by reading the articles, the group appears to be a group of animals which use that mechanism (at least some of them, others may use a similar but different mechanism, the articles weren't entirely clear about that). --Tango (talk) 17:40, 19 June 2008 (UTC)

Thanks, The question is if it's the same group? I don't think other insects use the same mechanism since if they do they would be added to the same group. So does it mean the insect group and the mechanism are the same? —Preceding unsigned comment added by 192.115.235.2 (talk) 18:03, 19 June 2008 (UTC)

Hemimetabolism discusses insects both amphibious and terrestrial. The Odonata, for instance, are amphibious. The taxon that you single out, Exopterygota, are mainly terrestrial, but the Exopterygotan stoneflies are amphibious. HTH. --11:01, 20 June 2008 (UTC)

Gene promoter prediction

From this online gene promoter prediction tool, I get the following possible promoter sequences for GREM1 gene sequence (1000 bp before transcription start site and 1000 bp after). The bold letter is what it claims might be the transcription start site. Is it not possible that they are both promoters with only one (the later) containing the transcription start site?

Promoter predictions for 1 eukaryotic sequence with score cutoff 0.80 (transcription start shown in larger font):

Promoter predictions for seq0 :

 Start   End    Score                Promoter Sequence
 412   462    0.83    AGCCCGCCAGGTTAACGGGGGCGCCGGGGTCAGCGCCCTCGAAGTTGGGG
 961  1011    0.99    TGCCGCCGGCATTTAAACGGGAGACGGCGCGATGCCTGGCACTCGGTGCG

--145.29.22.90 (talk) 17:10, 19 June 2008 (UTC)

Reproduced embossed seals in diploma plaques

There are services that reproduce diplomas and certificates as metal plaques that can be hung on walls. Embossed seals in the original documents are somehow reproduced like stamped marks. Are the reproduced embossed seals manually recreated or are they mechanically converted to printed marks? If the latter, how is it done? --71.162.249.253 (talk) 17:58, 19 June 2008 (UTC)

Not sure, but the xv Unix graphics program has an option to convert a pic into what looks like an embossed image. StuRat (talk) 22:34, 19 June 2008 (UTC)

The program feature you mentioned achieves something different from what I was talking about. If you search for "diploma plaque" using your favorite image search engine, you'll see examples of the kind of plaques I was referring to. In those plaques, the embossed seals of the institutions issuing the original document are replaced by recreated (re-drawn?) facsimiles. When you scan a document that has an embossed mark, the depth of the impression does not translate very well into lines, although if the light source is directional, the edges in the embossed marks can be discerned based on the shadows. It doesn't look like a straightforward process to go from a scanned embossed mark with shadows to the final recreated rendering. --71.162.249.253 (talk) 09:08, 20 June 2008 (UTC)

I note [11] which simply asks for a copy not an original. My guess is that provided they can see the embossing, it's easy to recreate. As far as I'm aware, the embossing is usually simple with one thickness. So provided you can see the mark left by the embossing, you just have to create a depth for the mark and it looks fine. I would guess they also have many common documents & marks already available in their systems Nil Einne (talk) 11:25, 20 June 2008 (UTC)

sentient dinosaurs

What is the liklihood that dinosaurs (and/or other such critters) would have evolved to the point of sentience if they had not gone extinct? Would there be a parallel evolution with mammals or is more likey that one species would have out-competed the other? If we remove the mammal factor, would they have developed sentience? —Preceding unsigned comment added by 69.77.185.91 (talk) 18:36, 19 June 2008 (UTC)

Dinosaurs were on top of the food chain for 160 million years, are still wildly plentiful today in the form of birds, and have never evolved enough intelligence to leave any manhole covers or other long-lasting artifacts around for us to find, so presumably they did fine with their "walnut-sized" brains. Speaking as the owner and amused observer of a flock of small dinosaurs, they've got a long way to go. --Sean 18:58, 19 June 2008 (UTC)

Some scientists speculate that the most intelligent dinosaurs (such as velociraptor and troodon) would have evolved into a bipedal "human like" dinosaur known as the dinosauroid. An artist and scientist Dale Russell has actually produced a sculpture of the hypothetical dinosouroid you can learn more about the dinosauroid and see the dinosauroid sculpture at this entry in the internet encyclopedia of science more information about dinosauroid.--Apollonius 1236 (talk) 18:45, 20 June 2008 (UTC)

Had they not gone extinct could they develop sentience? Well some dinosaurs did evolve into modern day birds which are alive and well today, and they did not develop sentience. Those were theropod dinosaurs. The others went extinct like Sauropods. There seems to be a positive correlation between intelligence and animals capable of eating meat. The most intelligent animals, Humans and other primates, pigs, dolphins, octopi, etc all can eat meat. The proteins in meat apparently stimulated brain growth. So unless Sauropods and Cerapods could have evolved into meat eating animals, we can probably rule them out. Theropod dinosaurs did eat meat, and they also evolved into birds. Life span is also a factor in intelligence. An animal must live long enough to learn and teach things. That's why wisdom is associated with age. Octopi are smart, but they don't live very long. Just a few weeks maybe. If they could live to 100 years, maybe they could have evolved sentience. Giving time to learn and teach is critical. Feral children are a good example of humans that are not taught modern education, and they are almost indistinguishable from wild animals. So I guess the answer is probably no, because theropods would have been the most likely to develop sentience since they eat meat, but they evolved into birds which are not sentient. ScienceApe (talk) 19:25, 19 June 2008 (UTC)

A little pedantic, I know, but the preferred plural is "octopuses" (see Octopus#Terminology). ;) --Tango (talk) 21:12, 19 June 2008 (UTC)

Octopuses live for much longer than a few weeks. Depending on species, they may live for between 6 months and 5 years. I am also fascinated with your assertion that if octopuses "could live to 100 years, maybe they could have evolved sentience." Why would you think that? Even assuming an octopus would "learn" something in 100 years of swimming about dodging calamari fisherman that it didn't "learn" after 5 years, how would that promote the evolution of sentience? Moreover by almost all definitions of the word, Feral children are just a sentient as any educated child, since one doesn't get taught to be sentient. I think you may also be confusing Sentience with Sapience. Rockpocket 02:31, 20 June 2008 (UTC)

Most species don't live very long at all. A few months is still a pathetic lifespan. So is 5 years at most. I think lifespan is very important to learning and teaching. We spend a huge amount of our lives merely learning. At best, you'll be 21 or 22 before you are fully educated with grade school, highschool, and 4 years of college, and some continue their education past that. We associate wisdom with age because with age, you are given lots of time to learn new and useful things. There are a lot of things that we can no longer do when we get old, but learning is not one of them. You can ALWAYS learn something new. Learning and teaching is essential to technological growth.

Now if we have an animal that shows great problem solving intelligence, and has the potential to learn, then this animal has great potential to be technologically advanced. However, if it only lives to 5 years of age at the most, this would inhibit technological growth, because the animals will not have the time to learn and teach knowledge.

Sure, I might be using the word "sentience" wrong. I'm mostly just talking about the potential for octopi to be as technologically advanced as.... well us. I could be wrong of course. This is all just conjecture and speculation, but I would love to test my hypothesis. Now if we could identify the most intelligent octopus species, and genetically engineer them to live to lifespans of over 100 years, I would love to see what they are capable of. ScienceApe (talk) 18:29, 20 June 2008 (UTC)

Who says that all birds aren't sentient? As our sentience page points out, the definition of sentience is rather contested. Under some definitions birds would be sentient, even if they don't leave behind "manhole covers" (lest we forget, humans left behind zero vestiges of civilization as well for most of our history). As for whether they would—I don't think it's unlikely to assume that many dinosaurs did have a lot more cognitive power than others, and some probably could be "self-aware" in a rudimentary sense. If you mean, "as smart as humans," well, probably not, but then again we don't know all that much about the evolutionary history of human intelligence, either, and we do appear rather exceptional. (You could also ask whether the dinosaurs would ever develop a sense of smell as good as a dog or a wolf, or vocalizations on par with a Grey parrot, or sight on par with a hawk—that is, pick another trait that a highly evolved species is extremely exceptional in regards to. Note that when you make it something less tangible and wrapped up with our essential "humanity", it becomes a lot easier to conceive of it happening. Note the special accord we give our own traits, and the special credit we give ourselves for having developed them!) --98.217.8.46 (talk) 21:07, 19 June 2008 (UTC)

In support of your last comment - we frequently point out how intelligent humans are for being the only animal to do XYZ, only to discover lots of other animals doing it (toolmaking, for example). --Tango (talk) 21:12, 19 June 2008 (UTC)

People tend to define "sentience" as the same thing as anthropomorphism. E.g., imagining dinosaurs would start walking erect and building minivans. The idea that any other animal would evolve toward becoming human-like is rooted in the outmoded belief that humans are the pinnacle of evolution, and evolution naturally progresses toward a human-like state. This is just as silly as a self-aware bird thinking that, given a few million years more of evolution, humans may finally achieve birdience, grow feathered wings, and start building complex mud nests on the sides of rock walls. Anyway, it's likely that relative intelligence in dinosaurs would have increased over time...because it has. The brains of many modern birds are equal to or larger than the most intelligent non-avian dinosaurs. Whether or not this means they are s mainly marter is probably unknowable, but it's likely that things like the crow and the gray parrot are the smartest dinosaurs ever. Dinoguy2 (talk) 23:34, 19 June 2008 (UTC)

I live in a region that is very well populated with crows, specifically American Crows and Northwestern Crows, and I would say they are sentient. Of course there is no precise definition of "sentient", nor an easy way to measure it. And my statement is just opinion and "original research" -- although the crow page has some info on their intelligence and external links to much more. But really, spend some time watching these "pests" and you start to realize their behaviors are amazingly complex and constantly changing to adapt to circumstances. They don't only say "caw caw!", but have a surprisingly rich and subtle .. vocabulary. They are amazingly social, at least around here. They know the identity of other crows -- kin, kith, alien, etc -- so it seems odd to me that they wouldn't have some kind of sense of self. And unlike many other birds, they are keenly aware of their surroundings -- of you, if you happen to be nearby. I'm skeptical that they have symbolic thought like we do, but we're talking sentience here. There's your sentience dinosaur, if you ask me. And crows aren't even the smartest of birds, if I'm not mistaken. Pfly (talk) 06:26, 20 June 2008 (UTC)

Carl Sagan tackled this very idea in his book The Dragons of Eden. — The Hand That Feeds You:^Bite 13:09, 21 June 2008 (UTC)

Bird population control

Listening to the radio the other day, I heard a story about trying to control the cormorant population around Lake Champlain. It seems that biologists are coating the eggs with vegetable oil so that they won't hatch. I'm not really sure how that works but whatever. What occurred to me first was, why don't they just take the eggs away or something easier than coating them with oil? Dismas|^(talk) 18:40, 19 June 2008 (UTC)

I guess it would either upset the parents in an undesirable way, or the parents would just lay a new egg to replace it. --Tango (talk) 18:55, 19 June 2008 (UTC)

This has been done for years on the Sister Islands at the north end of the lake at the northwest corner of Grand Isle. It's mostly done because the sport fishermen on the lake object to the cormorants competing with them for the game fish. And the reason you don't take the eggs away is that birds will lay more eggs to replace missing eggs, but will waste time (several weeks) brooding infertile eggs.

Atlant (talk) 19:18, 19 June 2008 (UTC)

Egg shells are porous, and clogging the pores with oil kills the embryo by depriving it of oxygen. --Sean 19:01, 19 June 2008 (UTC)

I wasn't aware that they'd lay another one if the first disappeared. Thanks for the answers! Dismas|^(talk) 19:06, 19 June 2008 (UTC)

measuring airflow

I have installed one of those wind-turbine roof vents (aka "whirly-bird"). Fans used in "whole house fans" would obviously move much more air but I am curious as to how one would go about measuring the flow of air as it leaves one's attic. OK. Let's be honest: I am really wondering if there is enough airflow via the whirlybird vent to run venting from the whirlybird through the ceiling to move the hotter indoor air (I am thinking of a "passive" approach to the whole house fan idea). —Preceding unsigned comment added by 69.77.185.91 (talk) 18:44, 19 June 2008 (UTC)

An airflow meter typically uses what looks like a computer fan but is, in fact, a free-spinning impeller with some sort of tachometer attached to it. You can actually do a fairly good simulation with a real computer fan and a stroboscope or by modifying the fan to output tach pulses but not run the brushless DC electric motor. Calibration is pretty arbitrary, though. I used just such a jury rig when I was considering abandoning a return air duct in my house; there, I was concerned with the air flow ratio between four different return air registers.

