Wikipedia:Administrators' noticeboard/Incidents

Administrators' noticeboard/Incidents
This page is for urgent incidents or chronic, intractable behavioral problems. Before posting: Read these tips for dealing with incivility If the issue concerns a specific user, try discussing it with them on their talk page Try dispute resolution Just want an admin? Contact a recently active admin directly. Be brief and include diffs demonstrating the problem Do not report breaches of personal information on this highly visible page – instead go to Requests for oversight. When starting a discussion about an editor, you must leave a notice on their talk page; pinging is not enough. You may use {{subst:ANI-notice}} ~~~~ to do so. Closed discussions are usually not archived for at least 24 hours. Routine matters might be archived more quickly; complex or controversial matters should remain longer. Sections inactive for 72 hours are archived automatically by Lowercase sigmabot III. Editors unable to edit here are sent to the /Non-autoconfirmed posts subpage. (archives, search)
Start a new discussion

Admin blocked because of questionable use of admin tools; needs review.

I have blocked Arthur Rubin (talk · contribs · blocks · protections · deletions · page moves · rights · RfA) because, upon review, it seems evident that there was objectionable use of admin tools used in a dispute against another editor. This needs to be scrutinized before proceeding, and protecting the encyclopedia is paramount; in addition, I cannot help but notice that this admin has been blocked three times in the past three months for edit warring. — Coren ^(talk) 19:28, 15 March 2008 (UTC) (e/c) Further note for the record, the block is set indefinite but the intent is "until such time as things have been reviewed". There is neither significance nor desire in that unbounded duration. — Coren ^(talk) 19:34, 15 March 2008 (UTC)

Unblock now. Dispute is over, admin tools were used once, block by Coren clearly punitive and inappropriate. No reason to block at this time. Christopher Parham (talk) 19:33, 15 March 2008 (UTC)

By the way "this needs to be scrutinized before proceeding" is a message you should take to heart before indefinitely blocking other admins who are not an immediate threat to anything. Hasty, unhelpful actions like this fan the flames. Christopher Parham (talk) 19:35, 15 March 2008 (UTC)

I was not aware that we got an allocation of tool abuse before something need to be made about it. — Coren ^(talk) 19:44, 15 March 2008 (UTC)

You must be new around here. ➪HiDrNick! 22:15, 15 March 2008 (UTC)

There's no allocation; but if the tool abuse was a one-time issue and has obviously stopped, indefinite blocking can no longer be described as preventative. You were welcome to bring up the action here; it's punitive blocking that is inappropriate. Christopher Parham (talk) 19:46, 15 March 2008 (UTC)

Could one of you two post some evidence please. We are not mindreaders. Theresa Knott | The otter sank 19:36, 15 March 2008 (UTC)

• First question is... If you want review and issued the block, why did you handle the unblock request yourself? Avruch ^T 19:37, 15 March 2008 (UTC)

Coren, declining unblock requests of people blocked by you[1] is highly inappropriate, unless they trolled. MaxSem^{(Han shot first!)} 19:39, 15 March 2008 (UTC)

(e/c) x 8 To both point above; my mistake. I mostly meant to answer the direct question, and I realize I should have done so outside the context of the unblock template. Will fix immediately. — Coren ^(talk) 19:44, 15 March 2008 (UTC)

If the problem is the single deletion of the opt-out page, then I think this block is both hasty and unnecessary, two things which blocks should not be. I think Arthur Rubin should be unblocked immediately to participate in this discussion, since there doesn't appear to be danger of harm from his actions. Avruch ^T 19:42, 15 March 2008 (UTC)

Just checking the edit history of the MfD. User:Carcharoth explained a policy violation there (diff). If I'd thought of that, I would have said it, but I could just see that it's an unconscionable and possibly illegal "contract". Copying, as well as producing the diff.

Quoting from this page version (the text has since been removed): "Keep in mind that when you sign this list, you fully are aware that you lose the right to [...] You also lose the right to complain about the bots themselves or the issues they raise." - here the generalised (not the specific) right to complain is not something that can be signed away. We can have a semantic argument over whether we mean complain or criticise, but Wikipedia is a co-operative and collaborative editing environment. Wording such as this, however "voluntary" it is, does not contribute to a collaborative editing environment, because it restricts the possibilities for discussing the bots and what they do. It promotes an environment where bot operators WP:OWN the bots, and contravenes the third of the m:foundation issues: "the wiki process" (we write articles and change community processes by discussion, not by fiat). To sum up: even in principle, people shouldn't be allowed to sign away their rights to make valid comments and criticisms, of a bot or anything (even if that gets labelled as "complaining"). They certainly shouldn't have such rights held to ransom over an opt-out process. Carcharoth (talk) 18:56, 15 March 2008 (UTC)

Furthermore, although I have separate disputes with beta and the bots ("beta and the bots" would be a good name for a rock band), the number of editors who do not have a dispute with beta is small enough that when I see a clear policy violation by beta, I don't see any reason not to note it.

Furthermore, I'm not the only one who removed the content from Beta's user page. Apparently someone signed it, then read the page and also found it unconscionable. I think it would be wise to notify User:Obuibo Mbstpo as well as User:Carcharoth of the AN/I thread. I don't want to violate WP:CANVASS. It appears that inciting violations of the pillars is not actually a policy violation, but perhaps it should be. — Arthur Rubin (talk) 19:48, 15 March 2008 (UTC)

Arthur Rubin abuse of sysop tools

• Arthur Rubin (talk · contribs · blocks · protections · deletions · page moves · rights · RfA)

I'm in a hurry, work quickly approaching, but here's the basic rundown of issues, hopefully others can expand for me and help explain. I'll clarify anything I may need to when I return from work tonight.

• AR deletes Betacommand's Opt-Out subpage under criteria T2 despite the fact that it's not a template.
• He then states "I deleted it under WP:IAR and WP:CSD#T2. It's not a template, but it does violate policy." He does, however, cite no policy.
• After it was restored, he nominated it for MFD yet still cited no policy.
• I don't have time right now to gather all the relevant diffs, but there are several on various pages where he asserts it's a violation of policy without citing a policy.
• He then nominated zscout370's subpage also as a violation of, I assume, the same policy, but without naming it.
• Then he comments on another user's talk page that "once the image deadline passes, there will be no reason to unblock betacommandbot when it's blocked for screwing up", which to me shows his bias which should have prevented him from using his tools in this matter.
• Here he begins a revert war with Betacommand on Beta's subpage. (Note he's been blocked three times this year for edit-warring.)
• Reverts again here.
• Then he warns Betacommand to stop edit warring or risk being blocked. If he, as an admin, understood the policy for which he's gaining a habit of being blocked for, he'd know it doesn't apply to user space.
• He finally states the policy, but I fail to see what WP:NOT#CENSORED has to do with anything.
• Then he starts with this. I don't even know what he's thinking. You judge.
• Then he states that "I deleted a proposal which would be a clear violation of policy and law". What law? This is ridiculous.
• I issued a final warning.
• And then he drops a template warning on my talk page telling me to assume good faith.

I believe it's time the community reevaluated his access to administrative tools. Lara❤Love 19:40, 15 March 2008 (UTC)

A.R. seems to have a habit of edit warring, but RFC/arbitration would be better places for this discussion. Christopher Parham (talk) 19:42, 15 March 2008 (UTC)

I can see only one bad use of the tools. Maybe this needs an RfC, but there's nothing here meriting desysopping yet. A lot of pointy MfDs, that's all.--Doc^g 19:43, 15 March 2008 (UTC)

I can agree with this summary, and it demands an explanation from Arthur if not more serious proceedings. A block seems totally unnecessary and inflammatory, though. Avruch ^T 19:44, 15 March 2008 (UTC)

I don't have time to build an ArbCase right now, but this is the justification for his well-deserved block. Lara❤Love 19:46, 15 March 2008 (UTC)

Except Arthur's right, Wikipedia should never allow these kinds of agreements to take place (trading one thing for another). Especially trading away ones right to participate in discussion. —Locke Cole • t • c 19:50, 15 March 2008 (UTC)

That he is right or not is immaterial; WP:POINT is bad enough without misuse of the tools. — Coren ^(talk) 19:54, 15 March 2008 (UTC)

WP:POINT? How was this misuse, these kinds of pages simply should not exist per my previous comment. —Locke Cole • t • c 19:56, 15 March 2008 (UTC)

Deleting pages under criteria explicitly disallowed in userspace, citing IAR (you don't cite IAR, you just use it and if you're good enough, it slips under the radar), and threatening to block under a policy that gives exception to userspaces? Will ^(talk) 20:04, 15 March 2008 (UTC)

How is that page good for the encyclopedia? How does it help the encyclopedia? There's probably a policy somewhere that covers these kinds of "contracts" or "agreements", and I doubt it looks highly on them. Even if there's not, do you really need a policy to tell you what common sense should: We should never tolerate agreements to restrict editing unless they're part of dispute resolution (which this clearly isn't). —Locke Cole • t • c 20:08, 15 March 2008 (UTC)

I am unblocking in 3 min, unless someone can tall me what this block is preventing? We can re-block if there's further problems.--Doc^g 19:47, 15 March 2008 (UTC)

(e/c x 11!) I agree with an unblock iff Arthur agrees to lay off the tools until this is resolved. — Coren ^(talk) 19:53, 15 March 2008 (UTC)

I don't believe there is support for requiring that condition. Christopher Parham (talk) 19:55, 15 March 2008 (UTC)

Yep, unblock. Take the case to arbcom if necessary. Addhoc (talk) 19:48, 15 March 2008 (UTC)

Absolutely. Highly inappropriate block. El_C 19:49, 15 March 2008 (UTC)

(ec x8) Looking at the diffs, I agree this should go to LYNCHMOB, if only for a stepping stone to arbitration, as we have no community desysop process. But still, AR's block threat does sound hypocritical, especially as he's had three 3RR this year. Will ^(talk) 19:51, 15 March 2008 (UTC)

You lost me at "agree." El_C 19:53, 15 March 2008 (UTC)

It wasn't a reply to you, it was a reply to Avruch and Glasgow - after the fifth edit conflict I got tired of placing the comment midway in. Will ^(talk) 19:56, 15 March 2008 (UTC)

I agree that AR's block threat was wr9ong and had he actually blocked anyone then I would be the first in line in asking the AC to desysop him. But he didn't. Theresa Knott | The otter sank 19:55, 15 March 2008 (UTC)

Unblocked to participate in discussion. MaxSem^{(Han shot first!)} 19:57, 15 March 2008 (UTC)

• Aye, unblock and use our processes. Deleting that article as T2 was a poor decision (I restored the history after Betacommand re-created it) but probably not worth a block at this time. Black Kite 19:56, 15 March 2008 (UTC)

Anyway, he's unblocked now. Christopher Parham (talk) 19:57, 15 March 2008 (UTC)

I think the issues of the Betacommandbot/Optout page may be Civility and AGF, I must admit I find the bolded entry somewhat confrontational and not particularly conducive to collaborative editing. Furthermore, AR placing a note warning of blocking for 3RR didn't necessarily mean he was goingto do the blocking, just that 4 reverts places anyone at risk. Those would be my AGF takes on it. I do agree that 3 blocks recently is somewhat of a concern.

PS: I have not been too involved with the betacommand issues. Do others think the stern approach on the optout page is necessary?Cheers, Casliber (talk · contribs) 19:59, 15 March 2008 (UTC)

Personally I think the first bolded sentence is fair enough but so obvious that it's unecessary. The second is clearly wrong and totally ignorable. Theresa Knott | The otter sank 20:16, 15 March 2008 (UTC)

We need to specify that it's clearly policy that it's ignorable. I think it's clear, but Lara apparently doesn't believe it's ignorable, and beta clearly doesn't believe it's ignorable, or he would have agreed to the strikeout. I apologize for being baited by beta. I should know better, by now. — Arthur Rubin (talk) 21:18, 15 March 2008 (UTC)

And, for the record, I didn't threaten to block anyone. I stated that anyone who agreed to the condition should be blocked. As an involved admin, I wouldn't do the blocking, although I would probably withdraw from Wikipedia if the condition agreed to as a policy. — Arthur Rubin (talk) 22:20, 15 March 2008 (UTC)

The deletion and the block relate to issues that may be accepted at an ongoing arbitration request so that can be left aside for now, though I will be suggesting that the main parties involved here that are not already parties to that request, ie. User:Arthur Rubin and User:Coren, be added to the request. Arthur is right, though, that there does need to be a clear statement somewhere in policy that informal gag rules and trade-offs and divisive interpersonal contracts (however voluntary they are) are extremely destructive to a spirit of collaboration. I did struggle to find a policy where this sort of behaviour is disallowed, and my arguments about about WP:OWN and the third foundation principle were rather weak, but we can't expect policy to explicitly cover everything. Carcharoth (talk) 22:59, 15 March 2008 (UTC)

Seems like a case of WP:BEANS in action to me. We don't have a policy on it because it's a pretty obscure thing to do. Perhaps we need more of a catch-all policy against behavior that goes against the spirit or goals of Wikipedia to cite in cases like this. --Infophile ^{(Talk) (Contribs)} 03:42, 16 March 2008 (UTC)

Whew. Long day at work. Good times. So, here's my take. Considering he deleted a page under an invalid criteria and cited Ignore All Rules, then made two pointy MFDs, then threatened to block Beta (or, rather, have him blocked) for an offense that not only has he been blocked three times in two or so months, but for an offense that doesn't even apply to the page Arthur was edit-warring with Beta on... Beta's own subpage. Then, as if that weren't enough, he dropped a template warning on my talk page. Seriously? Telling me to look at the Welcome page so that I, an admin with over 18,000 edits, can learn how to contribute to the encyclopedia. The rest was tldr, but the point is that admins don't drop template warnings on other admin's talk pages. Clearly, in my opinion, he was losing his grasp on wikireality and needed a few hours to chill out and realize what he was doing. He's been with the 'pedia for quite some time, but 2008 seems to be going downhill for him. Lara❤Love 03:52, 16 March 2008 (UTC)

The template on your page seemed like an attempt to be funny and informative. That said, the block was inappropriate as there was no immediate issue, and any long-term problems with Arthur belong at RFC or arbitration. Christopher Parham (talk) 04:05, 16 March 2008 (UTC)

Betacommand isn't an admin. And Betacommand hadn't just gotten a final warning telling him to stop using his admin tools in this situation, including warning users, considering his abuse of the tools. Lara❤Love 05:38, 16 March 2008 (UTC)

Actually, beta had gotten multiple final warnings about various things, including misuse of rollback, which used to be an admin tool. But that's not entirely relevant. Then again, I haven't had a valid final warning for misuse of admin tools, either. — Arthur Rubin (talk) 09:00, 16 March 2008 (UTC)

Lara, do you see several people saying that the block of Arthur Rubin was inappropriate? Maybe you could consider listening to them? I'm not going to defend what Arthur Rubin did, as that is not how I would have handled things, but Arthur is discussing things and talking to you. Calling for him to be blocked or desysopped is an over-reaction. I will say again that if you and Coren disagree over that, then you, Coren and Arthur Rubin need to take this to arbitration as a "dispute between admins". Unless you want to try and resolve this before it reaches that stage? Pre-emptive blocks of admins because someone thinks they've abused their tools is not how things are done here. In any case, the last time I checked, blocking an admin doesn't stop them using their tools (of course, in practice it does stop them using their tools as using their tools through a block is considered a reason for desysopping). Carcharoth (talk) 10:30, 16 March 2008 (UTC)

As I've stated on my talk page in a different context, what I saw was (a) an admin tool (delete) being used in furtherance of a content dispute (b) continuing dispute, and (c) threat that an admin tool (block) will be used. What clearer definition of preventative block would you prefer? — Coren ^(talk) 14:35, 16 March 2008 (UTC)

Arthur, you'll note that Beta no longer has rollback privileges, so if you want to use that as a comparison, are you saying you agree it's time to take your admin privileges? I doubt it. As far as the warning goes, apparently it was valid, because you were subsequently blocked for ignoring it. As Coren pointed out above, you abused your tools, which appears to me is something the community agrees on. So, Carcharoth, while the community does not agree that Arthur should have been blocked, it is something I obviously endorse considering I posted the justification for it above. While blocking admins doesn't technically stop them from doing anything, considering they can unblock themselves, it's understood that if you're blocked, you treat it as such and go through the same venue as everyone else, just as Arthur did. So (a) deletion of page under invalid criteria citing IAR and no policy, (b) two pointy MfDs, (c) threat to block Beta for 3RR (something Arthur has been blocked for three times this year) on his own subpage, which is not a blockable offense, (d) ignored warning. It was my opinion, which I continue to stand by, that he needed to be blocked at that point while it was brought to the community's attention because I believe his block log and actions during this dispute have shown him to lack the necessary judgment and restraint expected of an admin. As Coren noted, a clear example of a preventative block. Lara❤Love 20:43, 16 March 2008 (UTC)

For what it's worth, there is clearly nothing WP:POINTy about the MfDs. Beta has shown no interest in discussion, so it seems to me to be WP:POINTy to attempt to discuss it before making the strikeout edit and then the MfD. The delete may have been inappropriate, but it still seems to be that allowing gag rules is contrary to the principles underlying Wikipedia. As for the second MfD, I should have initiated discussion first, but I thought fairness required that I open MfDs on all copies of the material, and I withdrew the MfD and requested others withdraw their delete !vote as soon as I became aware that ZScout was open to discussion. I'll wait to comment in the RFAr until a few more points are brought up, so I don't use my entire space repeating points made by others. — Arthur Rubin (talk) 01:18, 17 March 2008 (UTC)

I'm sorry, Arthur, but I find both MfDs to be pointy. Mostly because they cite no policy, and also considering you cited IAR in your rogue deletion prior to the first one. Betacommand is actually quite receptive to discussions presented to him in a civil manner. Straight up deleting his page as you did, then turning to MfD was not at all the constructive way to go. Lara❤Love 02:21, 17 March 2008 (UTC)

"Betacommand is actually quite receptive to discussions..." is clearly false, but could we defer this until RfAr β2 is resolved. Even though I think it was opened prematurely, it is open, and such discussions should only be in one place. — Arthur Rubin (talk) 14:39, 18 March 2008 (UTC)

John254 has pointed out the following at the arbitration case. Wikipedia:BLOCK#Inappropriate administrative actions states: "Blocks may not be used to sanction administrators for the abuse of administrative privileges." - while the wording (which was added by John254 around a month ago) could do with some work, this is, I believe, an already generally accepted principle. Preventative blocks may seem fine, as long as there is a clear danger, but most times people will disagree whether there was a clear danger or not. In general, discussion should be used for a lot longer than was the case here, and then go to arbitration. Blocking between admins can all too easily escalate into wheel-warring. This wasn't the case here, but please let's not risk that in future. Carcharoth (talk) 06:42, 17 March 2008 (UTC)

Where is the discussion for this change? And, as an aside, why is he posting as a party despite not being listed as one? Lara❤Love 13:09, 17 March 2008 (UTC)

I noticed this change when it happened and I support it, especially in light of Archtransit's block of me. A change does not need to be discussed. If nobody objects, it stands. Jehochman ^Talk 13:15, 17 March 2008 (UTC)

I agree with it as well. Admins and editors are bound by the same rules, there isn't a special set of rules and offences for admins. Orderinchaos 06:55, 18 March 2008 (UTC)

Dbachmann

The following was left on my talk page by a user in need of some help. As he says, I don't really want to get involved. I stepped in regarding a naming convention (see Wikipedia talk:Naming conventions (Syriac)‎) but I'm really trying to keep my distance from the overall issue. I'm just posting this here because I don't think Chaldean is aware of this page.

I know you don't want to get involved, but you have to, since the only admin involved is abusing his powers. He is deleting masive amount of source information [[2]] when it is clearly not off-topic. When I ask sources for his big changes, he states he owns the page [[3]] and is not obligated to bring sources to the table. I try to negotiate with, try to work with him, but he continues to put me down [[4]]. It would be one thing if this was a regular user talking this way, but this is an admin. He is moving pages without discussion [[5]] and the madness goes on. The thing I'm must troubled with is that he doesn't want to negotiate. I have been verbially abused so many times by this guy in the past week, for simply asking sources for his edits. And now he is ready to put his master-plan together by moving Assyrian people page, despite the huge opposition to it in the talk page. He doesn't care, his gameplan is to wait until the opposition has died down and then suggest to move it again. You don't go to Greek people page and suggest to move it to Greek/Hellenics people. This guy has a complete monopoly on Assyrian related pages. Chaldean (talk) 13:56, 15 March 2008 (UTC)

I know the editor who wrote this has some POV issues of his own, but I also think Dbachmann is a little over-involved in this topic and is getting kind of aggressive, as some of his edits show. A few more eyes on the matter might be useful. Thanks, everyone. Kafziel ^{Complaint Department} 06:46, 16 March 2008 (UTC)

Hmm. Yes. I don't have time myself, but this does look like it needs attention. Fast. For the record, Dbachmann is not using his tools (unless he is moving over redirects), so no abuse I can see. Just a content dispute that may be escalating. Carcharoth (talk) 09:49, 16 March 2008 (UTC)

Ri-ight. Lets examine some of the diffs, shall we? "Deleting masive amount of source information" is usually the first thing one has to do on discovering a little walled garden where enthusiasts or fringe nationalists or mysticists of some stripe or another have set up a shrine to something. In this case, Dbachmann removed a long disgression about the stone age from an article about modern names. "Ownership" - I read Dbachmann's edit summary as indicating that he knows where the page has to go, but he's being swarmed with what he assumes are extreme nationalists; I personally can't disagree. (User:Chaldean's username is a bit of a giveaway.) In the same summary Dbachmann pleads for some admin attention. So I suppose this section is useful in a way after all.

"Moving pages" - as Carcaroth has pointed, out, its over redirects. More to the point, he had a perfectly valid reason: he moved the page "X in the USA" to X's official group name in the US census.

All-in-all, business as usual. Dbachmann's trying to apply our core policies to another little-visited corner of the project, that's all. His talkpage shows him being relatively restrained with the ensuing commotion. If anyone's interested, I'm sure he'd be happy with some help. Relata refero (talk) 10:17, 16 March 2008 (UTC)

I am a little concerned with what I perceive as a growing attitude to consider editors actively trying to implement Wikipedia core policies as "over-involved". Indeed this needs more eyes. I have been advertising for more eyes. I will be grateful if it isn't left entirely to me to look after WP's coverage of "various ethnic groups and nationalisms". It is a deeply flawed attitude to think that the "admin caste" is here for admonishing people, while matters of content should be left to pov pushers of various convictions. I can't believe I am "old school" for actually trying to understand the issues under dispute and trying to fix them within policy, instead of an idiotic approach of "hur, hur, can you believe, some people are arguing over content (as opposed to procedure and red tape). Let's slap them all on the wrist a little bit and go back to Wikipedia-administring on IRC". dab (𒁳) 12:35, 16 March 2008 (UTC)

You can spend the rest of your life on IRC and you'll never see me there. I resent the implication that I'm a red tape admin; anyone here who knows me - love me or hate me - knows that isn't true. I know I stepped on your toes a bit with your guideline proposal, but that was because you were abusing it. I backed up my reasons with policy (just as you're doing here) but that doesn't mean I'm any more a slave to procedure than you are.