Another style of airflow meter uses a self-heating thermistor, but I've only seen these in fixed installations for go/no go testing of airflow. The fuel injection system in your car may use a similar arrangement as the mass flow sensor for incoming air.

Atlant (talk) 19:05, 19 June 2008 (UTC)

Keep in mind that the airflow will dramatically change when you attach a duct to the whirlybird, now you have pressure drop through the duct system. If you have enough airflow to spin the whirly, maybe you should be looking at wide-open windows with a deflector, like a casement window. You will get far more air volume that way. Franamax (talk) 23:37, 19 June 2008 (UTC)

Getting Kicked in the Testicles and its effects on the digestive system

What if somebody kicked me in the testicles and how would it affect my digestive system? Ericthebrainiac (talk) 19:23, 19 June 2008 (UTC)

One is not related to the other. However, I recommend against original research. — Lomn 19:34, 19 June 2008 (UTC)

He's probably referring to the nauseous feeling associated with being kicked in the testicles. ScienceApe (talk) 19:37, 19 June 2008 (UTC)

Being kicked in the testicles does not affect your digestive system. As for the nauseous feeling you may feel, that's one of the body's many ways of dealing with pain. It's very common to feel sick during extreme pain, such as when kicked in the testicles. Regards, CycloneNimrod ^talk?_contribs? 20:24, 19 June 2008 (UTC)

The foot delivered an unending holocaust of pain as it rocketed into Zamboni’s crotch. -- Toytoy (talk) 02:47, 20 June 2008 (UTC)

Not true. The nerve endings in the testicles are connected to your innards. I don't remember what organ exactly. Anyway, it can have a negative effect - feeling pain somewhere in your belly. I felt A LOT of pain somewhere in my belly when I got hit in the testicles. My doctor recomended strengthening abdominal muscles and regularizing eating habits to me. Ask your doctor what he thinks you should do. I still get a weird feeling in the belly sometimes.

When you're kicked in the testicles, you feel pain in the belly, but that's a result of your brain misinterpreting the source of the pain: the digestive system isn't actually involved. The innervation of the testicles is by T9/T10-L1/L2. The innervation of the abdominal viscera (small intestine, colon, rectum) is also T9-L2. Your brain perceives the sudden increase in nerve impulses from the kicked testicles and misattributes it to the digestive tract. (There's a similar explanation for why gallbladder pain is often felt in the right shoulder). - Nunh-huh 08:27, 22 June 2008 (UTC)

evolution/natural selection and complexity

I realize that evolution isn't a process that will necessarily produce 'better' or more intelligent organisms over time, but is it true that evolution always tends to produce increasingly complex organisms over time? Are there counter-examples? ike9898 (talk) 21:11, 19 June 2008 (UTC)

When life first evolved, it started with very simple organisms, and more complex ones occurred later, but the simple ones are still around, and I don't think recent (as in, the last 100 million years, or so) evolution has made organisms any more complicated. I would say that evolution doesn't favour simple or complex organisms, and the percieved change from one to the other is just because life started out as very simple. --Tango (talk) 21:17, 19 June 2008 (UTC)

Well, do organisms ever become less complex? ike9898 (talk) 21:44, 19 June 2008 (UTC)

Yes. Viruses are one example. Another might be flightless birds, which have lost the (complex) ability to fly. StuRat (talk) 22:21, 19 June 2008 (UTC)

I have a book within reach by Professor John Tyler Bonner. On the back-flap it mentions another of his books, The Evolution Of Complexity By Means Of Natural Selection. So I'd have a look at that. Parasites are another example of the evolution of less complexity. The ancestors of wales used to have legs and walk about on land, they cannot do that any more. (I wonder if being less-intelligent-than-a-human is beneficial to some animals, so they have evolved to never become more intelligent?) 80.0.101.122 (talk) 23:26, 19 June 2008 (UTC)

Yes. In humans, it can take up to 20% of the daily calories to run the brain due to it's size. Our brains developed in such a way that they were beneficial (having bigger brains allowed us to get more food). However, in some animals, a bigger brain just wouldn't really be feasible. Sure, if the brain got big enough, I guess it could help any animal; but the brain has to support the animal through each successive step. Ζρς ι'β' ^¡hábleme! 00:52, 20 June 2008 (UTC)

There is another reason to limit intelligence. Intelligence, and complexity in general, makes a system more likely to fail. In the case of intelligence, look at the portion of people who have mental disorders. I'd suspect that the portion is much lower in organisms with simpler brains, as a simpler system has fewer ways it can fail. So, unless the organism can benefit from intelligence in excess of this risk and the energy cost, it's better to have a lower intelligence. StuRat (talk) 01:11, 20 June 2008 (UTC)

Let's face it: we as a species are not going to survive for hundreds of millions of years like the dinosaurs did. Sooner or later someone's going to set off a doomsday device and that will be it. It's great that we didn't do it in the first 60 years that we've been able to, but we've still got a hundred million years to go. Basically our *only* chance to survive is to become less intelligent. Vonnegut's wonderful Galapagos lays out an amusing way for it to happen, a happy alternative to our fate shown in Cat's Cradle. --Sean 03:53, 20 June 2008 (UTC)

I can't think of a single example of how "intelligent" genes in humans could be selected against. Zain Ebrahim (talk) 11:28, 20 June 2008 (UTC)

It's more likely to happen through culture than genetics - just stop educating people, and they'll be less intelligent. --Tango (talk) 12:04, 20 June 2008 (UTC)

Good point. Zain Ebrahim (talk) 12:19, 20 June 2008 (UTC)

If high intelligence generally speaking makes a species powerful enough to eventually destroy its own environment, then high intelligence will be selected against. --Sean 13:33, 20 June 2008 (UTC)

Or even more mundanely, all being selected against means having less a chance to reproduce. In our current society, high intelligence is often selected against in that sense—the more education one has, the less children one has, typically. --98.217.8.46 (talk) 13:59, 20 June 2008 (UTC)

That won't work because harming the environment hurts everyone's chances of reproduction equally (actually it's more likely to affect the poor), not only the most intelligent. However, stupid people, especially men, who have random sex with no birth control, are likely to have more survivng offspring than those who are smart and responsible. StuRat (talk) 13:59, 20 June 2008 (UTC)

Why do you say "mundanely"? The positive correlation between level of education and intelligence coupled with the typically fewer children that educated people have seems like a good source of anti-selection of intelligence. I suppose it doesn't make much of an impact because of other factors (such as disease and poverty) which select against the unintelligent genes. Zain Ebrahim (talk) 14:42, 20 June 2008 (UTC)

Why assume that? The situation in which the least educated have the most surviving children, and education is pretty available to smart people no matter who their parents were, has only been around in the countries where it exists for a few generations. Why assume it won't have much of an impact? 79.66.20.219 (talk) 15:23, 20 June 2008 (UTC)

Wowow. So many issues here! Passing the "(some) birds lost flight" and "whales lost walk" making them less complex which is just nonsense in terms of evolution. Totobagins, any doomsday caused by an intelligent species and that would wipe out the said species cannot be included in a pattern of evolution. Firstly, because in our case, it is a cultural creation (no one ever developed into a doomsday device but we made it with our dexterous little fingers, thus an intelligent species might be culturally inclined never to develop such weapons - I said might but I agree that any intelligent species would tend to develop increasingly destructive devices). Secondly, because if there was such a device that could wipe out a whole species with no further offspring, then it plays no role in their evolution since it simply stops it. The only way you could argue your point would be if you could have a look, say, at all the intelligent species of a galaxy and ascertain that every time they reach a certain threshold of 'intelligence' they destroy themselves (and even then one counter-example would bring it all down). It could also be argued that in our current state of mind no actual big nuclear war would wipe out the human species. One would really have to want to kill everybody to succeed (some gruesome scenario I can think of would involve some religious doomsday/redemption/salvation type scenario where the button pusher would positively think that human salvation would be achieved through the death of humanity ... hum). So if there are survivors it could be argued that they'll just carry on (somehow also be 'fitter') and who knows, one day learn the lesson. One good counter example would be Ridley Walker where a big-badaboom wipes out culture and the back-to-stone-age-humanity's only obsession is to recreate the conditions of the emergence of their culture a.k.a. The Bomb, in an inescapable cycle of self destruction. But then this is just a - good - novel.

An other idea I would have to take issue with is that: In our current society, high intelligence is often selected against in that sense—the more education one has, the less children one has, typically. Less children is correlated with wealth and education. Education has some links to genetic potential of intelligence but is in no way directly correlated with it. You can take a poor kid from a big family and he will have the same potential for intelligence as a rich kid from a small family. Thats because we're all Homo sapiens (woohoo), and as far as I'm aware, you cannot significantly link the big variations of genetic potentials for intelligence inside the species to any (racial, social, etc) group of humans (and I'd love to be proved wrong). So I don't see how high wealth and level of education could have a positive influence on genetic evolution of intelligence potential. ACTUALLY, I think I would be ready to argue the opposite. First by saying (again) that someones culture doesn't make him and his offspring in any way more genetically intelligent. Then by saying that if a poor family who lives in harsh conditions has a lot of children and a lot of them die, that's a pretty good evolution stress element that would push towards better cognitive adaptation and capabilities. In short, whether a rich, educated and thus protected lineage (i.e. look at European nobility) is shielded from environmental pressure and thus can drift all it can, the genetic tree of a poor family will be pressured towards better brain fitness. This will give some chance to poor individuals to grow successful and shield their family in turn from outside pressure, etc, in a cycle that would put the pressured poor humans as the positive evolutionary reserve of the species. Ok this is really total speculation since it assumes some sort of stability of a the poor-rich system that could be analyzed over an evolutionary significant portion of time. Still I wanted to debunk some of the ideas that have been put forward in this thread because they just seemed absurd. The biggest one being a direct link between someone's education and the genetic intelligence of his offspring.

Like Sturat said, viruses are a great example of an organism that lost its ability to reproduce by itself and became dependent on a host to survive. How this is the opposite of a 'complexification' process I'm no quite sure. The way I see it, if an organism, over many generations, somehow manages to give more autonomy to its cells so that one day they would turn back to being a colony of cells as opposed to one organism, that would be an example of 'decomplexification'. I guess we haven't yet defined what a process that makes an organism more complex would be, even less what its opposite could be. John-jack 200.127.59.151 (talk) 16:12, 20 June 2008 (UTC)

(Remove indent) 98 made a theoretical point which I still think is valid - and I know that this would be impossible to test empirically because there are many many other factors which select each way. Assume the following:

• Genes control intelligence to an extent. You took exception to this above on the basis that we're all homo sapiens and therefore any differences in intelligence are attributable to the non-genetic components of our phenotype. I disagree. That a small part of the difference is due to genetic differences is unfalsifiable, AFAIK.
• Differences in intelligence can explain some of the differences in level of education.
• Differences in level of education can explain some of the differences in number of offspring.

None of these are unreasonable IMHO. So there's a direct link between "intelligent genes" and reproduction.

I don't think anyone is suggesting that certain racial or social groups inherently have more "intelligent genes" simply because there are many other factors which select for and against intelligence/education/wealth/etc - this is just one of those factors and its effect would be impossible to gauge in practice. But none of this invalidates the theoretical point. Zain Ebrahim (talk) 20:54, 20 June 2008 (UTC)

Does the nature need the primitive organisms to exist?

For example, any bacteriums? Or, does the nature need only developed creatures? For example, the animals? Must be all bacteriums in the length of time any developed creatures? Have the bacteriums in nature for them any works to do? Can any developed creatures work the same job? Are the bacteriums an evidence of evolutions, because these are simple creatures? Are their job simple for nature? For example. Who can clean the nature (waters etc), if there are not any bacteriums? Have a boing jet only complex components, have not it any simple screws? Are any screws for a boing jet trivial?--78.177.173.0 (talk) 01:24, 20 June 2008 (UTC)

That's a lot of questions rolled into one, but I think the main thing you're driving at is covered in the description of an ecosystem. Ecosystems are complicated things, because organisms evolve to fill niches, and as they evolve they create more niches. Certainly modern ecosystems need microorganisms for various purposes, and if you suddenly killed all the bacteria you wouldn't find life of other forms surviving for much longer, either - even humans need certain microorganisms in our digestive systems. However, I suspect that it would be possible to genetically engineer an ecosystem composed only of macroorganisms, but it would probably be terribly inefficient given the myriad jobs microorganism do efficiently.