I'm curious, though, as to which "core policies" were implemented by this comment or this edit summary. That's the sort of thing that tells me you may be "over-involved". Kafziel ^{Complaint Department} 15:58, 16 March 2008 (UTC)

That's the sort of thing that tells me only that someone has been over-taxing even Dbachmann's abundant patience. It happens, you know. Fut.Perf. ☼ 17:00, 16 March 2008 (UTC)

It looks like Dbachmann has been violating our core policy of WP:CONDESCENSION again. Wait, that's a red link. Never mind... John Carter (talk) 16:30, 17 March 2008 (UTC)

Give me a break. If a new user had said that stuff, he'd be warned for incivility immediately. It should be more so - not less - when it's an admin. Kafziel ^{Complaint Department} 17:07, 17 March 2008 (UTC)

Doesn't look that way to me, and i'm NOT one of Dbachmann's biggest fans. I don't always agree with him, but he's out there in the middle of lots of serious POV pushing messes, and usually TRIES to go towards NPOV, though i'm not sure his NPOV matches everyone elses. That he regularly gets hit here for being a wide angle POV pusher is absurd, and that he gets tired of it at times is understandable. I don't see much wrong beyond the condescending tone, which isn't incivil, just blunt. and Wikipedia needs more blunt talk and less obsequious patter. In fact, we just had a thread about how being TOO tiptoe-y can be disruptive. ThuranX (talk) 20:35, 17 March 2008 (UTC)

Not uncivil, just blunt? It's deplorable conduct, totally unfit for this wiki. No personal attacks is policy. Further up this board an IP just got blocked for saying "You must be bloody awful to work with." Admins would do well to apply such blocks to their own caste, or not at all. Your double standards on civility bring the project into disrepute, and cause no end of ill feeling. The tone and import of Fut and Carter's responses make it difficult to dismiss perceptions such as point two here. 86.44.6.14 (talk) 23:24, 18 March 2008 (UTC)

Speaking as someone who's helped out far too little at the fringe noticeboard, it looks to me like Dbachmann is indeed showing signs that he is perhaps overworked, and only a human after all. Shall we, then, provide him with a cigarette, a blindfold, and a sunny bit of wall to stand in front of? I would hope not. Sheffield Steel^talk_stalk 21:15, 17 March 2008 (UTC)

Who was I kidding. I thought I was done and made my final wiki edit. After all the verbal abuse that I have recieved from dab, I thought it really wasn't worth it anymore. Saying the things dab has said against a person that is pushing POV and is simply wrong would be one thing. But please I ask you to show me what I have done or said that made me deserve the treatment that I got. I wasn't the one that removed massive amount of sourced information, it was him. He creates his own "guideline"[6] and then try to use it to win arguments elsewhere[7]. I was simply asking (over and over again) for sources from dab. The answer that I kept on getting was verbal abuse with the declaration of me not having good enough English skills to work with him. Funny that I have been working on Wiki for 2 years contributed over 10,000 edits and not one other user has accused me of having bad English langauge skills. Chaldean (talk) 15:50, 18 March 2008 (UTC)

I try to work with dab and let me give you an example of what I get from him whenever I do so;

Chaldean - - there are other ternomologies for every single ethnic group. Show me another ethnic group page on Wikipedia that uses /. By your idiology, we should move the Greek people page to Greek/Hellenic people. Again, you continue to create more problems then actually slove them. I awknolged there is an issue and that is why we created the naming disupte page. But to spill this issue on all these other pages is making things ever worse. [8]

Dab's answer - except the Greeks don't make fools of themselves in the Greek/Hellenic matter the way you people do. [9]

How is an admin to talk in his tone and let it be ok? Do rules still apply on admins? Chaldean (talk) 19:40, 18 March 2008 (UTC)

Michael & Hephaestos, the last chapter

Not the most pressing problem Wikipedia has, but this has gone on for way, way, way too long.

Once, long ago, there was a vandal fighter by the name of Hephaestos. This was back at the dawn of Wikipedia, before most of you had even heard of Wikipedia. In his time, he was the preeminent vandal fighter, a model that such legends like Zoe & RickK modelled themselves on. Then he encountered a problem user by the name of Michael, who in the end drove him from the project.

In any other story, that would be the end; this has been the end of the story of many vandal-fighters. But I've since discovered that this saga has continued, below the radar.

Even before Hephaestos left, it was clear that Michael could be obsessed with certain things. Like a punk band called Crass -- & with Hephaestos. Michael created countless sock puppets to harass Hephaestos -- & since Hephaestos ended his time with Wikipedia, he has used these to vandalize Hephaestos' user & talk pages. Have a look at the history of those pages. So I decided enough is enough: no one needs to edit the page of a long-departed user, so I sprotected indefinitely the user page.

If this doesn't put an end to this obsessive behavior, I will then protect both. The saga is now over; Hephaestos deserves to exercise his right to vanish. It's time to start enforcing his right. -- llywrch (talk) 05:09, 17 March 2008 (UTC)

Sounds reasonable. I remember dealing with a bunch of those socks, back in the day. Not sure if this will bring a complete close, but it may help a bit. – Luna Santin (talk) 05:15, 17 March 2008 (UTC)

I'm surprised it hasn't been fully protected already. We often do that with userpages of retired users, even if they aren't a vandalism target. Hut 8.5 07:45, 17 March 2008 (UTC)

I'm fairly sure everything is protected. I know I did such to the talk page last year.—Ryūlóng (竜龙) 08:07, 17 March 2008 (UTC)

C.Fred -- of whom I never have heard -- protected the user page last July, but that protection expired this January. You did protect the talk page a week ago, after BetaCommand -- for reasons I cannot imagine -- unprotected it in January 2007. What's-his-name apparently discovered the protection of the user page had expired this month & resumed his attacks. -- llywrch (talk) 02:22, 18 March 2008 (UTC)

(ec x 2) I'm more than familiar with dealing with the vandal involved and, yeah, he's still active. Please feel free to indef protect both user and talk pages. I certainly endorse your actions here. If Hephaestos needs his account re-activated, he should be able to contact someone via email who can then do the necessary - Alison ^❤ 08:08, 17 March 2008 (UTC)

IIRC it used to be protected, and we used to get the socks posting lots of unprotect requests, make sure the protect message is clear and keep an eye on it for the almost inevitable new admin honouring such a request. --81.104.39.63 (talk) 19:28, 17 March 2008 (UTC)

I've gone ahead and indef full-protected his userpage (I see Ryulong did the talk page). Hut 8.5 07:36, 18 March 2008 (UTC)

Allegations of State terrorism by critics of the United States

Page move? --Goon Noot (talk) 12:16, 17 March 2008 (UTC)

I can find no discussion on a proposed page move at either the talkpage of the article or Requested Moves. THe moving editor's contribs (see also DHeyward (talk · contribs)) show no participation in such a debate, and this is the second time the editor has moved this article to a different title (per his move log, see 12 July 2007). Unless someone has an overwhelming argument for keeping the new title, either during a discussion on the matter or because it's better in some way I'm not seeing, I'll move it back. UltraExactZZ ^Claims ~ Evidence 12:30, 17 March 2008 (UTC)

• MOved back. There was no discussion I can see, and this is a high traffic article so discussion is definitely needed before a move to a title which embodies a value judgement. Guy (Help!) 14:23, 17 March 2008 (UTC)

If moved again without consensus, perhaps it should be move-protected until such a consensus is reached. I'm not a fan of protecting an article in this manner but, given that this user has already moved the article twice without any involvement in the article, a third move is likely. - 52 Pickup (deal) 14:28, 17 March 2008 (UTC)

The issue of renaming this article has been discussed at length, as shown in the talk page archives here. Note that that archive is at the wrong title, but I'm not going to move it back until this settles down. My concern was that, whatever the consensus for or against the move, the article was moved and has been at a title for almost two months. If indeed consensus was strongly against this title, then someone would have moved it back sooner. The proper course would be to post on the talk page, asking about moving it back and citing the weak or missing consensus to move in the first place. Given that so much discussion had taken place about this article's title, it's unreasonable to move it without at least asking about it first. JzG was exactly right to move the article back - had I not been sidetracked, I would have done so myself. UltraExactZZ ^Claims ~ Evidence 16:44, 17 March 2008 (UTC)

The article was moved to it's current title unilaterally and against consensus anyways. The only reason it wasn't moved back to "Allegations of state terrorim" etc etc is because it's not possible to move to an existing page. Jtrainor (talk) 02:08, 18 March 2008 (UTC)

What a mess...that article is hopeless.--MONGO 07:36, 18 March 2008 (UTC)

Good luck getting it AfDed :x The time I tried a while back, a zillion people came out of the woodwork and accused me of all kinds of garbage. Jtrainor (talk) 21:49, 18 March 2008 (UTC)

I moved it per WP:BRD. My previous move was to restore "allegations" in the title when it was removed without consensus previously. The current title is the result of a non-consensus move. The article is unsalvageable and should be deleted. At hte very minimum, the title should be rolled back to include "allegations". --DHeyward (talk) 07:28, 19 March 2008 (UTC)

Pure Reason Revolution/Jon Courtney/User:Justpassinby

This is a complicated case involving vandalism, possible sockpuppetry and WP:BLP issues, so I wasn't certain where to report it and came here instead! Justpassinby has a long history of tendentious editing of Pure Reason Revolution, including past vandalism (see User_talk:Justpassinby) and a past sockpuppetry incident. The sockpuppetry case included a possible sockpuppet account of User:Joncourtney. Jon Courtney is the name of the lead guy in the band Pure Reason Revolution, but the one edit made back then was insulting towards the band and seemed to be by Justpassinby. Subsequently, Jon Courtney was created as an article. Justpassinby tried a speedy delete, which was rejected, then an AfD that failed (narrowly). During that time, he made claims of plagiarism against Courtney but then agreed to withdraw these. Since then, Justpassinby vandalised the article.[10] There was then one edit by the Joncourtney user[11] — I presume this was Justpassinby. Of course, if it really was Jon Courtney, then there are conflict of interest issues. Also see discussion on WP:BLP noticeboard. Basically, help! This all needs investigating, but I also think some quick action could be taken by admins. Thanks. Bondegezou (talk) 15:12, 17 March 2008 (UTC)

Further dubious editing continues... I've also reported possible sockpuppetry at Wikipedia:Suspected sock puppets/Justpassinby (2nd). Bondegezou (talk) 17:32, 18 March 2008 (UTC)

Image:Techcrunch-transparent-photshop.gif

Resolved

 – Uncopyrighted, trademarked-only logos do not fall under WP:NFCC. — Edokter • Talk • 16:26, 17 March 2008 (UTC)

Is there a way to get User:BJBot to use some kind of exception tag or whitelist entry for fair-use images that are exceptions to the rule that fair-use images must be used in at least one article. Discussion at User talk:BJBot#Image:Techcrunch-transparent-photshop.gif is not occurring soon enough, because the bot keeps adding the template. Is there some kind of "hang-on" tag to use so at least some discussion can occur without the bot continuing to add the template?

This is important also because User talk:BJBot sections get archived if no discussion occurs in 3 days in those sections.