As to whether the existence of bacteria is evidence for evolution, not really - a creationist or intelligent designist could equally argue that the creator understood the need for microorganisms in an ecosystem and designed accordingly. Confusing Manifestation(Say hi!) 02:48, 20 June 2008 (UTC)

To stress the point: Humans are mostly movable containers for colonies of microorganism, and are entirely dependent on these for survival. We are reasonably efficient as containers, too - about 90% of the cells inside a human are microorganisms. Without symbiotic bacteria, you will get very little nutrition from food, for example. See Human flora. --Stephan Schulz (talk) 12:36, 20 June 2008 (UTC)

Don't forget the bacteria which are vital to the nitrogen cycle, without them we would be pretty screwed too. --Mark PEA (talk) 16:39, 20 June 2008 (UTC)

Rats and mice kept free from microorganisms live healthy lives, but they have to be kept in quarantine, so a typical human couldn't keep himself bateria-free in the usual environment. A human would not get too little nutrition from food, as the human digestive enzymes suffice, and most bacteria live in the colon anyway, were hardly any nutrients are taken up by the body (butyric acid is partly used by the cells in the lining of the colon IIRC). Regarding the vitamins, AFAIK it's mainly vitamin K that is relevant in this context, but vitamin K is also contained in certain common foods. Changing the proportions of species in the human gut by e.g. antibiotics may lead to problems, but judging from mouse and rat experiments, a human could live healthy without any bacteria inside him. Icek (talk) 21:48, 20 June 2008 (UTC)

Why say the evolutionists that the microorganisms are any primitiv creatures, if these have a place in nature, in an ecosystem? For example: We have a spoon, a cutlery that these are simple instruments. We need these to eat, not a computer. Must be all things too complex, so that man says these are perfect? Are the microorganisms perfect or primitiv?--78.177.173.0 (talk) 14:19, 21 June 2008 (UTC)

Nothing is perfect. Some microorganisms could be described as 'primitive' if they appear little changed over millions of years, but they have not changed much because they are well suited for their niche and their niche has not changed. I don't tend to encounter the word 'primitive' used by biologists, 'simple' is more common in my experience to describe an organism which is not complicated. So, your question doesn't make a lot of sense. 79.66.20.219 (talk) 20:40, 21 June 2008 (UTC)

How best to refute a common myth about central heating?

I often see on forums people saying that it is cheaper to heat a house all day rather than heat it from cold just before you return from work. Of course, this is incorrect and the later option is the correct one.

An example of typical resoning behind the heat-all-day myth is this excerpt: ""Run it constantly....Think about it, it take much more energy to heat a kettle of cold watter, and alot less if its already warm warm, topping it up....Same goes for heating, heating a cold house takes hours, maintaining it at a constat level takes a lot less energy. " From http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html

What is the best and most succinct way to refute this mistaken notion? I mean verbally rather than inviting the person to observe an experiment etc, and bearing in mind that the person is unlikely to understand technicalities like the Laws Of Thermodynamics. Thanks. 80.0.101.122 (talk) 23:36, 19 June 2008 (UTC)

The way I always thought of it is: turn the heat down, and wait 'til the heater comes on again - all that heat has to be replaced when you come home, so you haven't saved anything yet. But once the heat comes on again, now you're saving money, because you're keeping the house "less warm", so you're spending less on heating up the entire planet, i.e. less heat is escaping from your house. Same works for air conditioning, when you turn the temp up, you don't save anything until the next time it comes on, then you're getting a benefit. Franamax (talk) 23:44, 19 June 2008 (UTC)

Also, you can explain thermodynamics in terms of water - the higher the heat the faster it flows downward to the cold part. That way you don't have to describe how Euler's number works. Franamax (talk) 23:47, 19 June 2008 (UTC)

Would anyone like to try writing a brief refutation of the myth, that could be used in forums etc please? 80.0.101.122 (talk) 23:54, 19 June 2008 (UTC)

How are you so sure that "the later option is the correct one" if you have no proof of your own. The cost to run the appliance depends on many factors such as outdoor temperature, current indoor temperature, expected indoor temperature, humidity, the material the building is made of, the BTUs of the appliance, how long it runs for, how long it is turned off, etc. I would imagine under certain circumstances, it would be more cost effective to turn the heat off, especially if it is for an extended period of time. Keep in mind though, that it does require more energy to heat something than it does to maintain a temperature for a constant time and external temperature. --Russoc4 (talk) 23:56, 19 June 2008 (UTC)

Kid, I cannot believe that you are a science major. For whatever length of off time, turning off the heater or air conditioner surely saves energy (or at least to cost exactly the same amount of energy if the off time is only seconds).

Let's say that you have a glass of water and you want to keep it between 67-73 F in a constant 30 F environment. The heater turns itself on at 67 F and turns itself off at 73 F. It only has one most-efficient burner setting. It produces y units of heat per second.

Let's say the 40 F heat gradient transfers x unit of energy to the cold air per second. x is the average energy output required by the heater. x must be small than y. Let's say y = 2x, your heater must be on 50% of the time.

Now if we leave the water to cool down naturally to 40 F by turning off the heater, the heat transfer shall be less than x during the cool down period. To bring it back to the 67-73 range, your heater shall do less work than keeping it within the range all the time.

Unless you have a heater with an afterburner-like part that heats up the room in no time (very inefficient to operate), a fixed-output burner shall always be no less efficient to operate if you turn it down manually from time to time.

A weight lifter may hold a 200 lbs thing in the air for an hour. It shall cost the poor guy much less energy if he puts it down for a while and then picks it up for a while.

If your NUCLEAR-POWERED heater could heat up your frozen house within one millisecond; then it may be very inefficient to let you house cool down because the extremely high output may be highly inefficient.

Otherwise, jut turn it off. Got it? Your factors are all BS. -- Toytoy (talk) 02:02, 20 June 2008 (UTC)

With all due respect, bull-roar. Equation please? Franamax (talk) 00:06, 20 June 2008 (UTC)

This very issue caused a friend of mine and his housemate to go their separate ways. A good argument is that thermal loss through exterior walls and windows is proportional to the temperature difference, so the less the difference, for the longest time, the less thermal loss, which means the less that has to be made up by the furnace or A/C. If they still don't see it, use the extreme argument: "What if you only heated the house once a year, would you still say it would cost less to keep it heated year-round instead ?". A common counter-argument is that "like cars, furnaces operate best at a constant rate rather than changing speeds all the time". This isn't the case because furnaces only have one "speed", unlike gasoline engines. StuRat (talk) 01:05, 20 June 2008 (UTC)

All I can say is: "THEY ARE NUTS!"

• http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html

It works by monitoring how the room cools down at night, and from this can calulate the outside temperature (including wind chill factors).

Wind chill factor has very little to do with your house. Strong wind would surely cold down your house much faster, but wind chill factor is the temperature perceived by your skin which is subjected to water vaporization and many other living thing-only factors. How easily they are fooled.

I cannot work out a nice and easy way to explain the obvious. Maybe they should experiment with it and see their own heating bills. Many brain-dead and uneducated people in the U.S. leave their air conditioners on all the time. Maybe they should also leave their car engines running 24/7/365 because IT SAVES ENERGY NOT TO TURN THEM OFF. -- Toytoy (talk) 01:17, 20 June 2008 (UTC)

On the other hand, many people choose to install a cheapo brain-dead crappy controller that turns on and off all the time. Say they set the temperature at 70 F for both heating and cooling. It would save them much money if they put on some clothing during winter and set it to 60 F and set it to 80 F during summer.

One problem with many household central controllers is they only have one sensor in the living room. A more efficient design shall close the living room vent at night and only heat up the bed rooms. Saving a few lousy bucks up front seems to be the natural instinct to some less sophisticated souls. -- Toytoy (talk) 01:28, 20 June 2008 (UTC)

"

Toytoy. I said "it does require more energy to heat something than it does to maintain a temperature for a constant time and external temperature." Did you overlook the fact that in both circumstances, heat is also being lost. Assume heat is lost at the same rate, through windows or walls or whatever, if the temperature is to be constant, the heat going in will have to be equal to the heat going out. If, however, you are trying to raise the temperature, you will need to put in as much heat as is being lost, and then some to actually raise the temperature. (Do I smell a differential equation here?) And please do not disrespect me, or any other Wikipedians for that matter. Disagreeing with our answers is one thing, but don't bash us because you don't think we know what we are talking about. --Russoc4 (talk) 03:04, 20 June 2008 (UTC)

Actually Russ, it was me who said you were full of crap, so give Toytoy a break. Keep in mind here that we're talking about heating a house. You've basically said that it's better to keep the house warm all the time, rather than let it cool down. I asked you for some equations to support that, anything coming up soon? You mention a differential equation above, yet you're neglecting the basic fact of exponents - a house at 20 degrees above its' surrounding temperature radiates much less than half the heat of a house 40 degrees above. I could of course be wrong - please put up the math to prove me so, I'm always willing to learn! Franamax (talk) 04:37, 20 June 2008 (UTC)

Yes, as I said previously, the heat loss is proportional to the difference in the temps, so a cooler house will lose less heat. Russoc4, more energy will be used per minute while heating up the cold house, yes, but that's for a much shorter period of time than if the heat is run all day long. In the end, it works out to require more total energy to keep it warm all day. Franamax, while I agree with your technical analysis, I don't agree with saying somebody is "full of crap". When we disagree we should prove our POV without resorting to insults. StuRat (talk) 04:47, 20 June 2008 (UTC)

Stu, you're absolutely right. I was not actually telling Russ they were full of crap. You'll need to scroll way up there, what I was referring to was where I said "With all due respect, bull-roar" and I wanted to draw attention to myself as the original questioner of the premise, not Toytoy. I was the one who initially questioned the reasoning, I'll take the heat. I certainly don't want to question the motives of anyone who asks or answers here. I do, however, like to learn whatever truth is available. Apologies if any offence was taken from my wording. Franamax (talk) 05:26, 20 June 2008 (UTC)

I think the argument suggested above is a good one. Take the idea to its logical conclusion, and conclude that since it takes less "energy" to keep a warm thing warm than to make a cold thing warm, it would take less energy to keep the house warm all year round than to leave the heating off for the year and only turn it on for Christmas Day. Assuming they agree that this is nonsense, ask them why they think there is a point (length of time) where the optimal choice swaps from being "turn it off" to "leave it on", and ask them where they think that point is. Maelin (Talk | Contribs) 04:53, 20 June 2008 (UTC)

Russoc4, you need to learn something about equilibrium before trying to solve this problem. It takes more energy to heat up a cold thing, right? But to keep the warm thing warm, you spend energy to warm it EVERY SINGLE MINUTE. Do I need to show you how confused you are?

You have a 1000 gal tank made of some lousy thin and porous material. You use it to store water. Inside the tank, the water level is 10 ft, outside it is 0 ft. Water seeps out your tank from everywhere on its surface. The higher the water level, the quicker it leaks.

Now you use a pump to keep the water level at 10 ft (THE FIRST 10 FT). At this level, you lose 10 gal per minute. You need to pump in 10 gal/min to keep the water lever constant.

To make the calculation easier, let's assume water loss is directly proportional to the water level; that means 3 gal/min at 3 ft. (This assumption actually makes water loss at 3 ft too high.)

Now you turn off the pump and let the water level gradually fall to 0 ft. Your tank is empty now. The porous material is also dried up (assume the material does not absorb and hold water).

Let's say your pump can do 20 gal/min. No more and no less. You can either turn it on or turn it off. You cannot let it run at 50% speed. THIS IS SIMILAR TO MOST HOME HEATERS. They are either on or off. If hey are adjustable, the range generally falls within a range of maximum efficiency.

• Time to fill up = 1000 gal / (Water In - Water loss).
• Water loss = A function related to the water level which I am too sleepy to do.

It takes time for the pump to fill up your 10 ft tall tank (THE SECOND 10 FT).

Since the average loss of water per minute between the first 10 ft (before turn-off) and the second 10 ft (after restart) shall be lower than 10 gal/min (water level is lower), EACH MINUTE YOUR TANK IS BELOW 10 FT, IT LOSES LESS THAN 10 GAL/MIN.