Here is the last version of the image with the template: [12]

This image meets Wikipedia:Non-free content criteria exemptions. See the image page for the reasoning. --Timeshifter (talk) 14:49, 17 March 2008 (UTC)

Hang on a minute. The fair use reason is that it doesn't render properly because it is a transparent gif? I don't understand. Why do we need to use a company logo for that? Theresa Knott | The otter sank 15:19, 17 March 2008 (UTC)

Hardly matters, since {{PD-font}} obviously applies. —Random832 15:22, 17 March 2008 (UTC)

Doesn't look obvious to me. This is a company logo. Presumably trademarked. I removed the resolved tag. Let let others take a look. Theresa Knott | The otter sank 15:32, 17 March 2008 (UTC)

The Coca-cola logo, which does not violate NFCC to use here (and good luck getting it deleted from commons)

Trademark has nothing to do with copyright. Image:Coca-Cola logo.svg is both a lot more trademarked, and a lot more public-domain, than the image we're discussing. —Random832 15:43, 17 March 2008 (UTC)

Indeed. Trademark is not considered in WP:NFCC so it's restriction do not apply. Marking as resolved again. — Edokter • Talk • 16:26, 17 March 2008 (UTC)

Theresa, I have argued on Commons and elsewhere that our focus on copyright in deciding whether an image is free is unhelpful and that other commercial rights such as trademarks need to also be considered as they represent a considerable restriction on the uses images can be put to. That argument has not seen much success, it seems that "free" in the Wikimedia context has been widely interpreted to mean "not subject to copyright" not "not subject to any commercial right which may limit the legally permissible uses of the image". As well as trademarks, we ignore other rights - like that of museums and galleries to disallow photography. The works being photographed may be out of copyright but those that own the collections have a commercial interest in limiting photography - to sell their own photographs, postcards etc. Such rights have been successfully vindicated in many jurisdictions, but again isn't something that we seem to factor in when describing an image as "free". WjBscribe 16:30, 17 March 2008 (UTC)

(unindent) I don't understand the technicalities too well, but thanks for keeping the image. --Timeshifter (talk) 17:31, 17 March 2008 (UTC)

The problem is that, unlike copyright, trademark is heavily context-dependent. The H&R Block logo is simply a green square. Any green square, if used in the context of promoting a tax preparation company, would be a trademark infringement. Should we ban all images of green squares from Wikipedia? Of course not. There are words that are trademarked - many of these are used as article titles. —Random832 18:03, 17 March 2008 (UTC)

This is confusing. I've seen images marked {{PD-textlogo}} and {{trademark}} get removed from an article as unjustifiable fair use, then deleted as orphaned fair use. Are logos subject to NFCC or not? Gimmetrow 21:51, 17 March 2008 (UTC)

I think the points WJBscribe raises are interesting. The Coca-Cola logo we count as free, even by Commons' definition of free. But, imagine what would happen if you tried to use it commercially. It's not really free. --Hammersoft (talk) 17:49, 18 March 2008 (UTC)

Admin assistance needed FOR admin assistance in Articles_for_deletion/List_of_hooligan_firms

Man, I never thought I'd have to file one of these, but:

On March 13, I submitted "List of hooligan firms" for deletion via AFD
[13] as it violated WP:NOT#DIR. Yes a few of the users involved with that particular article & group protested. That's normal.
March 16, I decided in the name of WP:BOLD to simply close the thing, considering it was a list and therefore a violation of policy:
dif of course, it got removed a few times, which I expected:
[14]
[15]
[16]
At that point I gave up for the evening and came back the next morning. An admin Rambling Man had been called in and he and I spoke about the revert, very civiliy. However, he decided to "shut the door" as it were with this message [17] The users contesting the deletion as well as the admin are all members of a group that would have contributed to this list, as such, his involvement is COI. Additionally, he has stated that he will allow a violation of WP:NOT#DIR by allowing this list to be retained, even go so far as to actually ask if this is a list. I'm specifically asking that his conduct be examined as I belive that it constitutes COI, and that his involvement in the aforementioned AFD is not allowed. It's still standing so a DRV wouldn't be appropriate at this time.

Kosh Sez We don't need no stinkin FUR!! 18:25, 17 March 2008 (UTC)

Kosh, you are specifically not allowed to close AfDs for any reason that you are the nominator for. Had you not done that, I don't believe there would be any problem here. Rambling Man has done absolutely nothing wrong and has been way more civil than other editors/admins would have been in the same situation. He was friendly, to the point, and corrected where you were obviously in the wrong. What action do you want here? Because, so far, all you've done is draw attention to yourself. I would recommend a "back away slowly and quietly" approach...but that's just me. Keeper | 76 | Disclaimer 18:31, 17 March 2008 (UTC)

So you closed an AFD you started... after three days... when you're not an admin... accused others of vandalism for reverting it... threatened anybody who stayed in your path... edit-warred to restore your bogus close... and then decided step into the lion's den here? You should just fall back and count your graces that you didn't run into a block-happy admin. east.718 at 18:34, March 17, 2008

Yeah. What he said. And said better than me. Keeper | 76 | Disclaimer 18:36, 17 March 2008 (UTC)

Indeed. That article is actually a drama, vandalism and sockpuppet magnet (I've got it watchlisted, and have had to make a number of reverts and blocks because of it recently), but it's undoubtedly a valid article. The OP would be well-advised to read up on deletion policy before submitting another AfD. Black Kite 19:07, 17 March 2008 (UTC)

SO this is ok:

Sorry, I'm confused, if we disallow lists, why do we have so many featured lists? You raised the AFD to make a point. Read the text, " the deletion process proceeds based on Wikipedia community consensus" - not on your single decision that this is "just a list" which fails to meet policy. You're the only editor who believes that this article does violate policy. You do not have the consensus, the article will be kept. Simple as that. And, while we're here, consensus can overrule policy, that's how policies evolve and improve. The Rambling Man (talk) 17:12, 17 March 2008 (UTC)

I don't think so. I was accused of WP:POINT, despite my explaining twice that this was not a WP:POINT. Let's also not overlook the fact that he;s stating "Consensus over-rides policy" which has been proven false. Policy CAN be changed by consensus, but that's seperate to this AFD. While we're at it, check WP:NOT#DIR and note that it states that lists are one of things Wikipedia is not (outside of the listed exceptions). OH, and I love the part where you said I edit warred. I reverted vandalism to that AFD 3 times. I closed it per WP:BOLD WP:IAR with a note showing only that. As far as the "revert and be reported" That's not threating, it's a statemnt of fact, that why we have WP:3RR. Now, AGF and have a nice cup of tea (to quote an admin I know :) ) Kosh Sez We don't need no stinkin FUR!! 19:50, 17 March 2008 (UTC)

Regardless of how you think the AfD should have been closed, you shouldn't have closed it. You were the nominator. Everyone knows what you think. By closing it, you have pushed your own POV, nothing more, nothing less. Rightuflly reverted. If not by Rambling Man, by any other admin or even non-admin that would have stumbled into it. I strongly suggest you move on. Move on. Keeper | 76 | Disclaimer 19:54, 17 March 2008 (UTC)

IAR only works when you're right. Also, I'd suggest on reading up on our policies about conflicts of interest, edit-warring, and what vandalism is and isn't. Throwing around acronyms without actually knowing what they mean isn't really the best way to get your point across. east.718 at 20:07, March 17, 2008

I'm sorry but I have to comment here. KoshVorlon has pointed out that mention was made (by me) that the AfD came across as if it was being done to make a point, which with respect it did. That is exactly how it looked and still looks. However, bear in mind that Kosh has also used an edit summary to make an accusation of sockpuppetry without any evidence, and has npot replied when asked to back up his claim; he has also accued me of having a "conflict of interest" without it would seem having a clear understanding of what WP:COI actually involves. I, like BlackKite, keep the article in my watchlist for the very same reasons as BlackKite, to root out POV pushing & vandalism and to also ensure it is correctly sourced, as it is a topic where there are a number of sources that are not reliable, and that can attract strong POV. The topic matter is not the most pleasant, but that is irrelevant to whether it should be on wikipedia. How exactly my comments on the AfD and my "keep" qualify as COI, I really don't know. Kosh has also accused a number of others, again including myself, of being in "a group" and claimed that therefore all our comments are irrelevant because we all apparently have a conflict of interest. This whole thing has been blown up totally out of proportion and seems as if it is being used to push Kosh's views about Lists on wikipedia. I've no idea how many "lists" there are on wikipedia but I know that there are good articles and guidelines which specify how lists should be formatted etc. There is also this list, Wikipedia:List of Wikipedians by number of edits. If all the Lists on wikipedia were put forward for AfD we would be here for a very long time.♦Tangerines♦·Talk 21:15, 17 March 2008 (UTC)

Kosh, WP:IAR only applies, not when only you're "right" as pointed out by someone above, but when the absence of your action seems to the undermine the spirit of what Wikipedia is about. In other words, you ignore all rules when a procedure prevents wikipedia from being what it's supposed to be. You went against clear consensus and closed (as delete mind you - that's a no no) an AfD that you were the nominator of. I believe this is pretty cut and dry and extend to all those people involved in the discussion to consider the matter closed. Kosh, if you continue to badger the point, you will only succeed and illuminating yourself in the bad light. Wisdom89 _{(T / ^C)} 23:28, 17 March 2008 (UTC)

As one of the contributors to the discussion at Wikipedia:Articles for deletion/List of hooligan firms, and one of those who reverted the editor's unfortunate closure of his own nomination, I have to say that I see nothing wrong with the consensus at that AfD, and that it seems to pretty clearly say Keep, given that lists are allowed in Wikipedia. I mention the AfD because it is the core reason we are here today. I was on the point of posting here myself in relation to the accusing editor, but he has saved me the effort. His over-bearing need to have this list deleted has clouded his objectivity, to the point where he will use all ends to achieve it, and his conduct now borders on uncivil. Myself and fellow editors are struggling to maintain our cool and desist from sinking to insults. I am putting this in as strong a way as possible without being impolite. As far as I personally am concerned, the editor must follow the laid-down guidelines and policies put in place at AfD (and elsewhere, as this ANI is frivolous to the extreme), or risk removal from our community, for whatever length of time. Unlike the editor, I am unable to decide one way or the other on that, because I don't have the tools (I have pointed out to him his lack of the same for deleting articles he takes a dislike to). I am hoping, however, that he, as a fellow editor with much to offer us, will step back and let the AfD process take its course, then return to making solid contributions to the encyclopedia. Thanks. Ref ^(chew)(do) 11:03, 18 March 2008 (UTC)

Ref, say WHAT?!?!?!? Dude, why don't you read Wikipedia is not a list.