Let's say you have two tanks side by side, one (always on) is losing 10 gal/min, and the other (turned-off for a period of time) loses less than 10 gal/min during its low water level time (draining time + empty time + fill up time), WHICH ONE IS LESS COSTLY? WHICH ONE USES LESS ENERGY?

You really need to brush up your basic idea about physics. I am harsh. Yet, I am also telling you the truth. You idea is fuzzy and unorganized. -- Toytoy (talk) 05:04, 20 June 2008 (UTC)

I'm not sure why, but I still think it is possible for there to be a situation where turning the heat off will prevail, while another would have keeping it constant would prevail. I'm basing this on the assumption that the rate of heat transfer is independent of the temperature differences. I don't have the time just now, but if I can think of a situation with some parameters, I'll be sure to post it as soon as I do. --Russoc4 (talk) 13:28, 20 June 2008 (UTC)

I, and apparently everyone else here, stills disagress. However, I should mention there are some valid reasons for keeping the temp in your house constant. A constant temp and humidity is easier on wooden furniture and your pets. Letting your house cool down too much could result in pipes freezing. It's also nice to not have to wait for your house to become comfortable when you get home (although a digital thermostat may allow you to fix that last issue). I can even find an energy conservation reason for you: If you don't have a digital thermostat, or can't use it because you come home at random times, then you can get all hot and sweaty when you first arrive home. If this results in you having to take more showers and wash your clothes more often, this could possibly require more energy than is spent keeping the house at a constant temp. StuRat (talk) 13:49, 20 June 2008 (UTC)

I don't see a reason to argue about it. I just bought a digital thermostat (a big whopping $12) and set it to be 50 during the day, turn to 72 10 minutes before I get home, turn to 65 while I'm asleep, heat to 75 10 minutes before I wake up (I like it extra warm when I wake up). Previously, I had it set on 70 all the time. My electricity bill went down (a lot more than the $12 I spent on the thermostat). Now, I'm experimenting with the AC, letting it warm during the day and when I sleep. -- kainaw™ 14:17, 20 June 2008 (UTC)

One thing I think people are way overlooking is that if you leave your AC/heater off, there will be a point where the temperature will stop changing any significant amount. People seem to assume that leaving it off all year means the temperature will drop constantly, and never stop dropping, so then the cost of heating it on Christmas day would be equal to maintaining, but obviously that's not true. I'm sure there are cases where it's better to leave it on than off (such as 5-30 seconds or so for lightbulbs, I forgot the exact time), and times where it's better to keep it off (like if you go out on vacation for a week, your heater will have to heat from 50F up to 70F or something one day instead of maintaining 70F all week. If your house drops 10F every day during that week, then yes, it'd probably cost the same amount either way, but your house won't decrease in temperature forever, so then turning it off would be better. I'm thinking that it's probably more energy efficient to turn it off if the time is long enough for the house to cool down to a point where the temperature won't drop any more for a significant amount of time, and more efficient to leave it on if not. Something along those lines. I'll try and work it out based on heat conduction equations and specific heat equations when I get home, if no one has. --Wirbelwindヴィルヴェルヴィント (talk) 16:13, 20 June 2008 (UTC)

There is a benefit well before the temp drops to match the outside temp. As I've said repeatedly now the temperature loss is PROPORTIONAL TO THE DIFFERENCE in temps between the inside and outside. That means that even a one degree drop in the inside temp will slow the rate of thermal loss. Also, unlike the case of the light bulb, where it stays on if left on, and thus avoids the damage caused by many transitions, heat left on will still cycle on and off, unless it's so cold outside that it stays on constantly. The furnace will actually go on and off more often if left on than if it's turned off when the home is vacant. StuRat (talk) 16:58, 20 June 2008 (UTC)

I don't mean matching the outside temperature. For my parents' house, from what I noticed, is that it never seems to get colder than a certain temperature (between 55 and 60, I think) even if the heater is left off for a week in the winter when it's 32 out, or something. Sure, heat still escapes, but not fast enough to matter as much. --Wirbelwindヴィルヴェルヴィント (talk) 17:10, 20 June 2008 (UTC)

That's because of heat coming up from the ground and also heat generated inside the house, by lights, electrical equipment, stoves, ovens, water heaters, people and pets. StuRat (talk) 17:22, 20 June 2008 (UTC)

@sturat: "Temp loss is proportional to the difference in temps". Do you mean the total loss of heat or the rate of heat loss. Obviously more heat is lost going from 70 to 50 than 60 to 50, but what about the rate at which it happens. Assuming outside temperature is constant, should the rate of heat transfer be nearly the same for both processes? --Russoc4 (talk) 23:26, 20 June 2008 (UTC)

I mean the rate of heat loss. In your example, the heat would be lost twice as quickly with the 20 degree diff as the 10 degree diff. So, when the temp dropped from 70 to 68 in the first case, it would drop from 60 to 59 in the second case. This is why you save money by setting the thermostat lower, you have less energy loss as a result. StuRat (talk) 05:31, 21 June 2008 (UTC)

Thank you for replies. I like the example of only heating the house one day a year, although the counter-arguement will be that there is some shorter time-period where it makes sense to leave the heating on. An analogy that has occurred to me is that of a leaky bath with a running tap. Water is leaking out of this bath (heat loss) while at the same time water is slowly running into it from a tap (you might use a different word in American-english) just enough to keep it full. You want the bath to be full when you get home from work - will you save water by letting the tap run all the time, or by turning the tap off in the morning and putting the tap full on to fill the bath in the evening? Thanks 80.0.108.8 (talk) 12:16, 21 June 2008 (UTC)

Last surviving human artefacts?

If humans were all suddenly wiped out, what would be the last recognisable human artefact to survive millions or billions of years into the future, rather than becoming dust? Manhole covers? 80.0.101.122 (talk) 23:50, 19 June 2008 (UTC)

Voyager 2. If you look closer to home, whatever we left on the moon will also survive quite a while. On the Earth's surface, erosion, corrosion and subduction will remove/recycle most artifacts sooner or later. --Stephan Schulz (talk) 23:54, 19 June 2008 (UTC)

Noble metals? --Russoc4 (talk) 23:59, 19 June 2008 (UTC)

(ec) And eventually the death of the sun will trash anything on Earth or Moon, plus any surviving satellites and such, while there's no particular reason Voyager and the other interstellar probes shouldn't last much longer. Algebraist 00:01, 20 June 2008 (UTC)

Unless, of course we go out there to retrieve them all for display at the Smithsonian Institute in a hundred years or so... :) --Kurt Shaped Box (talk) 01:35, 20 June 2008 (UTC)

(e/c) I'll vote for Voyager (which was just said on the TV as I typed it!) but, without having done the math, I'd also propose isotopes of plutonium. Franamax (talk) 00:03, 20 June 2008 (UTC)

Wasn't this question just asked the other day? Someone provided a link to an article here about a book that was written on this same subject. I recall the article saying something about forests taking over cities and Mt. Rushmore being one of the last bits of evidence to disappear. Dismas|^(talk) 00:07, 20 June 2008 (UTC)

Found it. The World Without Us. Dismas|^(talk) 00:09, 20 June 2008 (UTC)

Enriched uranium will stick around much longer than plutonium, and since the isotope ratio of natural uranium is so predictable, any deposits of enriched uranium will be obvious for many half-lives of U-235. --Carnildo (talk) 21:22, 20 June 2008 (UTC)

(after ec) According to the documentary Life After People, which was shown here the other week, the last remaining 'large' human creations on earth would be the Pyramids, The Great Wall of China, the Hoover Dam and Mount Rushmore. I also remember reading a New Scientist article years ago which mentioned that when humanity comes to an end, the last remaining artificial evidence of our existence may well be glass bottles, or fragments thereof. --Kurt Shaped Box (talk) 00:11, 20 June 2008 (UTC)

I dunno about the Pyramids, aren't they on a northeast floating plate? At 2 cm/yr, I'm thinking it's only 30-40 million years 'til they go under. Franamax (talk) 00:23, 20 June 2008 (UTC)

Hmmm. I wonder if the Pyramids would still be recognizable as Pyramids at that point in time? --Kurt Shaped Box (talk) 00:37, 20 June 2008 (UTC)

(EC) I believe we're talking about timescales of less than 1 million years where they will disintegrate due to erosion and biological action. -RunningOnBrains 00:38, 20 June 2008 (UTC)

Well, if we're talking about just a million years, I'll re-nominate nuclear waste as our most enduring legacy. However I do believe that the Pyramids will still be somewhat pointy-shaped at that time. Franamax (talk) 03:59, 20 June 2008 (UTC)

Obviously television broadcasts of Star Trek: The Motion Picture have gotten farther than Voyager, but will they last longer? Will attenuation by interstellar dust wipe them out before V'ger gets pinged to death by micrometeorites or runs into a star? --Sean 04:20, 20 June 2008 (UTC)

For starters, the recent discussion on signal fade may be useful. Jdrewitt (talk) 06:34, 20 June 2008 (UTC)

According to the book The World Without Us and the Scientific American article about it, broadcasts and radio signals produced by humans may "survive" and travel through space for trillions of years (that is if the universe survives for trillions of years). --Apollonius 1236 (talk) 02:48, 21 June 2008 (UTC)

June 20

Homework Question

heat flows between 2 objects that are close to eachother if the objects have different what? —Preceding unsigned comment added by 66.66.198.72 (talk) 00:16, 20 June 2008 (UTC)

Please do your own homework.

Welcome to the Wikipedia Reference Desk. Your question appears to be a homework question. I apologize if this is a misinterpretation, but it is our aim here not to do people's homework for them, but to merely aid them in doing it themselves. Letting someone else do your homework does not help you learn nearly as much as doing it yourself. Please attempt to solve the problem or answer the question yourself first. If you need help with a specific part of your homework, feel free to tell us where you are stuck and ask for help. If you need help grasping the concept of a problem, by all means let us know. -- kainaw™ 00:30, 20 June 2008 (UTC)

Fellow refdeskers, this does appear to be homework. If I am giving too much information for a homework question, let me know. OP, see heat transfer. Ζρς ι'β' ^¡hábleme! 00:42, 20 June 2008 (UTC)

I think that we should link to articles for homework questions (as a matter of policy) even if it contains the answer in the first line. Zain Ebrahim (talk) 08:13, 20 June 2008 (UTC)

Agreed - if you know which article to link to. -- kainaw™ 13:53, 20 June 2008 (UTC)

Temperature. One object has to be hotter than the other, and it will then transfer it's heat to the cooler object. This is called conduction. JessicaN10248 18:11, 20 June 2008 (UTC)

Thank you, but we try and avoid giving direct answers to questions that look like they are probably from someone's homework. People don't learn well by just being given the answer. --Tango (talk) 18:50, 20 June 2008 (UTC)

Sorry. Obviously it's not good to do someones entire homework, but I was just pointing them in the right direction. If nothing else they'll have learned what conduction is. JessicaN10248 19:10, 20 June 2008 (UTC)

That wasn't pointing them in the right direction, it was giving them the answer... --Tango (talk) 21:52, 20 June 2008 (UTC)

Retaining wall - construction

I'm looking for a website that shows me how to construct a retaining wall. I'd like to be able to learn how one functions and know the specific formulas used in the construction of a retaining wall. Kironide (talk) 05:31, 20 June 2008 (UTC)

As an encyclopedia, Wikipedia has an article Retaining wall. For how-to information it's best to search Google. Otherwise Wikibooks may have a textbook on constructing a retaining wall that you can search for here[12]. Cheers, Julia Rossi (talk) 08:28, 20 June 2008 (UTC)

Cells and Tissue

shanu 06:43, 20 June 2008 (UTC)Most of the plant tissue(like sclerenchyma tissue) are made up of 'cells' which contain no protoplasm and are completely dead. Is it correct to label them as a 'cell'? If they are not cells how can sclerenchyma be called a tissue( given that tissue is a group of 'cells' performing same function with common origin( correct me if I am wrong))?