It contradicts what you just said. Bottom line here, the "article" is a list. That's just a fact. Wikipedia isn't for list, that's a fact, per WP:NOT#DIR. Yes, I closed it per BOLD and IAR and contrary to popular opinion, I was right. Policy states it as such. If I create a page about an actor and I have it referenced to the gills, but it's defaming him, it doesn't matter how many people say "KEEP". I'm violating BLP and therefore, by policy alone the article has to be deleted, consensus or not. GO back and read policy then tell me Wikipedia is for list. I'll leave the your list be. Kosh Sez We don't need no stinkin FUR!! 12:19, 18 March 2008 (UTC)

forget the list itself, you were simply WRONG to close the AFD, numerous people have told you this whatever you'd like to claim about IAR and BOLD. You can argue the toss about this all day but nobody agrees. I'll leave the your list be. this sounds like a threat to me? what is you plan to do? run another AFD? blank the page? --Fredrick day 12:23, 18 March 2008 (UTC)

Sorry, no can do. If it's a list then it fails policy. Fail policy and your "article" , list whatever, gets deleted, that's just fact. By the way, "I'll leave the list be" sounds like a threat? No way ! It means just what it says, I'll leave it alone. I won't touch it. No further action. Kosh Sez We don't need no stinkin FUR!! 12:38, 18 March 2008 (UTC)

Kosh, what part of the fact that Wikipedia allows lists do you not understand? You are seriously misreading what WP:NOT#DIR says. What it actually says is "Lists or repositories of loosely associated topics such as quotations, aphorisms, or persons (real or fictional)." It goes on to say "Of course, there is nothing wrong with having lists...". Simply being a list does not make something eligible for deletion. You also may not ever close a deletion discussion you initiated unless you have decided to withdraw the nomination, and even then it may not be appropriate if there are several editors who believe deletion is the correct course of action. Simply put, you are wrong on all accounts. - auburnpilot talk 14:52, 18 March 2008 (UTC)

Comment - "I'll leave the your list be" denotes that he still believes that I, or my fellow consensors at the particular AfD which stoked him up, actually seriously contribute to, or maybe even own, the article List of hooligan firms. For my part, I simply happened across this AfD and decided to vote as a one-off, which I do regularly on a variety of topics, and as I expect to be allowed to do peacefully, as long as I don't disrupt Wikipedia doing it. Exactly the behaviour we are viewing at the moment - but not from myself, I assure you. Thanks. Ref ^(chew)(do) 16:02, 18 March 2008 (UTC)

'Not a list' has the specific footnote - This provision is not intended to encompass lists of links to articles within Wikipedia that are used for internal organization or to describe a notable subject. MickMacNee (talk) 16:13, 18 March 2008 (UTC)

This has got completely out of hand. As has been poined out above, a number of editors have tried dealing with this civilly and in the face of unfounded accusations of "conflict of interest", vandalism and sock puppetry and somehow of being part of a group, all because they all disagreed with Kosh's opinion. Regardless of the consenus of the AfD, Kosh still refuses to accept that he was wrong to close the AfD despite being told that as nominator he is not allowed to close it, and especially so when he has no powers to delete the article. This should not even be an issue. Surely it is time to move on. Also, given that Kosh as nominator of the AfD has now said, "I'll leave it alone. I won't touch it. No further action." then presumably he accepts the consensus, albeit still fully disageering with it, which he is perfectly entitled to do.♦Tangerines♦·Talk 17:04, 18 March 2008 (UTC)

User Viridae violating WP:CANVASS

It would appear that Viridae is violating Wikipedia's policies on canvassing to influence the outcome of a deletion review. See the edits here and here. Bongout (talk) 02:58, 18 March 2008 (UTC)

That's not really canvassing, he's just notifying 2 people that will likely want to comment. John Reaves 03:01, 18 March 2008 (UTC)

He solicited the opinion of someone he knew would be in agreement with him: "...because you are the person most likely to get the deletion reason, something that sails far above the heads of many others." Further action needs to be taken against Viridae for his highly inappropriate unilateral conduct because there was ongoing discussion, and he chose to dismiss all of it of his own accord. RTFA (talk) 03:07, 18 March 2008 (UTC)

He's cherry-picking people he knows will likely want to comment in favour of his position, something that is made very clear by those edits. Bongout (talk) 03:12, 18 March 2008 (UTC)

It may not be entirely appropriate, but it certainly doesn't require sanctions. John Reaves 03:14, 18 March 2008 (UTC)

I don't believe this is a good interpretation of Canvas and Durova and Doc glasgow's views are indeed to be hoped for in such a DRV. Thanks, SqueakBox 03:16, 18 March 2008 (

This may be the case, but the guideline clearly states Always keep the message neutral and Viridae's message to Doc glasgow clearly violated this. It also states Do not attempt to sway consensus by encouraging participation in a discussion by people that you already know have a certain point of view and Durova has very well known views on BLPs. Bongout (talk) 04:06, 18 March 2008 (UTC)

Contacting two users isn't canvassing, and is perfectly appropriate. It's especially appropriate for an issue such as this, where there is certain to be a prolonged discussion. — Carl (CBM · talk) 03:19, 18 March 2008 (UTC)

Oh pull the other one. Durova had already discussed the article in question and possible deletions of it. Doc is the most clued in person on the project BLP wise, even if I don't always agree with him and is likely to want to be involved in an issue such as this. Viridae^Talk 03:33, 18 March 2008 (UTC)

(EC)::I agree with Squeakbox, CBM and John Reaves. Carefully reading WP:CANVASS reveals that there are only very slim arguments that could be made for a violation by Viridae. The scale was definitely limited. Votestacking, per WP:CANVASS, involves mass talk messages - these were two individually worded messages (one was simply "Heads up, D"). One could make an argument that the first one was not neutral - although no effort was made to TELL Doc to vote one way or the other. Was he campaigning? Well, again, the policy paints a gray area on this one - you have to take scale into account. Here, it was only two people. Was this action completely appropriate? Possibly not. Are there any warranted sanctions (or really, any warranted actions at all)? Not in my opinion. Although that last addition by Viridae wasn't exactly mature. Tanthalas39 (talk) 03:36, 18 March 2008 (UTC)

Doc is often involved in deletion reviews and it appears that Durova was involved with this article previously. So, not canvassing. Cla68 (talk) 04:11, 18 March 2008 (UTC)

It is canvassing because the message was clearly not worded neutrally and it was an obvious attempt to sway consensus. Bongout (talk) 04:14, 18 March 2008 (UTC)

No one agrees with you, nothing is going to happen, so just drop it. John Reaves 04:18, 18 March 2008 (UTC)

There are well-respected people who agree with me, both in this section and in the deletion review. Bongout (talk) 04:33, 18 March 2008 (UTC)

At the present, the only person in this section who has agreed with you is RTFA, a sockpuppet. If Viridae's talk page messages violated WP:CANVASS, the problem is with the canvassing document rather than with the actions. In particular, there is no reason that every talk page message has to be neutrally phrased. — Carl (CBM · talk) 04:38, 18 March 2008 (UTC)

It is not my contention that every talk page message need be worded neutrally. Also, while RTFA is a sockpuppet, as explained here, this they are a well-established user in good standing merely attempting to separate edits on subjects. This isn't a violation of policy, of trust, or of anything else.Bongout (talk) 04:48, 18 March 2008 (UTC)

Not even every message that tells someone else you want them to support you in an AFD or DRV. Your responses here seem to alternate between wikilawyering over the wording of CANVASS and wikilawyering over the manner in which others respond to you. I think I'll take John's advice. — Carl (CBM · talk) 04:52, 18 March 2008 (UTC)

If WP:CANVASS were to prevent wise folks like Durova or DocG from commenting anywhere, I'd say there was a bit of a problem. ;-) --Kim Bruning (talk) 04:15, 18 March 2008 (UTC)

No one is suggesting that they be prevented from commenting. ;-) Bongout (talk) 04:16, 18 March 2008 (UTC)

(ec. *2) ... okay... so what are you suggesting? --Kim Bruning (talk) 04:21, 18 March 2008 (UTC) (ec)

That Viridae be prevented from consensus canvassing. Bongout (talk) 04:48, 18 March 2008 (UTC)

Which would mean that you are opposed to Durova and DocG having been contacted, (as that is canvassing, according to you) correct? --Kim Bruning (talk) 05:47, 18 March 2008 (UTC)

Incidentally, is it just me, or do several folks consider BLP to override all else? --Kim Bruning (talk) 04:18, 18 March 2008 (UTC)

That's because it does, IMO. It's our most important content policy, because it takes all the other content policies we have and distills them down for a single issue where it is vitally important that we not screw up: the lives and reputations of living people. FCYTravis (talk) 04:23, 18 March 2008 (UTC)

When used correctly, it should. John Reaves 04:22, 18 March 2008 (UTC)

Yes, I'd say that both Doc G and Durova's input generally substantially improves the quality of discussion in any BLP matter. FCYTravis (talk) 04:20, 18 March 2008 (UTC)

Which anyone would think who is generally in favor of deletion. The bottom line is that anyone paying attention to BLP-penumbra issues at all knows exactly how Doc would respond and know how Durova would likely respond as well. At best, this Viridae should have ealized that this looked bad. JoshuaZ (talk) 05:06, 18 March 2008 (UTC)

This is asinine. I move that Bongout be censured for violation of WP:AGF. Jtrainor (talk) 05:16, 18 March 2008 (UTC)

(ec) That's as blatantly absurd as Bongout's idea that this was canvassing. I suggest that this section's discussion be closed as it's just rehashing now. ···日本穣^{? · Talk to Nihonjoe} 05:24, 18 March 2008 (UTC)

Censured? We can do that? :-) --Kim Bruning (talk) 05:53, 18 March 2008 (UTC)

See, it would be a proof-by-counterexample sort of thing. We would show that Assuming Good Faith is important by failing ourselves to do it for him, and letting him know how it feels. Disputes can be kept alive for years that way, if you're dedicated enough. -GTBacchus^(talk) 06:02, 18 March 2008 (UTC)

And that, of course, would be a textbook example of disruption to make a point <GRIN> --Kim Bruning (talk) 06:07, 18 March 2008 (UTC) You wouldn't believe how many people get WP:POINT wrong. Basically, if you're not grinning from ear to ear at the sheer creative audacity of it all, even while preparing to click the block button... it probably wasn't a WP:POINT violation. ;-)

Not sure if anyone mentioned this yet, but there already was a related discussion on Durova's talk page when Viridae left a message. -- Ned Scott 05:22, 18 March 2008 (UTC)

Which is kinda sorta why I left her a message. Ned You have a great skill in pointing out the obvious sometimes when other people have been entirely oblivious to it. Keep it up. Viridae^Talk 07:05, 18 March 2008 (UTC)

Yup, Ned nails it. I was already considering nominating that article myself. Don Murphy falls within my standing offer for courtesy BLP nomination. Viridae followed up on the active discussion to mention he'd already taken action. I've got some concerns about his decisions today on a process level, but canvassing isn't one of those concerns. Durova^Charge! 09:37, 18 March 2008 (UTC)

Look at the last AfD which I initiated. It's pretty clear that simply deleting the article is not considered acceptable by large numbers of people. Where is the on-wiki discussion prior to this deletion? Guy (Help!) 14:15, 18 March 2008 (UTC)

If he called to view the discussion 2 people he knew would have a similar desired outcome for it to him, he should have also asked a couple of people he knew to be on the other side of the debate, otherwise it does risk skewing it. The special, the random, the lovely Merkinsmum 18:03, 18 March 2008 (UTC)

That has got to be the silliest suggestion I've heard in a long, long time. I suppose patrollers should go ask random vandals to place {{hangon}} tags on speediable articles to avoid "skewing the debate"? There is a vast gulf between canvassing and notifying two people of some debate, and even hinting at conflating the two is to be, at best, completely disingenuous. — Coren ^(talk) 20:26, 18 March 2008 (UTC)

Hanlon's razor - I'll bet it's ingenuous. (No offense, Merkinsmum - I think you're mistaken, but that doesn't at all mean stupid.) Only Merkinsmum knows for sure.

We discourage canvassing because it encourages the ideas that we are voting, and that "getting out the vote" somehow makes sense as a "strategy". It's harmful when busloads of people show up to "register a vote" because it obscures what's really going on, and it encourages complaints from people who thought they won the "vote". Alerting a person with applicable knowledge doesn't turn it into a numbers game; it helps keep the focus right where it should be: on content and policy.