I guess you've seen the section of the article Sclerenchyma here[13]. Afaik, there is living tissue and dead tissue, but it's all tissue. Julia Rossi (talk) 08:32, 20 June 2008 (UTC)

Friction down an incline

Can someone please check the reasoning of my answer to the question below:

Q: A body of mass 5kg slides from rest down a plane inclined at 30° to the horizontal. After sliding 12m down the plane it is found to have a final speed of 10m/s How much work is done to overcome the friction along the plane [textbook answer is 44 J]

A: Work done by gravity, Wg = Fx = mgsinφx = 294J

Energy lost due to friction, Ef = ΔKE = 1/2mv² - 1/2 mu² = 250J

Work to overcome friction = Wg - Ef = 44J

Did I use the formula Ef = ΔKE correctly? I mean, is the formula always true? I'm using the formula but I don't understand the physics behind it. ExitLeft (talk) 07:34, 20 June 2008 (UTC)

Your calculation is correct but your reasoning is a little off. ΔKE is not the energy lost to friction. It is the increase in the kinetic energy of the body due to falling down the ramp. The loss to friction is the difference between the work done by gravity (mgh) and the kinetic energy you actually ended up with (½mv²). If they were the same then there would have been no loss to friction. Energy lost to friction and work done to overcome friction are the same number. SpinningSpark 11:52, 20 June 2008 (UTC)

Ok. Thanks for your help!ExitLeft (talk) 06:27, 21 June 2008 (UTC)

Pubews

I have pubes growing out of my areolae and am male. Is this normal. Before 1901 C.E., did males have this?68.148.164.166 (talk) 18:28, 19 June 2008 (UTC)

See chest hair and yes. Dismas|^(talk) 18:41, 19 June 2008 (UTC)

Are you sure? Are there documented cases before 1910 of approximately 6.3 cm long pubes coming out of a male areola?68.148.164.166 (talk) 19:41, 19 June 2008 (UTC)

Pretty sure. Chest hair is very common, and it generally starts on or around the areola. I have no reason to believe it's a recent phenomenon. I'm sure plenty of men in history have been described as having hairy chests - portraits of them may not show it, though, in the same way they often don't show pubic hair, despite the fact that it was almost certainly there. --Tango (talk) 19:45, 19 June 2008 (UTC)

Also, my hair acts as an asymtote; it just drops off in length away from the areola, so is that normal?68.148.164.166 (talk) 08:03, 20 June 2008 (UTC)

1) STOP moving questions around on the desks. 2) NOBODY has "pubes" growing from anywhere except the pubic area. 3)Why the arbitrary cut-off date? --LarryMac | Talk 19:48, 19 June 2008 (UTC)

I'm not sure if my "pubic" hair is considered normal. Because before then, plastics were not invented.68.148.164.166 (talk) 08:03, 20 June 2008 (UTC)

There is no cut off date, he's asking if they had hair on areolae before 1901. I'm pretty sure this is a joke question, anyway. And also, i've NEVER heard of a 6.3cm hair coming from an areolae. Regards, CycloneNimrod ^talk?_contribs? 20:22, 19 June 2008 (UTC)

Some nasty person removed my explaination: I'm not sure which year plastics were invented, but that I'm just concerned that xenoestrogens can alter hair growth. That's why I provided 2 years.68.148.164.166 (talk) 08:09, 20 June 2008 (UTC)

Well, there is a cutoff of either 1901 or 1910 (both were used above) before which such hairs did not exist. Based on the message on my talk page, this is nearly a medical advice question anyway, so I won't be commenting further. Unless he starts to move questions around again, then it's clobberin' time. --LarryMac | Talk 20:41, 19 June 2008 (UTC)

Chest hair is often extremely curly, so when straightened out, 6.3cm doesn't sound strange to me. I agree this is becoming close to medical advice, so in response to the message on my talk page I did recommend seeing a doctor if he was concerned (I said it sounded normal to me, though). --Tango (talk) 21:03, 19 June 2008 (UTC)

As Tango has already said, chest hair has definitely existed prior to 1901 or whatever date you want to choose. For starters you'll find descriptions of people with hair chests in old books. I suspect you'll also find paintings and the like containing chest hair even if wasn't commonly potrayed for a variety of reasons in some cultures (the article mentions this briefly). Heck you may even find photos of people with chest hair. Besides that, the idea that people all over the world are going to suddenly develop chest hair because someone in Germany or whatever made plastics is silly so the cut off date is pointless. Also, if people didn't have chest hair, and it suddenly started developing throughout the world after the invention of plastic, you can bet people would have noticed. Whether there has been a change in the type, frequency of or length of chest hair since the invention of plastics no one can answer. And finally if you have concerns about your chest hair, you should see a doctor. Nil Einne (talk) 10:48, 20 June 2008 (UTC)

I think some of you people might have misunderstood. I think the OP meant rogue hairs that develop sometimes during puberty, such as ones coming out of the areolae. I had one like this, and there was a point where it was growing to almost full length every day, because I would cut it and it'd be back the next day. Then eventually puberty ended and it started slowing down, and then it finally stopped showing its head. It also looks like "pubes" because it's abnormally thick, thicker than typical chest hair. I'm pretty sure this is what the OP is referring to. As for if it's dangerous, from when I researched it on the internet before, it's not anything to be concerned about at all, but if you're worried, consult a physician, as we can't give medical advice. --Wirbelwindヴィルヴェルヴィント (talk) 15:45, 20 June 2008 (UTC)

Sodium laureth sulfate

Sodium lauryl sulfate (SLS) is a foaming agent naturally derived from coconut and/or palm kernel oil.

— http://www.tomsofmaine.com/toms/ifs/sls.asp

Does sodium laureth sulfate have the same fate?68.148.164.166 (talk) 10:55, 18 June 2008 (UTC)

Does ammonium lauryl sulfate have the same fate?68.148.164.166 (talk) 11:02, 18 June 2008 (UTC)

Check the relevant articles at Sodium laureth sulfate and Ammonium lauryl sulfate --TomDæmon (talk) 11:36, 18 June 2008 (UTC)

Please don't tell someone to do something when you can't do it yourself.68.148.164.166 (talk) 08:06, 20 June 2008 (UTC)

Why can't you? After all, you're the one who wants to know... If your too lazy to do things for yourself, and rude when others offer you help, don't expect people to want to help you in the future. Nil Einne (talk) 09:28, 20 June 2008 (UTC) Sorry I may have been confused. Are you complaining that the articles don't really help answer your question? If so, then this is a legitimate complaint, although I would suggest you be more polite in the future to people who are trying to help. Nil Einne (talk) 09:37, 20 June 2008 (UTC)

I just wanted to point out that sodium lauryl sulfate and sodium laureth sulfate are different chemical compounds which tend to be readily confused (as may be the case here). Both are completely synthetic. But they can be produced from lauric acid, which is found in plant oils such as coconut and palm oils. I don't know if they actually are produced from naturally-derived oils, though. ChemNerd (talk) 16:43, 18 June 2008 (UTC)

The "naturally derived" term is misleading advertising. Of course all products we use are at some point derived from the natural environment such as from plants or from the earth, but in this case artificial production methods involving sulfuric acid are used. Graeme Bartlett (talk) 21:53, 18 June 2008 (UTC)

Of course it's even more misleading than that....the sulfuric acid could be collected from the run-off from mine tailings. Or acid rain. Now I assume the sulfuric acid used, even if a synthetic commercial product, was made using some other material found in nature. Lather, rinse, repeat backwards step by step. DMacks (talk) 22:24, 18 June 2008 (UTC)

IMHO, the problem is that 'naturally derived' is mostly a meaningless term. All products can be said to be naturally derived, perhaps unless you are producing them in a particle accelerator or fusion/fission reaction. The problem is of course, people assume something 'naturally derived' must be safe, which clearly isn't the case. The only case when naturally derived is perhaps meaningful is as a distinguisher when you are referring to flavours or other substances which occur in nature and are isolated without significantly changing them but can also be produced artificially. Nil Einne (talk) 09:44, 20 June 2008 (UTC)

Human Evolution

Evolution is an ongoing process. Thus humans should be evolving too. I want to know in what possible ways can humans evolve into in future?117.197.5.137 (talk) 10:33, 20 June 2008 (UTC)

There's Participant evolution, but for the more traditional biological angle, I can't find a thing in Wikipedia. I'm sure there are such predictions, though. Sorry. Try a Google search. --Allen (talk) 11:11, 20 June 2008 (UTC)

Modern medicine and welfare systems means there isn't all the much evolution. Evolution happens when genetic difference increases the number of offspring someone is likely to have, however these days how many children you have bares little relation to anything to do with your genes. Welfare means people that wouldn't otherwise be able to support themselves, or children, are able to anyway, and fertility treatments mean people that wouldn't otherwise be able to have children at all can anyway. In fact, I think there is a negative correlation between number of children and level of education (I don't have statistics, this is rather anecdotal), which is the opposite of what you would expect from natural selection. There are various other ways humanity can evolve, but conventional natural selection isn't going to do much (baring a major disaster - evolution generally goes much quicker if a population is facing extinction, see genetic drift for one reason). --Tango (talk) 11:53, 20 June 2008 (UTC)

Evolution is always ongoing, but it technically just means gene flow. If you mean, "major phenotypical changes on a noticeable level across the entire species", though, keep in mind that 1. even under highly selective circumstances, in which the difference between some individuals living, dying, and reproducing is extremely high, evolution is incredibly slow from a human point of view, and 2. humans have engineered their world so that our circumstances are, for the most part, not highly selective—that is, most people these days can make it to adulthood and reproduce and etc. without too much difficulty, even if they have bad eyesight or are overweight or are not very bright or what have you. Some have argued that this is a form of dysgenics but I don't see a lot of evidence that things have changed all that much for quite a long time and tend to think we are just going to see a regression toward the mean in the long run (that is, there will not be much change on average over the entire gene pool). But this is a point of dispute, and there is no rigorous way to know. We can't in any concrete way predict what will happen to the human species over the next, say, ten thousand years, especially since things like reproductive patterns are shaped not only by culture and society but more and more by the technologies we develop for them (without even considering things like reprogenetics, something as "simple" as the pill has changed those patterns dramatically from what they were a hundred years ago). But ANYWAY—if you just want to know "possible ways" that the human species could change over time, just look around you and imagine that any outlying individual you see could be indicative of the entire species. We have a lot of variables that could change, ranging from the very superficial (weight, height, eye color, etc.) to the more subtle (personality, intelligence). Probably not in the cards are things like multiple arms and extra fingers (which are likely to be non-beneficial mutations in most cases anyway, and are almost certainly to be selected against in almost all imaginable scenarios) or telepathic powers (or other things with no physical basis for existing). Boring, no? --98.217.8.46 (talk) 11:55, 20 June 2008 (UTC)

See also higher evolution.--Shantavira|^{feed me} 13:07, 20 June 2008 (UTC)

See Idiocracy for a not-unlikely scenario. :) --Sean 13:37, 20 June 2008 (UTC)

For a related idea see dysgenics--Fang 23 (talk) 19:07, 20 June 2008 (UTC)

See Man After Man: An Anthropology of the Future and the mbc article Human evolution at the crossroads for possible future human evolution scenarios.--Fang 23 (talk) 19:02, 20 June 2008 (UTC)

Also the Hard science fiction project Orion's Arm provides some interesting examples of posthuman species that may arise in the future from genetic engineering or other types of Participant evolution such as the Europans who are aquatic humans who dwell in the seas under the jovian moon Europa's ice.--Apollonius 1236 (talk) 19:42, 20 June 2008 (UTC)

Ok here's the problem. We aren't subjected to natural selection much anymore. We have modern technology protecting us from climate change, natural disasters, other animals, etc. Also there is a lot of gene flow which prevents speciation. You can live in America, and hop into a plane and travel to Japan in a day or so. The human populations of the world are no longer isolated, so there is a lot of mixing when people from different cultures mate. This inhibits speciation. And finally, and I think most importantly, we can evolve ourselves. With things like genetic engineering, or even the technological singularity, artificial evolution is far more likely to occur. Why depend on nature to evolve us, when we can evolve ourselves faster, and with desired results?