If you wish to argue that Viridae "violated" some policy (how legalistic!), you'll have to explain how it was harmful, what he did. Even then, the appropirate remedy would be to fix the problem, not to censure Viridae. Remember, this isn't court. Did Viridae hurt the project? If so, how? -GTBacchus^(talk) 20:52, 18 March 2008 (UTC)

How about by deleting an article which had survived two AfDs by a substantial margin, reportedly at the request of a banned user at a troll site, without any on-wiki discussion? I mean, they really don't come a lot more rouge than me, and even I wouldn't have deleted this one, I took it to AfD. And I was one of the ones attacked by Murphy and his goons, including having him phone my wife at home. Guy (Help!) 21:57, 18 March 2008 (UTC)

Well sure, that sounds like something that ought to be looked at carefully, which is why there's a DRV discussion, right? I was responding to the complaint that he "canvassed" for the DRV. If leaving notes on those two talk pages hurt the project, then I can see a cause for concern, but if someone's simply hung up on the wording of WP:CANVASS versus the spirit, then I was trying to point out that they're different things. -GTBacchus^(talk) 22:07, 18 March 2008 (UTC)

Except that the banned user is the subject of the article... Viridae^Talk 22:59, 18 March 2008 (UTC)

Completely irrelevant. He knows where to find OTRS and has already corresponded with numerous admins, and Jimbo, by email. We do not accede to requests for admin action by banned users at Wikipedia Review without on-wiki discussion, it is absolutely wrong. I say we, I know you do, and have done so before, but it is still unequivocally wrong. Guy (Help!) 11:17, 19 March 2008 (UTC)

There doesn't seem to be a window for administrator action here, so on what basis does this conversation continue? It was two active editors, one an admin, notified about a discussion that one was already tangentially involved in. Time to move on. Avruch ^T 21:48, 18 March 2008 (UTC)

User:John Reaves just inspired me to write this essay. Just FYI. Equazcion •✗/C • 00:14, 19 Mar 2008 (UTC)

A new vandalism-only account?: Roosterpunk430

• See:
  • This page difference
  • http://en.wikipedia.org/wiki/Special:Contributions/Roosterpunk430
  • Anthony Appleyard (talk) 06:33, 18 March 2008 (UTC)

Left a warning. In the future, please use WP:AIV for a more direct response (remember to warn them first!). Thanks, Master of Puppets _{Call me MoP!☺} 07:38, 18 March 2008 (UTC)

Reporting user for continued Wikipedia disturbance, including repeated sock puppetry

I, WalterGR (talk · contribs · deleted contribs · page moves · block user · block log) am reporting Kilz (talk · contribs · deleted contribs · page moves · block user · block log) for repeated sock puppetry use during edit wars and continued disruption of the editing process. (Please forgive the length of this entry - I just wanted to make sure I thoroughly documented the sock puppetry.)

Previous incidents:

• 21:34, 21 October 2006 (UTC) - Kilz is blocked for suspected sock puppetry.
• 12:20, 24 October 2006 (UTC) - Kilz's static IP is blocked as it's "used to avoid 3RR detection." 67.175.233.209 is clearly Kilz. Kilz obliquely admits this. (diff)
• 18:19, 8 March 2008 (UTC) - Kilz is blocked for violating the 3 Revert Rule. Full disclosure: I reported him.

Incidents not yet reported:

• Of Kilz's approximately 1,200 edits, about 1,100 - over 90% - are related to controversy he has stirred up in the following 3 articles:

• Swiftfox. Page history, at the end of the edit war: [18]
• Office Open XML. Edit war is slowly ongoing, but here's a good snapshot of it: [19]
• Standardization of Office Open XML. Current page history, edit war is ongoing: [20]

• I have identified 4 sock puppets which Kilz uses to make edits during these edit wars, and to agree with his arguments in discussion pages:

• IDontBelieveYou (talk · contribs · deleted contribs · page moves · block user · block log)
• Idbyou (talk · contribs · deleted contribs · page moves · block user · block log) ("IDBYou" = "I D B You" = "IDontBelieveYou")
• StVectra (talk · contribs · deleted contribs · page moves · block user · block log)
• Loki144 (talk · contribs · deleted contribs · page moves · block user · block log)
• (Another user noticed his use of "IDontBelieveYou" and "Loki144", here.)

• Use of Loki144:

• Kilz argues for the removal of a reference for benchmark data which shows Swiftfox is faster than Firefox:

• "The site is also a private site listing the findings of only one person with no editorial oversight and is therefore not a creditable source [WP:RS]..." (diff: [21])

• Loki44 backs Kilz up:

• "The browser speed test site is also a private site and not a reliable source." (diff: [22])

• Use of IDontBelieveYou:

• When Kilz argued for the removal of the reference for benchmark data, he also said:

• "If we cant find information on the 2.0 version from a reliable source the section needs to be removed IMHO." (same diff as above: [23])

• IDontBelieveYou backs Kilz up:

• "I agree with you Kilz... This article should be about 2.0. If we can't find references for the speed section for 2.0, the section should be removed." (diff: [24])

• Kilz doesn't believe Swiftfox is faster than Firefox.

• Kilz removes the text "The name Swiftfox implies a faster browser than Firefox" (diff [25]). It gets added back in. Kilz then adds a {{fact}} tag (diff [26]). It gets removed. Kilz adds an {{unreliable}} tag to the section instead (diff [27]). It gets removed. He adds it again (diff [28]). It gets removed again.

• IDontBelieveYou comes to Kilz's aid:

• He makes the following edit: "The name Swiftfox comes from the animal Swift Fox which coincidently implies speed". (diff [29])
• That edit gets removed, then Kilz "restore[s] edit of idontbelieveyou" (diff [30])

• Use of IDBYou and StVectra:

• Kilz doesn't believe statements from Microsoft's web sites can be used in Standardization of Office Open XML:

• "It dose not pass WP:SOURCES it is a self published source." (diff [31])

• StVectra agrees with Kilz:

• "Microsoft in this instance is not a reliable source. It is writing about itself WP:SELFPUB clearly says it cant be used as a reference when it includes claims about third parties." (diff [32])

• Kilz later responds:

• "You cant use the source. It is self published , and has claims about a third party." (diff [33])

• Sock pupped IDBYou backs Kilz and StVectra up:

• "WP:VER is very clear, you can not use self published sources. I think the section needs to be removed as it also has claims against a 3rd party" (diff [34])

• Kilz later argues that blogs cannot be used as sources:

• "This is from a Blog, blogs are not usable as sources WP:SPS." (diff [35])

• StVectra agrees:

• "I agree that blogs should not be used as sources or references. They all to often have bias that is impossible to remove." (diff [36])

• Kilz agrees with the bias point:

• "Every blog has bias." (diff [37])

• Kilz later disagrees with blogs I have removed:

• "Ars Technica is a news site. That they use Groklaw as a source in no way makes them unusable. FanaticAttack is not a blog in my opinion but an news site that covers a wide range of topics. The article is neutral. That it has a place for comments is besides the point. GrokDoc is a wiki, but it is not an 'open wiki'." (diff [38])

• StVectra agrees with Kilz:

• "Use of information on Groklaw is not a reason to remove another site. Fanaticattack is not a blog IMHO, and the neutral style they use is that of most news sites. I am not so sure about Grokdoc more because of a neutral point of view problem. Open wiki's are those that allow anon posting, it is not open." (diff [39])

• Kilz removes information (diff [40]) that later gets restored. IDBYou removes the same information (diff [41]).
• IDBYou removes some quotations from the same section (diff [42]) that are later restored. Kilz removes some of them again (diff [43]).

Kilz's periods of editing activity - whether via sock puppets or his logged in account - are directly correlated to edit wars and controversy within those articles.

• Swiftfox: This dispute was summed up here. Kilz believes Swiftfox is non-Free Software and is opposed to non-Free Software: "There are a few of us on the Ubuntu forums who oppose non free software... Jason has tried to stop me from telling people Swiftfox is non-free... I think I know how unethical he is, and know he will lie to win." (diff: diff).
• Office Open XML and Standardization of Office Open XML: On Kilz's talk page, "Groklaw - I find the site facinating. When I found it 2 1/2 years ago I was still using Windows. The site has changed how I feel about freedom and the court system. Ubuntu - I have completely removed Microsoft from my life. I do not miss it in any way." (diff: [44]) Groklaw is critical of Office Open XML standardization.

While every editor has a point of view, Kilz is extremely and continuously disruptive.

If necessary, I can provide more info on request.

Thanks, WalterGR (talk | contributions) 10:15, 16 March 2008 (UTC)

Kilz may also be using the Tor (anonymity network) to make untraceable anonymous edits during edit wars. I can provide diffs if desired. WalterGR (talk | contributions) 01:15, 17 March 2008 (UTC)

Restoring unresolved section archived by MiszaBot II. WalterGR (talk | contributions) 06:41, 18 March 2008 (UTC)

Your best bet is WP:SSP. Coldmachine^Talk 09:47, 18 March 2008 (UTC)

It was suggested I come here given the past violations of this account, the ongoing sock puppetry, the use of TOR during edit wars, and continued disruption. But if WP:SSP still really is the best place to post this, then I'll go there. Let me know. Thanks, WalterGR (talk | contributions) 16:37, 18 March 2008 (UTC)

• Why not just copy this whole mess above to WP:RFCU? It seems like you could probably skip SSP in this case, there is already a fairly good body of evidence for a checkuser to use to evaluate whether abusive sockpuppetry has occurred. Avruch ^T 21:51, 18 March 2008 (UTC)

Well, based on my reading of RFCU, the only "acceptable request" would be under the category of "Request doesn't fit any of the criteria but you believe a check is warranted anyway". I think the behavioral evidence I presented above is strong enough that a checkuser isn't really needed.

I copied this report to Wikipedia:Suspected_sock_puppets and will see what happens.

Thanks for your input. I guess the report here can be marked as resolved, or whatever the proper procedure is. Thanks, WalterGR (talk | contributions) 23:07, 18 March 2008 (UTC)

Because he doesn't want that, it would clear my name. He wants to harass me and trash my name as much as possible. The only thing all the names above have in common is that they agreed with me, or did an edit like one I did before. As he already read the first sham sockpuppet case, he knows I have a static Ip. In 2006 some admin said I had a sockpuppet for a not logged in edit, read the talk page of the 2006 case above. He hopes history will repeat itself and Ill be found guilty with no evidence.

WalterGR stalks me, if I ask a question on a noticeboard, he looks up in my contribs and barges in disrupting my questions.

• [45]
• [46]
• [47]

I even tried to put an end to the fighting, but he wasnt willing to end it. He has dredged up an argument in 2006 (Swiftfox) on a article he wasnt even involved in and one from 2008 (OOXML) and says its a pattern. Kilz (talk) 04:05, 19 March 2008 (UTC)

User:Nicolaas Smith: repeated personal attacks

I (and others) are being repeatedly attacked at the Talk:Inflation page. I am hard-pressed to place all the diffs due to the editing storm by this user:

(Note: this user is a confirmed sockpuppeter who has recently used different log-in names and frequently does not log in - see my note to him that I would only mention this if he appeared to be sockpuppeting by not logging in or using different names: Diff from talk page. In this same communication on his talk page, I also requested he stop referring to me when there is no connection. This is repeated in subsequent communications, politely; this conversation was then posted to the inflation talk page: cross-posting of info.