So unless a nuclear war occurs and blasts all of us back to the stone age, I don't think natural evolution will take precedence over artificial evolution. ScienceApe (talk) 18:13, 20 June 2008 (UTC)

Not voices in the head, but similar

Imagine that someone keeps repeating a frase or idea in his head over and over aware (but fully aware that it is not the Mary, the mother of Jesus). How do psychologies call this phenomenon? GoingOnTracks (talk) 11:18, 20 June 2008 (UTC)

You mean like having a song stuck in your head all day, or something more long term? Be warned, we can't give medical advice here, so you're going to get vague answers at best. --Tango (talk) 11:55, 20 June 2008 (UTC)

Yes, also like that. Some songs repeats on your head over and over. How do you call it? GoingOnTracks (talk) 12:01, 20 June 2008 (UTC)

Earworm? -- Ferkelparade π 12:41, 20 June 2008 (UTC)

Wow I never knew there was a name for that. WP is awesome 125.21.243.66 (talk) 14:22, 20 June 2008 (UTC)

Is this purposeful or something that just happens? There is an old book. If I remember correctly, it is Russian and the name translates to something like "The Pilgrim". Perhaps it is a fake book mentioned in another book - but that's not the point. In this book, a man attempt to pray at all times, so he purposely repeats the same prayer over and over until he is able to repeat it in his mind at all times. -- kainaw™ 14:00, 20 June 2008 (UTC)

obsessive thoughts/intrusive thoughts? Or just a variant of earworm I suppose, if harmless. 79.66.20.219 (talk) 15:01, 20 June 2008 (UTC)

Oliver Sacks has a whole chapter on this in Musicophilia. He mentions the term earworm, and says it was coined in the 1980s (a translation of the German term Ohrwurm), but people have been describing it for a long long time. Sacks, liking the alternate term "brainworm", describes them as: "brainworms and allied phenomena -- the echoic or automatic or compulsive repetition of tones of words". Usually he will mention a "medical" Latin-type term for things if one exists (terms like, eg, aphasia, etc), but he doesn't for earworms. So perhaps there isn't a "scientific" name for it. His chapter on them explores, a little, the way they seem to work, and makes some vague comparisons to certain aspects of things like autism, Torrette's syndrome, and obsessive-compulsive disorder, but notes that unlike these things, virtually everyone experiences earworms from time to time. Pfly (talk) 00:39, 21 June 2008 (UTC)

As an anecdote, I used to get this all the time. I'd get fixated on a word and it would just keep popping up in my head repeatedly. Very frustrating. I recently started taking anxiety medication and have noticed that the earworms have ceased when I'm on the meds. They only pop up again in the late evenings/early mornings, when my dose has worn off. I do still get songs stuck in my head, but in a pleasant way rather than the irritant that the earworms are. (Got a Devils Haircut in my mind...) — The Hand That Feeds You:^Bite 13:25, 21 June 2008 (UTC)

Related question to above question

Related to the above question... Is there a term for being able to recall music/speech/noises verbatim even after it has clearly left short-term memory? Basically, is there a term for "photographic memory", but related to the sense of sound, not sight? -- kainaw™ 15:25, 20 June 2008 (UTC)

Technically, photographic memory refers to Eidetic memory which include images and sounds. Gjmulhol (talk) 16:32, 20 June 2008 (UTC)

(ec)I'd recommend a read of Eidetic memory. It seems that the term (and 'photographic memory') covers all sorts of memory remembered in this fashion, although most tests focus on visual memory. An interesting little read anyway, and it links to other interesting places (as always). 79.66.20.219 (talk) 15:34, 20 June 2008 (UTC)

Aerosol Can

The other day, I just kept pressing the button of an aerosol can used to store perfume, even after the perfume had finished, just to see what happens. To my surprise, a fair bit of some kind of gas came out, which was definitely not perfume (as it didn't smell) and just before it went completely empty, the bottle turned really cold, like it had just been brought out of the deep-freeze. Can anyone explain what happened? Aanusha Ghosh (talk) 16:58, 20 June 2008 (UTC)

It's the propellants. --Wirbelwindヴィルヴェルヴィント (talk) 17:06, 20 June 2008 (UTC)

The gas was the propellant, used to propel the perfume out of the can. The perfume, or whatever, generally runs out before the propellant in my experience, so you get propellant on its own at the end. The reason it got really cold is because the pressurised gas expanded. When gas expands, it cools, see Charles's law. I can't see why it would happen right at the end, it should have got gradually colder as you used it up. It would have got really cold because you used it all up at once, normally it has time to warm up inbetween uses, so the temperature change it minimal. You can see the same affect if you look at gas canisters used for a gas heater, or BBQ or something - they often develop frost on the outside as they are used. --Tango (talk) 17:07, 20 June 2008 (UTC)

I imagine it took the can a minute to cool down after the gas inside cooled, so you would expect a slight delay between starting to spray and feeling the can cool down. StuRat (talk) 17:19, 20 June 2008 (UTC)

A thin metal can won't take long to cool down, but yes, there would be a slight delay. That still doesn't explain why there was a sudden change in temperature, it should have been a delayed gradual change. --Tango (talk) 18:17, 20 June 2008 (UTC)

Perhaps a propellant/perfume mixture was coming out for most of the expulsion, and then a shot of pure-propellant at the end comes out very fast due to its lower viscosity, explaining the last-minute freeze. --Sean 19:32, 20 June 2008 (UTC)

By the way, you should be careful about spraying a lot of gas out of an aerosol can like that. Once upon a time the propellant was typically freon, but this is no longer preferred due to the ozone layer depletion problem, and the gases now used are often flammable. (Of course, aerosols are also a fire hazard when used in the normal way, if the product is flammable.) --Anonymous, 01:37 UTC, June 21, 2008.

But of course this can be a distinct feature, if for example there's a deadly snake in the bathroom of your hut[14]. —Steve Summit (talk) 06:17, 21 June 2008 (UTC)

For a more godly example, see also the elevator scene in The Blues Brothers. --Anon, 21:47 UTC, June 21, 2008 AD.

Asperger Syndrome in Females

• This question has been removed as it may be a request for medical advice. Wikipedia does not give medical advice because there is no guarantee that our advice would be accurate or relate to you and your symptoms. We simply cannot be an alternative to visiting the appropriate health professional, so we implore you to try them instead. If this is not a request for medical advice, please explain what you meant to ask, either here or at the talk page discussion (if a link was provided). Regards, CycloneNimrod ^talk?_contribs? 18:38, 20 June 2008 (UTC)

My 25 year old cousin has Asperger yet she seems normal (normal meaning she doesn't appear to have Aspergers). Maybe just slightly a little too shy and sometimes she fumbles her words when she speaks. She has a lot of trouble explaining to people that she has this condition because they simply don't believe her. She was diagnosed a long time ago with this. How could this be? --Anthonygiroux (talk) 18:31, 20 June 2008 (UTC)

I've restored the question, as I see no sign of a request for medical advice here. As for Asperger's Syndrome, I suggest you read up on it by following that link. StuRat (talk) 21:00, 20 June 2008 (UTC)

I understand the question in a way if there is Asperger in females. As the article states that cause of Asperger is not fully understood and no specific gene has yet been identified, it is not limited to male, so a female dignosed with Asperger is possible.--Stone (talk) 21:43, 20 June 2008 (UTC)

I moved the discussion to Wikipedia talk:Reference desk#Medical question discussion. Zain Ebrahim (talk) 22:44, 20 June 2008 (UTC)

(Responding because in my opinion question is asking for information, not for advice) Asperger syndrome can definitely occur in females, although it is more common in males. If you or your cousin want to know more about the process of diagnosis, we have an article on diagnosis of Asperger syndrome. It is important to realise that Aspeger syndrome is not a disability - it is a set of behavioural traits and cognitive preferences that are an advantage in some situations but may also be a disadvantage in others. Indeed, some people with Asperger syndrome refer to it as a "gift". Think of it like being taller than average - good for reaching things on high shelves; not so good for driving a small car. I see no reason why your cousin should need to "explain" to people that she has Asperger syndrome unless it is relevant in a specific situation - you don't need to tell everyone that you hate garlic, only someone who is about to cook a meal for you. For more information on Asperger syndrome there is the Wrong Planet online community, and books by Elisabeth Hughes and Luke Jackson. Gandalf61 (talk) 13:02, 21 June 2008 (UTC)

A more straightforward explanation could be that your cousin was misdiagnosed. You mention that she was diagnosed 'a long time ago' and in my personal and professional experience a significant number of people with neurological or neurogenic disorders were misdiagnosed a long time ago. This issue brings to my mind a long time problem with people who make miraculous recoveries against all medical prognostication. "The doctors said he'd never walk again" and when the patient takes up his bed and walks do we admire with awe the spirit and courage of the patient or should we treat with deep scepticism the ability of the doctors to make an accurate forecast about the outcome. Richard Avery (talk) 14:27, 21 June 2008 (UTC)

Lab coats

Correct me if I'm wrong, but I'm pretty sure scientists don't drive to work wearing lab coats, so they must put on lab coats after they get to work. So my question is, at research facilities,

(A) is there a single big closet filled with lab coats of various sizes, and when a scientist arrives at work he or she just picks one out of the closet OR

(B) do scientists each have their own lab coats which they keep in their office, and they put it on when they get to work?

If (B), then what happens if you're a scientist visiting for a single day a research facility you don't work at, so you don't have an office with your own lab coat in it? Is there a closet of lab coats for visiting scientists?

Also, someone should add the answers to these questions to the lab coat article.

—Lowellian (reply) 19:29, 20 June 2008 (UTC)

Unless you have your own lab coat, I'd imagine the research facility would have several lab coats on a rack for each department that needed them. The scientists would simply pick any one they wanted, and return them at the end of the day, and presumably a cleaner would come along now and then to clean them. Thats how it is in every lab I've been in. But if your dealing with hazardous materials such as nuclear wast the lab coats would be worn only once before being destroyed, so they would probably have a large supply in a store room somewhere. JessicaN10248 19:37, 20 June 2008 (UTC)

In the labs I've been in, each of us had our own lab coat. Not that they had our names or anything on them, but they came in different sizes, and each had their own unique set of smudges, stains, burns, contaminants, etc. that identified them to their "owners". Occasionally I would wear mine home, but usually kept it on a rack at work.

When I visited another facility, I don't remember wearing a coat. That's because I was visiting for the purpose of observing, not for doing things that might get my clothing dirty. ~Amatulić (talk) 19:43, 20 June 2008 (UTC)

In the hospital here, all people have their own lab coat with name and position on it. I never wear mine. It has been hanging on the back of my door since I received it. Visitors don't wear lab coats unless they are here for a length of time. Then, the department they are attached to can opt to give them a lab coat. -- kainaw™ 20:02, 20 June 2008 (UTC)

It depends on the lab. In the institute where I work, I wear a lab coat only when I'm doing something messy or when I'm working with bugs (microbes, not insects...). When I want a clean coat, I drop the old one in the laundry bag and pick up a fresh one from the supply room. Used coats aren't shared—you don't know what the last guy spilled on the coat, now do you? The lab coat never leaves the lab, since you don't want to transfer toxic chemicals, caustic solvents, or infectious materials from the lab out to your office, the lunchroom, or to the WC. (There's an old joke—Q: How do you identify a chemist? A: He always washes his hands before he goes to the washroom.) Different laboratories will have different policies depending on the nature of (and risks associated with) their work, government regulations, and local attitudes toward health and safety. TenOfAllTrades(talk) 22:13, 20 June 2008 (UTC)

Where I used to work you got given a lab coat when you first arrived. Members of one lab each dyed their lab-coats a different colour to ensure they always got their own one back from the laundry. Currently where I work, there is no personal ownership of lab coats: instead we have a lab-coat laundry that one can collect a coat from or drop of off at will. Rockpocket 00:50, 21 June 2008 (UTC)

In my lab (biosafety level 2, working with infectious human viral pathogens) the technicians each have multiple coats. Some coats are for a specific room, to avoid cross-contamination from room to room. Transient visitors are not allowed to work in the lab, except to service equipment. Longer-term visitors who work in the lab are provided with coats to use.Scray (talk) 04:01, 21 June 2008 (UTC)

Two experiences of my own:

• R&D section of a medium size food products company - Everyone had a couple lab coats with their names that were left at work and cleaned by a laundry service. I think lab coat use was mandatory. The work here tended to be messy.
• Government ag research agency. Lab coat use totally optional and most don't use. Cloth lab coats actually not allowed, for some safetly/liability related reason. Disposable lab coats available in the stock room.

Anything in this discussion we can fold into the article? ike9898 (talk) 14:05, 21 June 2008 (UTC)

Rainbow frequency

Hi. Over the past 4 weeks or so, I've seen four rainbows. That's one per week! What does this indicate about the precipitation patterns over this period? 3 of the rainbows were complete, 2 were especially bright, 2 were low to the ground, all occured between 6 and 8 pm EDT (Southern Ontario), 2 had a secondary bow visible, 2 occured when it was raining in sunlight, 2 occured after "missed" thunderstorms, 3 were photographed, and all occured in spring. Is this particularly unusual? Are there statistics for the average number of rainbow days in S. Ontario? Thanks. ~AH1^(TCU) 22:10, 20 June 2008 (UTC)

I expect they all occurred while it was raining in sunlight, since that's how rainbows work. It may not have been raining exactly where you were, but it must have been raining nearby. Since rainbows occur when it's raining and sunny at the same time, they generally happen in light showers, which are quite common in spring - see April showers. --Tango (talk) 22:41, 20 June 2008 (UTC)

How do we not have an article on April showers? What is Wikipedia coming to... --Tango (talk) 22:42, 20 June 2008 (UTC)

Ironically, WP has April Showers (song) and April's Shower (film). Zain Ebrahim (talk) 23:43, 20 June 2008 (UTC)

Color of birds' eggs

What factors are relevant to the color of a bird's eggs? Does the color in the eggshells come from the bird's diet, the same pigment used for its feathers, or something else? Also, how do egg colors evolve and what advantage do various colors and patterns serve? For instance, the robin's blue eggs seem like they'd be easily spotted by predators. 69.106.4.120 (talk) 22:22, 20 June 2008 (UTC)

Don't know about pigments, evolutionary advantage, etc. (the eggshell article is a little sparse), but one thing I have heard (confirmed by Egg_(food)#Shell) about chicken eggs is that the color of the eggshells matches the color of the hen's ear (that is, the skin around the hole which leads to the eardrum). White ear = white egg. Brown ear = brown egg. Blue-Green ear = blue-green egg. I don't know if this holds for other birds, though. -- 128.104.112.147 (talk) 23:35, 20 June 2008 (UTC)

There are probably lots of factors involved in driving egg colour (see [15] for a review). There are a range of pigments known to colour eggs, these include biliverdin in blue eggs and complex porphyrin polymers in brown and black speckled eggs. Its been questioned why birds use these pigments, and not the more ubiquitous melanin, to pigment their eggs. A clue might lie in the fact that biliverdin and other porphyrins do not absorb infrared light (which is a large proportion of solar energy), thus they may help the eggs from over heating. A remarkable study (Gosler, A.G., Higham, J. P. & Reynolds, S. J. (2005), Why are birds' eggs speckled?, Ecology Letters) demonstrates that the speckled parts are thicker than the unspeckled part of the egg, suggesting one of the purposes of the pigment may be to provide structural support. Rockpocket 00:45, 21 June 2008 (UTC)

I'd say the color usually has one of two primary purposes:

1) Camouflage. This would apply to birds which must leave the eggs alone to find food. They would want them to be the same color as the nest or cover in which they are left.

2) Ease of location. For birds which take turns watching the eggs, so they are never left alone, it would make sense to make them easy to spot so the birds can easily keep track of them. Thus, they would want a color that sticks out versus the surroundings. StuRat (talk) 05:22, 21 June 2008 (UTC)

Sturat, wouldn't the second cancel out the first? They ain't Easter eggs. ;) Julia Rossi (talk) 10:17, 21 June 2008 (UTC)

One of two Stanstaple (talk) 12:31, 21 June 2008 (UTC)

Mmm. It's that I can't figure the second one being significant. I'd guess for birds (though who can know) it's not a case of "my god, I've mislaid the eggs!", but that camo and temperature control would be primary. Wouldn't birds find their own eggs by other factors than markings, by say, having information about the whole nest print, sun angles and geography? Julia Rossi (talk) 12:44, 21 June 2008 (UTC)

When birds trade positions sitting on eggs, they frequently knock them about a bit. It's critical that they find any that rolled away quickly, to keep them warm. Obvious colors may make them able to notice the eggs which rolled away more quickly. StuRat (talk) 16:02, 21 June 2008 (UTC)

Also, some birds don't even seem to use color cues when identifying their eggs-- there have been cases of chickens willingly incubating objects like lightbulbs because they had the same overall shape as eggs. (But they will throw out an egg that's unlike the others in the nest, even if it's really theirs.) 69.106.4.120 (talk) 14:20, 21 June 2008 (UTC)

Chickens aren't exactly the most intelligent birds, are they ? StuRat (talk) 16:02, 21 June 2008 (UTC)

Maybe what we're seeing here is a cue from shape, however vague, rather than colour? Julia Rossi (talk) 02:48, 22 June 2008 (UTC)

Hawk-headed Parrot - undeserving of bad reputation?

If you keep psittacines, or associate with people who do, you'll probably eventually hear the horror stories about the fearsome Hawk-headed Parrot, supposedly the ultimate 'expert-level' companion parrot. This bird's 'difficulty' is nothing to do with price, size, noise, eating habits or its rarity, mind. Rather, it is a supposedly 'difficult' bird because of its extreme aggression, unpredictable temperament and sly, cunning malice.

Yes, it will apparently kill any other bird housed with it once it tires of the company - even its own mates and/or offspring, will break human fingers for fun and will feign playfulness or use human language in order to attract humans within striking range - then lunge for the eyes, lips, nose and ears, with intent to cause serious damage. Or at least that's what they'd have you believe (sounds like a bit of an exaggeration to me). "An abused pitbull with a brain" is one description I've heard for this bird.

So, does anyone here have any *real* experience with Hawk-heads? I'm slightly curious to know how they got such a bad rep. I've never actually seen one in real life... --Kurt Shaped Box (talk) 22:59, 20 June 2008 (UTC)

Hi Kurt, do you have the right bird? I googled them and there's nothing except "affectionate", "likes to be held close", great pet and the like. When I searched "vicious hawk-headed etc" not much more except that one was anxious, agitated and in need of treatment. "Kamikaze" gets this[16]. Maybe the problem arises with the owners. For 1200 to 1800 bucks though, I'll never find out. Julia Rossi (talk) 10:03, 21 June 2008 (UTC)

I can't remember the exact search terms I used now, but I did come up with a few horror stories (the one you linked above was one that stuck in my mind, as it confirmed something I had previously been told, WRT the birds maliciously luring humans). Most of the things I've heard have been from fellow parrot fanciers in person, none of whom actually own Hawk-heads. I subscribed to Cage and Aviary Birds Magazine a few years ago and I remember there being a few writeups and write-ins mentioning that one always had to be careful around Hawk-heads, due to their Jekyll/Hyde nature. Whether this is another case of people just repeating stories that they've heard, I don't know.

Do you know much about Rosellas? I've heard that they can be quite 'difficult' too. --Kurt Shaped Box (talk) 23:40, 21 June 2008 (UTC)

Not Rosellas personally, but a nasty Masked Lovebird (little though it was, it destroyed any bird put with it), a vicious eastern Sulphur-crested Cockatoo and a Rainbow lorikeet. It had a lot to do with jealousy, their keepers indulging them and allowing them to dominate. All had bad tempers. The sulphur one would bite its keeper while speaking sweetly. Even though they start off young and cute, the more smart and aggressive parrots are vigorous, demanding pets even if hand-raised. So for me, it looks like behaviour problems on the one hand, being bored in captivity, and maybe keepers bragging about having power pets... you know how bad news catches on. Julia Rossi (talk) 02:43, 22 June 2008 (UTC)

cheaper coffee - instant or ground?

shoo there, moved back to humanities here[17] for price factors and OP reasons Julia Rossi (talk) 10:37, 21 June 2008 (UTC)

June 21

Trig

Hello i have problems in remembaring trigonometrical ratio i know there is a table with the help of which can easily calculate any ratio for sin,cos and tan but i forget it in school times so please help me i will be very thankful —Preceding unsigned comment added by Usmanzia1 (talk • contribs) 00:54, 21 June 2008 (UTC)

I always just remebered the phrase "SOH-CAH-TOA" when I was in school. sin = opposite/hypotenuse; cos = adjacent/hypotenuse; tan = opposite/adjacent. I'd write it out each time, because I'm lousy at conceptualizing these things, and draw the little triangle (opposite is always the side that is directly opposite the angle you are looking at; hypotenuse is always the longest one; adjacent is the only other one left). Or is that not what you are looking for? --98.217.8.46 (talk) 01:31, 21 June 2008 (UTC)

A mnemonic I was taught in school goes: Some People Have (s=p/h) Curly Brown Hair (c=b/h) Till Painted Black (t=p/b), where s = sine, p = perpendicular, h = hypotenuse, c = cosine, b = base, t = tangent. No doubt there are lists of mnemonics somewhere.--Shantavira|^{feed me} 06:14, 21 June 2008 (UTC)

Alternatively, why remember complicated mnemonics when you can just look up the Wikipedia article Trigonometry#Overview. SpinningSpark 11:55, 21 June 2008 (UTC)

Nothing complicated about the mnemonics, but possibly best to pick (or invent) one that's memorable for you yourself. Look at the article Spinningspark linked to remind yourself of the actual ratios, then maybe invent your own mnemonic so you can remember :) (I would note that Shantavira's mnemonic only works when the triangle is lined up so that one side is horizontal and the other vertical, and the angle is opposite the vertical line. The method recommended by 98.217 and others which use the words 'opposite' and 'adjacent' work for any right-angled triangle) 79.66.20.219 (talk) 20:23, 21 June 2008 (UTC)

When the North American Indians taught trigonometry to the European colonists, they all said "SOH CAH TOA," and thus was learnt trig. Mac Davis (talk) 01:32, 22 June 2008 (UTC)

sunburn

Why does vinegar [distilled] totally relieve the pain (burn and sting) of sunburn? Adaptron (talk) 13:03, 21 June 2008 (UTC)

the stereotype about women being scared of bugs more than men

You see it all the time, when women are portrayed alot in pop culture as screaming at the sight of a spider and asking a man to kill it. Are more women than men scared of things like bugs, spiders, creepy crawlies? Is the stereotype justified in ANY way by psychology or any studies made to test its veracity? Even if the stereotype contains any grain of truth, I would have a hard time conceiving why there would be a gender difference evolutionarily speaking. (ie. It's true men are on average stronger than women by physical not like there would be a survival advantage or selection for women to be have a high incidence of phobia of creepy crawlies, because they are tiny and you don't need strength to kill/avoid them to save your life)

74.14.117.135 (talk) 02:25, 21 June 2008 (UTC)

Well, I'm a man who is plenty creeped out by a centipede crawling on my leg, too. My first reaction is to get it off me, and my second reaction is to kill it. That last part is probably where the difference between men and women lies, the men want to kill those disgusting things while the women want someone else to kill it. This might just be a culturally learned trait, or it might have a genetic basis. If it is genetically based, I'd guess it goes back to the division of labor between men and women back in our hunter-gatherer past, where women did child rearing, gathering, weaving, preparing food, etc., and men did hunting and warfare. This would better equip men to handle dangerous animals. While most insects are harmless, a few are dangerous, and this probably explains why they creep us out. An exception is moths and butterflies. There aren't any poisonous moths or butterflies, so we don't fear them. StuRat (talk) 05:13, 21 June 2008 (UTC)

It all has to do with culture and conditioning. If you lived in the rainforest and ate tarantulas for lunch, you wouldn't be afraid of bugs at all, male or female. ScienceApe (talk) 06:39, 21 June 2008 (UTC)

I like bugs. Maybe it's a convention, a literary device, even a social device,to give the man a chance to impress and fulfil his protective role since there are no dragons to slay or handy mountains to climb. On the other hand, there is something disturbing about a little thing with excessive legs and a likely poisonous bite. Julia Rossi (talk) 09:54, 21 June 2008 (UTC)

I don't really know the answer, but I think the supposed difference in how much the two sexes fear creepy crawlies may be at least partly the result of gender roles. Girls may have been "taught" (explicitly or as a result of socialization) that it's OK to show their fear, whereas boys may have been "taught" to play the role of the protector and that they should not let their fear show. --71.162.233.193 (talk) 17:42, 21 June 2008 (UTC)

Spiders creep me out but other bugs don't, in fact I keep ants! JessicaN10248 18:59, 21 June 2008 (UTC)

Hmmm... So, I'm guessing this is pretty much cultural and not "evolutionary psychology" in any way (ie. If you explained that men are supposedly less scared for killing bugs because tribal hunts were done by men, and women were protected, it'd be a "just-so-story") 74.14.117.99 (talk) 21:25, 21 June 2008 (UTC)

Perhaps it is a culture-bound syndrome. I was scared a week ago from walking casually down the stairs only to notice a spider suddenly appear a foot away from me, hanging down from the ceiling. Bugs are good at being unpredictable and speedy. Mac Davis (talk) 01:30, 22 June 2008 (UTC)