1. "What is the talk page for then? Here we are suppose to state things and discuss things. If you remove it from the talk page then what is this talk page for? Are you crazy or what? Nicolaas Smith (talk) 22:10, 16 March 2008 (UTC) the sockpuppet"
2. Accusation of censorship: :"although editor Gregalton wants to censor me..."Nicolaas Smith (talk) 15:33, 16 March 2008 (UTC)
3. Accusations of puppetry: "Puppet Gregalton will hate the fact that I can add my knowledge to Wikipedia...Puppet Gregalton will certainly find ways to still bannish my work from Wikipedia. Nicolaas Smith (talk) 18:57, 17 March 2008 (UTC)
4. Comparison to Mugabe: "If you do not want me to mention your self-puppet name - it is not your real name - on Wikipedia you will have to leave Wikipedia. Have you never heard about freedom of speech? You will do well in Robert Mugabe´s government. Nicolaas Smith (talk) 19:38, 16 March 2008 (UTC)"
5. Denial of comparison in response to polite request: "I did not compare you to Robert Mugabe. I said "You will do well in Robert Mugabe´s government." Signed: Nicolaas Smith - Gregalton´s favourite sock puppeteer. —Preceding unsigned comment added by 87.103.77.114 (talk) 07:18, 17 March 2008 (UTC)"
6. Don't even know what to say about this: "Don´t give me the story about "personal attack". Are you here in person? No. You are not here in person. You are here as a puppet of your real self. No-one knows who you are. I am here as myself, Nicolaas Smith. I am not a puppet. You are the puppet. I can attack your puppet, if I want to - and bear the consequences. I did not compare the puppet Gregalton to Robert Mugabe. I said that the puppet Gregalton will do well in Robert Mugabe´s government. The real person who uses the puppet name Gregalton will most probably behave differently when not hiding behind the anonymity provided by the puppet name Gregalton. It is impossible for me to attack your person. I do not know who you are. You are not here as a person but as a puppet of a person. A person who no-one knows"
7. More of the same: "There is a difference being on here as a person in your personal name and being on Wikipedia as a puppet. You know that very well. Puppets like you have the advantage of anonymity. You have already abused that advantage in the past with attacks against me personally or against my puppet self when I was on here as a puppet (not a sockpuppet) - I can´t remember whether you attacked my puppet self of me personnally. I will not waste time to check. I do remember it happened."
8. General rudeness: "It is absolutely reprehensible and contrary to the spirit of Wikipedia that a very experienced editor like Gregalton knows about the Citing Oneself Wikipedia Policy and does not point it out to inexperienced editors like me. Nicolaas Smith (talk) 21:16, 17 March 2008 (UTC)". Since this whole bizarre history with this editor started some time ago, and he was confirmed as a sockpuppeter July 2007, hard to say inexperienced.

As further background, this editor has repeatedly attempted to push his own theory, self-published (although may have been published recently, as "truth." (See " I think the fact that I say that accounting and accountants destroy real value is what people do not want to hear. Unfortunately it is true. But, the whole world is unfolding, as it should (is that a quote from Khalil Gibran?). So why not accounting too? Not updating constant real values is a serious matter and changing that assumption will change the current Historical Cost paradigm. So, it is a big thing. That is why everybody is so much against it." and numerous others."

Grateful some attention to this, this is out of control on this one page (and this user keeps returning with editstorms every few months and then leaves in a huff, only to return more out of control).--Gregalton (talk) 07:42, 18 March 2008 (UTC)

Eh, this is messy. I think there's an unnecessary amount of animosity between you guys. I'll drop a note on Nick's talk page about civility, though the issue here is that you guys are making your differences personal. That's not the way to go. Also, if you think there's sockpuppetry going on WP:SSP might help. Given the user's history, sockpuppetry will lead to an indef block. Master of Puppets _{Call me MoP!☺} 07:51, 18 March 2008 (UTC)

Thanks for your note. I think you will see from my note on the user's talk page that my interventions have been polite. It should be obvious from interactions with other editors the issue is a more general one - although the bulk of the animosity is directed at me.--Gregalton (talk) 08:02, 18 March 2008 (UTC)

Dreadstar

I am having trouble with an Administrator who goes by Dreadstar. I have continuously asked him for explanations and he has only been ambiguous and pushy.--UhOhFeeling (talk) 07:46, 18 March 2008 (UTC)

Can you clarify (with diffs) what the problem is please? Cheers, Casliber (talk · contribs) 07:48, 18 March 2008 (UTC)

How do you do diffs? He insist on adding citations which I would consider incorrect. Also, he is accusing me of making personal attacks and adding fact tags to try to promote a view or something, not really sure exactly what he means and he won't really respond directly to questions.--UhOhFeeling (talk) 07:51, 18 March 2008 (UTC)

Well do you consider this a civil statement? he only noted the policy. - Caribbean~H.Q. 07:54, 18 March 2008 (UTC)

No that's not my point, really wasn't trying to be rude, just all the darth and stars and stuff, that's besides my point. Apologies...nothing wrong with being young though.--UhOhFeeling (talk) 07:57, 18 March 2008 (UTC)

See Help:Diff for information on diffs. Also, sometimes you can inadvertently push a point of view by bombing particular sections of articles with tags because you disagree with them. I'm not saying that's what you're doing, but that may be the perceived outcome. Master of Puppets _{Call me MoP!☺} 07:58, 18 March 2008 (UTC)

I understand, I really just don't see how my edits could be perceived as such. I usually just add the tag to statements that sound iffy or info I though needed clarification--UhOhFeeling (talk) 08:00, 18 March 2008 (UTC)

Permit me to add my completely unsolicited 3rd party opinion, as it's late, I'm bored, and I happened to look into what UhOhFeeling is talking about. He's not drive-by tagging. He clearly was reading articles about pubs and drinking, and added {{fact}} tags in completely appropriate places.

He did his duty in questioning whether curry is a common US/Canadian pub food, because that's absolute nonsense. ("Rubbish?") I'm from the US and have traveled across it. A citation about a single restaurant in Brooklyn does not make curry a common pub food in North America.

I don't know who was being civil and who wasn't, but UhOhFeeling was not drive-by tagging.

WalterGR (talk | contributions) 08:13, 18 March 2008 (UTC)

UhOhFeeling most certainly is drive-by tagging. Three different administrators have had issues with UhOhfeeling's behavior. Also, Dreadstar tried to be informative and was met with the an insulting remark about his age, see here. As for drive-by tagging, well, make your own judgments, but several other editors complained about Uhohfeeling’s seeming over-tagging of articles. It certainly appears to me that they were correct. One article, Bhumibol Adulyadej, is an example where UhOhFeeling added a very large number of fact tags:[48][49][50][51][52][53][54] And on other articles as well: [55][56][57][58][59][60][61] As a matter of fact, out of UhOhFeeling's 51 mainspace edits, 46 of them were fact tag-related (about 90%). Anyway, several have tried to help and explain things to him, but it doesn't seem to have done much good. — Rlevse • Talk • 09:58, 18 March 2008 (UTC)

Rlevse, you're not an innocent party either. A day after he created his account, you put on his talk page: "You're trolling and I doubt you're a brand new user." and later got upset when he responded to your accusations on your talk page. (Look - I've been editing for months and I'm still not sure what the proper protocol is for talk page back-and-forths.)

In your guys' trying to help, I've only seen accusations of drive-by tagging, telling him to stop adding {{fact}}, and threatening to ban him.

Keep in mind that different people contributes to Wikipedia in different ways, according to the volunteer time they choose to donate. Having information pointed out that needs references is useful, not something to be discouraged.

So I'd say do this:

• This all seems to be the fallout from edit wars. Let's cool down.
• UhOhFeeling - check out {{refimprovesect}} which is documented here: Template:Refimprovesect. It's usually better to just put one of those at the top of the section, rather than several {{fact}} tags within the section.
• Rlevse and Dreadstar: don't bite the newcomers. I didn't see anyone suggest {{refimprovesect}}.

But then again, I'm no admin. Just a 3rd party. And I should have been in bed hours ago.  :) WalterGR (talk | contributions) 10:34, 18 March 2008 (UTC)

He's not so new. He used to be User:Nigazblood. He's been talked to many times, and by more than Dreadstar and I. Tag-bombing to the point he did is counterproductive. He's had his chances. — Rlevse • Talk • 11:52, 18 March 2008 (UTC)

In my short time editing at wikipedia I have been thoroughly disappointed with the admin's quickness to judge, close-minded attitude, and lack of critical thinking. Let's look at the facts here, not how many admin's have been offended when I was following policy in the first place. I think the fact tags are useful rather than one large ambiguous tag at the top of the article they get to the point of what facts need citing. Some of the judgments cast on me as to my reasons for using fact tags are simply not true and as stated way to soon. Any advice would be appreciated, Thanks--UhOhFeeling (talk) 01:20, 19 March 2008 (UTC)

Cardiff - repeated IP vandalism

The article Cardiff has been repeated vandalised by an anonymous user who persists in inserting spurious and unsourced claims, as can be seen from the article's history page. The vandal appears to be using a dynamic (probably dial-up) IP address so even though warnings have been left in the past they seem to have done no good. Therefore, could someone semi-protect this page so that only registered users can edit it? Bettia ^(talk) 09:32, 18 March 2008 (UTC)

Done. Cheers, Casliber (talk · contribs) 09:34, 18 March 2008 (UTC)

Thanks matey! Bettia ^(talk) 09:40, 18 March 2008 (UTC)

Actually, would it also be possible to semi-protect Wales as this user has also been 'active' on there as well? Bettia ^(talk) 09:46, 18 March 2008 (UTC)

Yup - both semi-protected for 3 months. We'll see how it goes. Happy to reprotect after that date if the shenanigans continue. There is a specific page, WP:RFPP, for requests as well :) Cheers, Casliber (talk · contribs) 09:50, 18 March 2008 (UTC)

Many thanks again. Bettia ^(talk) 10:05, 18 March 2008 (UTC)

TFD closure overdue

This TFD was "relisted". It is however, over 7 days old. Can someone close? http://en.wikipedia.org/wiki/Wikipedia:Templates_for_deletion/Log/2008_March_18 (irrel) NonvocalScream (talk) 09:57, 18 March 2008 (UTC)

It's sort of pointless at this point. The consensus was for delete. I was browbeaten for closing it that way. So I relisted it and suddenly we have a slew of keep votes almost at once. 10:03, 10:24 and 10:27. The main complaint of the keep side was that there was "recruiting" on an IRC channel for delete votes. Well now I think we have it going on for the keep side. I say, scrap the whole thing and start over. Obviously, we have alot of passion on both sides and a fair vote is not going to happen. I tell ya. Unless it's overwhelming on either side, XfD votes have become a major pain. --Woohookitty^Woohoo! 10:45, 18 March 2008 (UTC)

my thoughts on assuming good faith. NonvocalScream (talk) 12:21, 18 March 2008 (UTC)

Today's featured article vandalism

Resolved

 – Vandalism fixed. עוד מישהו Od Mishehu 12:13, 18 March 2008 (UTC)

Today's featured article contains unreverted vandalism in the first sentence. The word "Lesbian" remains as the result of this incompletely reverted vandalism edit [[62]]. Could an administrator please get on it? AKAF (talk) 10:54, 18 March 2008 (UTC)

The article looks good now, but as a point of order for the rookie admin (me) - do we full protect the main page article, or just semi unless high levels of vandalism warrant a full protection? UltraExactZZ ^Claims ~ Evidence 12:18, 18 March 2008 (UTC)

Semi-protect if it gets really bad and even then only for about an hour or two. Full protection shouldn't be used against vandalism. James086^{Talk | Email} 12:21, 18 March 2008 (UTC)

As James says semi at worst, but generally the daily featured article is never protected. It's on enough peoples watchlists that vandalism will be reverted straight away. Pedro :  Chat  12:23, 18 March 2008 (UTC)

Haplogroup I1a (Y-DNA)

Aaronjhill (talk · contribs) is a newbie here, but knows a lot about the population genetics of Haplogroup I1a (Y-DNA). Over the last two days he's substantially upgraded the article, significantly for prose style, but also adding a lot more content.

Without discussing it either on the article's talk page, or Aaron's own page, User:Olly150 executed a sweeping revert at 11:53 GMT, [63].

Then, when Aaron quietly continued adding accurate technical details about the mutations which characterise the haplogroup, User:Steve Crossin slammed him with four reverts and vandalism warnings on his talk page, following which Aaron was blocked by User:Kralizec!.

Not suprisingly, Aaron is considerably annoyed, and as of this moment isn't sure he wants anything more to do with Wikipedia.