Question about neutron bombs

According to the article, the neutrons are not radiated beyond the bomb's blast range because they are absorbed by air. So then how would the neutrons kill living beings? The living beings would have to be inside of the blast in order for the neutrons to reach them, but then they would be killed by the blast anyway. But then the article says, "The lethal range for tactical neutron bombs exceeds the lethal range for blast and heat even for unprotected troops". But how is this possible if the neutrons do not radiate beyond the blast range? ScienceApe (talk) 06:33, 21 June 2008 (UTC)

If I may be so bold... it is due to the number of neutrons. A neutron bomb is designed to release a far greater number of neutrons than a conventional nuclear bomb which greatly exceeds the number of neutrons the elements which make up the atmosphere can absorb. 71.100.3.84 (talk) 07:25, 21 June 2008 (UTC)

Actually, our article states that for a "high-yield bomb", the blast radius exceeds the direct radiation effects. The neutron bomb is a low-yield (well, comparatively) bomb. --Stephan Schulz (talk) 10:05, 21 June 2008 (UTC)

My guess is that after the air absorbs neutrons, it becomes radioactive and the radioactive air is what kills living beings. — DanielLC 14:54, 21 June 2008 (UTC)

Sorry, but your guess is wrong. It's indeed the initial neutron blast that is supposed to kill people. All the major components of air are low-weight atoms. It's not easy to turn them radioactive, especially not by bombarding them with neutrons. --Stephan Schulz (talk) 15:39, 21 June 2008 (UTC)

Stephan Schulz's answer is correct. Weapons can be 'tuned' for (somewhat) smaller blast and greater neutron yield, expanding the lethal radiation radius beyond the blast radius. While it is technically true that exposure to the intense radiation from a nuclear blast will make the air radioactive, this effect is slight, and the large majority of radioisotopes produced have short half-lives – less than a minute – and clear rapidly. (More dangerous is fallout—radioactive dust which settles after a nuclear blast; more fallout is generated when a bomb explodes close to the ground.) TenOfAllTrades(talk) 15:45, 21 June 2008 (UTC)

But the article says that the neutrons don't radiate beyond the blast range. But people would be killed within blast range anyway. Also the article said that people would be killed well beyond the blast range by the neutrons... Which contradicts the earlier statement that the neutrons don't radiate beyond the blast range. ScienceApe (talk) 17:16, 21 June 2008 (UTC)

The article does not say that. I think you are mislead by this sentence: "This is because neutrons are absorbed by air, so a high yielding neutron bomb would not be able to radiate neutrons beyond its blast range and so would have no destructive advantage over a normal hydrogen bomb". But, as the preceding sentence makes clear: "Neutron bombs have low yields compared with other nuclear weapons." --Stephan Schulz (talk) 17:31, 21 June 2008 (UTC)

To confuse things a bit further think of what happens to the air when a nuclear explosion occurs. The nuclear blast produces a dense "shell" of compressed air known as a pressure wave. This dense "shell" of compressed air absorbs neutrons so the less compressed or dense the shell the more neutrons that will not be absorbed. 71.100.1.215 (talk) 21:13, 21 June 2008 (UTC)

I'm not sure that's quite right. The pressure wave moves at the speed of sound and the neutrons move much faster than that, I believe. Also, the neutrons are generated more or less instantaneously, so they would always be moving in advance of the air density fluctuations. Franamax (talk) 04:06, 22 June 2008 (UTC)

I'm not sure that air is dense enough to stop neutrons immediately. Usually when you want shielding against neutron radiation you use something that is dense and full of light atoms, like paraffin. Air is full of light atoms but is not dense. Air is not, by itself, a shield against neutron radiation, though I guess after a certain limit they'd probably eventually hit oxygen molecules and slow down. --98.217.8.46 (talk) 05:14, 22 June 2008 (UTC)

how is sugar used to treat battlefield wounds

Im trying to find out how using Osmotic Pressure,sugar is used to treat battlefield wounds,I herd that it dates back to the napoleonic war. Can someone give me some details please. —Preceding unsigned comment added by Frostytsnowman (talk • contribs) 11:27, 21 June 2008 (UTC)

This article on honey explains how the osmotic pressure acts as an antimicrobial agent. There are plenty of references in the article (which I havn't looked up myself) which seem to indicate that this was a treatment for wounds long before the Napoleonic wars. SpinningSpark 12:17, 21 June 2008 (UTC)

Skin effect of jewelry

What component of cheap jewelry causes a bruised coloring to the skin around where it's worn? What's the chemistry involved? —Preceding unsigned comment added by 67.241.181.205 (talk) 15:15, 21 June 2008 (UTC)

probably non-noble metals eg metals that are not gold/platinum etc.

Nickel and copper are common metals in cheap jewelry - reaction with perspiration (water) in sweat etc causes nickel/copper salts to be produced which are green/blue in colour

eg see http://jewelry.about.com/od/jewelrymetals/a/skin_reactions.htm87.102.86.73 (talk) 15:20, 21 June 2008 (UTC)

Thanks everyone. -- 67.241.181.205 (talk) 15:52, 21 June 2008 (UTC)

Simple Demonstrations to Show the Faultyness of Human Memory?

Hello,

I work as a teacher and I often try and explain to students how poor their memory, but they fail to believe me. Does anyone happen to know any simple (the simpler the better) experiments or demos that can be used to quickly show just how fault human memory can be?

Thanks for any help,

--91.106.26.7 (talk) 15:21, 21 June 2008 (UTC)

A simple example to show the weakness of memory would be to tell the students to remember a three digit number (not an obvious one to remember like 123), then read them(/get them to read) a chapter from an unrelated book. Then ask them to write down the number... I would almost certainly forgotten - though this only shows the brains inability to remember non-essential information.87.102.86.73 (talk) 15:26, 21 June 2008 (UTC)

You could get some people to suddenly come into the classroom and do something unusual (have a big row, say), and then ask the children to answer a few questions about the event. A few simple things like "What were they rowing about?", and then more subtle things like "What colour was X's shirt?", and then, if you want to get really clever, something like "What colour was Y's cardigan?" when Y wasn't wearing a cardigan. After asking them that question and giving them some time to try and "remember", a lot of people will insist they saw Y wearing a cardigan. --Tango (talk) 15:32, 21 June 2008 (UTC)

Yeah, I've had this done in class before. It's a classic psychological experiment, sometimes called the "eyewitness game". --98.217.8.46 (talk) 16:24, 21 June 2008 (UTC)

I seem to remember our teachers doing something like this, where someone burst into assembly, whipped out a banana and appeared to threaten a teacher, then ran away. Possibly in poor taste... Anyway, many students were convinced they'd seen a gun, and none could accurately describe the person. 79.66.20.219 (talk) 20:16, 21 June 2008 (UTC)

This Trick or some variation on it, could be done in real life. APL (talk) 20:08, 21 June 2008 (UTC)

A lot of girls and boys make a big deal of picking what they are going to wear in the morning for school (if there aren't wearing uniforms). Pick a few to come up to the front of the class and blind fold them. Ask them about things they are wearing, like what color shirt. Remembering myself from middle school—I could never remember what I ate for breakfast that day. There's another idea. Simple real-world things like that work better than artificial things. Mac Davis (talk) 23:03, 21 June 2008 (UTC)

Blood types

Moved from WP:HD Can a parent with A+ and the other parent with O+ have a child with A- Thank you for your assistance. —Preceding unsigned comment added by 24.17.150.22 (talk) 20:05, 21 June 2008 (UTC)

The short answer is yes. According to the article on ABO blood group system, a parent with A blood and a parent with O blood will have either A or O children, so as far as the ABO type is concerned, it is possible. The article on the Rhesus blood group system says that the R type is determined by a single gene with 2 alleles. The R+ version is dominant. It is possible that two parents would have one of each allele and the child get the negative one from each parent. This is better described in the article on genotype.Gjmulhol (talk) 20:46, 21 June 2008 (UTC)

sports drinks

Why does Lucozade Sport/Powerade make me want to pee more than say orange squash or water? —Preceding unsigned comment added by 86.144.125.17 (talk) 20:49, 21 June 2008 (UTC)

Those kinds of drinks have high levels of glucose in them. If your body cannot product enough insulin your blood sugar level will be very high, and the kidneys will be unable to diffuse sugar back into the bloodstream after ultrafiltration, meaning you have no choice but to pee it out. JessicaN10248 21:13, 21 June 2008 (UTC)

um that doesn't sound good (not being able to make insulin) but I only drink sports drinks during exercise. —Preceding unsigned comment added by 86.144.125.17 (talk) 21:44, 21 June 2008 (UTC)

I rather doubt that explanation: Lucozade has about 100 calories in 8 oz, and is marketed as "low-cal"; if it's causing osmotic diuresis in someone by virtue of its sugar content, that person is probably diabetic. More likely explanation: Lucozade energy drink contains caffeine, a diuretic. And both Powerade and Lucozade contain more electrolytes than water, which could possibly cause a diuresis. Or: you're drinking the Powerade right before you'd have to pee anyway... - Nunh-huh 02:24, 22 June 2008 (UTC)

alcohol based vinegar

Will all alcohols become vinegar if oxidized by fermentation and if so what organisms will ferment methanol and isopropyl alcohols? 71.100.1.215 (talk) 21:32, 21 June 2008 (UTC)

Heat transfer through different mediums

Right, lets imagine you make a cup of tea, bring it into your room and leave it until it's cold. Now unless I am mistaken heat loves nothing better than to try to spread itself equally. So why is it that when I put my tongue in the air for instance, it doesn't feel as cold as the tea which should have cooled down to around the same temperature? Jimothyjim (talk) 23:39, 21 June 2008 (UTC)

• In fact heat loves nothing better than to try and burn me... -Benbread (talk) 23:41, 21 June 2008 (UTC)
• Water (and tea) has a much higher specific heat capacity than air. So cold tea will transport heat away from your body much more efficiently than air. For very similar reasons, metal usually feels cold, while wood feels warm. --Stephan Schulz (talk) 23:44, 21 June 2008 (UTC)

Indeed. Bring back wooden toilet seats!--Shantavira|^{feed me} 06:58, 22 June 2008 (UTC)

June 22

Is there a name

Not sure if this is science but Is there a name for some one who is interested in sniffing the smell of there own farts (not others) —Preceding unsigned comment added by 79.76.232.210 (talk) 00:23, 22 June 2008 (UTC)

It is a type of olfactophilia or osmolagnia. Mac Davis (talk) 01:25, 22 June 2008 (UTC)

This one's been up before but you'll need the link. Julia Rossi (talk) 01:56, 22 June 2008 (UTC)

Also, Flatulence#Composition of flatus gases. Mac Davis (talk) 02:11, 22 June 2008 (UTC)

My answer is definitely not science, but the name would be Franamax :) I always take a certain pride in my own disgusting emissions, and yes, the flatulence of others is a completely different situation. I have no idea why that is, and it is definitely not sexual in nature, not even close. Maybe it has something to do with looking in the toilet when you're done, whereas looking at other people's products is something really no-one would want to do. I'm not a weirdo, really! I don't think it's all that uncommon to take more interest in one's own emissions than those of others, however none of the links above really describe what I'm thinking of. Franamax (talk) 03:59, 22 June 2008 (UTC)

Psychology website

I Know that Wikipedia doesn't answer questions that deals psychology, but is there any website that can take psychology questions? —Preceding unsigned comment added by 76.64.128.65 (talk) 01:42, 22 June 2008 (UTC)

If it's about Psychology, why not? Try us in a way that avoids asking for a diagnosis, but is about human behaviour, history, careers, models of psychology, applied research, fields, lists and interpreting any of these, you might get lucky. Best, Julia Rossi (talk) 01:53, 22 June 2008 (UTC)

Your question will probably be deleted if you mention there is a real world situation. Physics Forum's medical section is much less strict and there are plenty of real experts there, and in their medical section.[18] Mac Davis (talk) 02:15, 22 June 2008 (UTC)

But questions about psychology shouldn't be discouraged. We just don't want to give you the idea that you should take what we say as medically-valid advice. We are just volunteers, after all! However, now you've got me curious... what's the question? L'Aquatique[review] 06:33, 22 June 2008 (UTC)

Pain

What's the most severe physical pain a human can feel? What about emotional pain? Thanks.