Can we get him a speedy unblock, please? Jheald (talk) 12:41, 18 March 2008 (UTC)

While this edit doesn't seem particularly helpful, I'm seeing a lot of apparently good-faith additions to the article in question. Let me look into this. UltraExactZZ ^Claims ~ Evidence 12:48, 18 March 2008 (UTC)

I've left a notice for each of the involved parties (Olly, Steve Crossin, and Kralizec!), notifying them of this thread. I am inclined to unblock, but will wait a tic in the absence of discussion with/from Kralizec!. UltraExactZZ ^Claims ~ Evidence 13:03, 18 March 2008 (UTC)

No unblock is necessary, as the block expired 11 minutes before Jheald`s first message on my talk page. Despite the four levels of warnings given by Steve Crossin (talk · contribs) (and regardless of edits like this that clearly are vandalism), I was not entirely convinced as to the merit of Steve Crossin`s block request, so I only gave Aaronjhill (talk · contribs) a 15 minute block. --Kralizec! (talk) 13:08, 18 March 2008 (UTC)

Aaron's annoyance is perhaps understandable, but Aaron's communication skills could evidently use some work. Perhaps this would have been avoided if he'd taken a minute to explain in response to the warnings what he was doing rather than choosing this route to respond. I think Aaron could do with a friendly pointer to WP:AGF and WP:CIVIL and a suggestion that he try engaging the individual next time instead of vandalizing his userpage. --Moonriddengirl ^(talk) 13:14, 18 March 2008 (UTC)

Friendly pointer so delivered. I do commend those who've left friendly notes apologizing and/or explaining on the user's talk page. Nice anti-biting and showing of good faith, in spite of the user-space edit. :) I hope the new user won't be discouraged won't be discouraged from continuing, but will also respond more directly should there be an unfortunate next time. --Moonriddengirl ^(talk) 13:35, 18 March 2008 (UTC)

Since then, I have apologised to the user in question, and striked out the warnings, this is something I am deeply sorry about, and I again offer my apologies. Steve Crossin (talk) 13:13, 18 March 2008 (UTC)

I also struck the block message and apologized. --Kralizec! (talk) 13:22, 18 March 2008 (UTC)

I have left my apology on Aarons page and an explanation on Jheald's page also. Same reason as Steve - on vandalism patrol, the page came up on Lupin's AV, notably Line 380 - :Forward 5′→ 3′: gcaacaatgagggtttttttg - immediate reaction was too revert. If I had seen the page come up again, I would have looked into the history. I come accross vandalism like that all the time. Olly₁₅₀ 13:27, 18 March 2008 (UTC)

Good on both Steve and Olly for responding so quickly, and on Kralizec! for striking the block template. Is there any un-reverting that needs to be done at the DNA article? UltraExactZZ ^Claims ~ Evidence 13:43, 18 March 2008 (UTC)

Looks like Jheald reverted [64] the article immediately after his initial post here, and Aaronjhill has made over a dozen new edits [65] to the article. --Kralizec! (talk) 15:02, 18 March 2008 (UTC)

I am tempted to say something smarmy about anyone who thinks that gcaacaatgagggtttttttg in an article about DNA is vandalism. Let me say instead that automated tools that alert one to potential vandalism are merely tools, and the edits need to be viewed in context. Acting on the advice of a script or bot without checking is irresponsible. Thatcher 16:55, 18 March 2008 (UTC)

No harm meant here Thatcher, but I'm not a DNA expert. Far from it actually. However, we are glad of people like Aaron who do seem to be experts in this field. I am constantly reverting vandalism and edits that look that (see previous comment) are very common, and seem very popular amongst vandals. So I'm very sorry that I know little about DNA. And I did bring up a quick preview of the edit, as is possible thanks to Lupin, and to someone who doesn't understand such fields, it did look like vandalism. But, I promise in future to look REALLY closely at vandalism and hey, I've learnt something new. Isn't that what Wikipedia s' all about? Olly₁₅₀ 00:31, 19 March 2008 (UTC)

Underreporting deaths in Tibet on the Main Page

I am upset that the Main Page is saying that "at least 10" people have been killed in the unrest in Tibet, when the official Chinese government figure (which I do not believe anyone should trust) is already at 13, and the figure from the Tibetan government-in-exile is up to 99. There have been complaints about this at WP:ERRORS#Tibet Story for three days now with no action.

The Dalai Lama specifically states that he will resign if the violence continues, and that he is opposed to an Olympic boycott. Shouldn't that be included? All of the other "In the news" items are lengthier, so why not? SBPrakash (talk) 13:04, 18 March 2008 (UTC)

I am moving your question to Template talk:In the news, which is the appropriate page here. Thanks. -- lucasbfr ^talk 13:13, 18 March 2008 (UTC)

It says at the top of that page where you moved it, "To report errors that are currently on In the news, please post them on WP:ERRORS." The complaint, as I said, has been there at WP:ERRORS for three days without action. I am inclined to remove the archive notice here, but will ask someone else to because I'm scared of doing something against protocol that I don't know about. SBPrakash (talk) 13:17, 18 March 2008 (UTC)

You are right, my mistake. Sorry! I commented at WP:ERROR. -- lucasbfr ^talk 13:40, 18 March 2008 (UTC)

The Comparison_of_CECB_units article is uneditable

There is a small group of persons "policing" that article. They refuse to allow other persons (like myself) to edit the article. Everytime someone tries, they immediately revert the change. Is that behavior appropriate or not? ---- Theaveng (talk) 13:21, 18 March 2008 (UTC)

Maybe they have problems with the specific changes you're making, rather than with an outside person changing it as you seem to imply. —Random832 14:12, 18 March 2008 (UTC)

Yup, you can't be in the majority all the time, I see no reason to suspect foul play here. -- lucasbfr ^talk 15:34, 18 March 2008 (UTC)

You might get better results, Theaveng, if you do these things, some of which you may be doing already: (these are suggestions) you can talk more politely, for example avoiding saying things like "worthless" about some aspect of the article which no doubt someone else has expended work on; you can avoid using a lot of bold type, which may make you look angry; you can try to appear calm; you can apologize for your previous tone; you can present calm, logical arguments in favour of your changes rather than complaining that the article is uneditable; you can listen to others' point of view and say things that demonstrate that you understand it; you can present your suggested changes on the talk page before editing and discuss them and only implement them if they seem to have consensus. The others are not required to allow changes that they disagree with, but they should provide explanations for the reasons they oppose those changes. --Coppertwig (talk) 17:25, 18 March 2008 (UTC)

I've notified Wikiproject Telecommunications in an attempt to bring more eyes, in any case. —Random832 19:46, 18 March 2008 (UTC)

Single-purpose spamming account

Resolved

 – User blocked indef. by Orange Mike. UltraExactZZ ^Claims ~ Evidence 14:30, 18 March 2008 (UTC)

User:Thesnodgrass continues to add linkspam to various UK articles, despite warnings. I think a block is needed here. --RFBailey (talk) 14:04, 18 March 2008 (UTC)

Unfair removal and block

History: I'm an occasional but positive contributor to Wikipedia, after some problems with fair use images and the difficulty in trying to resolve them I created a userbox User:Bleveret/Userbox/BCBruin to state an opinion which was deleted. Consensus for this delete was dubious however I toned down the content of my opinion inline with the discussion to a new version User:Bleveret/Userbox/ruin. The new version is a soft opinion which is no different from many other userbox-stated opinions on the fair-use topic.

Situation: Users User:Nyttend and User:Doc glasgow have deleted the new version of the userbox without consensus or discussion and further to that User:Doc glasgow has attacked me personally of being a troll. I'm sticking up for my right to express a non-offensive opinion but I'm certainly not a troll (I had to look up what one was). Apart for the actioning admins in this case other users/admins are supportive to me.

Please can the new version of my userbox be re-instated so we can all get back to improving Wikipedia? --Bleveret (talk) 14:31, 18 March 2008 (UTC)

I don't see much reason to delete that. However I see no reason to worry about it, either. How does this little irrelevant box relate in any way to your ability to improve Wikipedia? The only obstacle I see to your doing that, is that you're more concerned about your box than about editing, apparently. Heck, even the first version is something you ought to be allowed to say. Users are allowed to editorialize about Wikipedia in user space. Have you tried putting it on your user page instead of in a separate page? It might not get noticed that way. Friday (talk) 14:37, 18 March 2008 (UTC)

I agree. State it on your user page, rather than in a userbox. Should be fine then. For the record, I think language divisive to a collaborative editing environment should be avoided. I'm waiting for a response from another user about a similar (but opposite) situation. It's in my contribs if anyone is desperate to see what I'm talking about, but please wait until I get a reply before commenting here or there. Carcharoth (talk) 14:52, 18 March 2008 (UTC)

I think there were three things done wrong here: 1)The repeated deletion of his userbox, which was different than the one involved in an MfD. 2)The unwarranted block. 3)The fact that User:Remember the dot posted the MfD for DR, and User:Nick immediately closed it. Enigma ^msg! 15:45, 18 March 2008 (UTC)

I should mention that User:Nick, the administrator who shut down the DRV request almost immediately, was the same one that deleted the userboxes in the first place. In any case, the new userbox is different enough from the original that the MfD discussion does not apply. If others still want to delete it then we can discuss it at MfD like civilized people. —Remember the dot ^(talk) 16:50, 18 March 2008 (UTC)

• Another thing done wrong (sorry to pick on you Remember the dot); Remember the dot, having been the party bringing the DRV, should not have been the party to unblock Bleveret. He should have asked another, uninvolved administrator to review the situation and make an appropriate decision. --Hammersoft (talk) 17:24, 18 March 2008 (UTC)
• And now Remember the dot restoring the userbox under contention, User:Bleveret/Userbox/ruin. This is a form of wheel warring. See Wikipedia:Administrators#Misuse_of_tools. --Hammersoft (talk) 17:33, 18 March 2008 (UTC)

• The root of the problem was the initial problematic actions taken. Whether RTD did it, or asked someone else to do it, they had to be rectified. As far as I'm concerned, Bleveret should've been unblocked immediately by whichever admin saw it first. Enigma ^msg! 17:38, 18 March 2008 (UTC)

• I'm not interested in wheel warring. Again, if you want User:Bleveret/Userbox/ruin deleted, then start a discussion at MfD. If there is consensus to delete then I have to abide by that decision. —Remember the dot ^(talk) 17:48, 18 March 2008 (UTC)

• But you have been wheel warring. For the record, I don't think the userbox should have been deleted. The first one (the one subject to the MfD), yes. The second, no. I also don't think Bleveret should have been blocked. That was clearly out of line. But so was unblocking him by a directly involved administrator, and so was restoring the userbox by that same administrator. There's 1500+ other admins. SOMEbody would have undeleted it. --Hammersoft (talk) 17:52, 18 March 2008 (UTC)

• Can we just be happy that the misapplication of speedy deletion criteria and the blocking tool was quickly reversed, and that we are now in a position to discuss the issue like civilized people? —Remember the dot ^(talk) 18:02, 18 March 2008 (UTC)

• I'm not looking for action against you. I am cautioning you that acting in the way you have has resulted in other administrators being forcibly de-adminned. Please use more caution in the future. When in doubt, seek action/advice from an uninvolved administrator. --Hammersoft (talk) 19:30, 18 March 2008 (UTC)

• Nothing much wrong with the second one, apart from the fact that looking at the actual code reveals an editor who doesn't understand the concept of Wikipedia. Black Kite 18:42, 18 March 2008 (UTC)

• Agreed. --Hammersoft (talk) 19:30, 18 March 2008 (UTC)

• Here's the core problem: the apparent assertion that enforcement of Foundation policy on unfree content amounts to censorship (which it clearly doesn't, this is a logical disconnect in the deleted UBX), combined with the idea that the encyclopaedia is somehow "ruined" by adhering to its mission to be a free-content encyclopaedia. I'm sure that the user can think of a way of stating his opposition to automated mechanisms of enforcement of fair-use policy without appearing to repudiate a Foundation edict and one of Wikipedia's core goals, if he really tries. Do it in a way that is not inflammatory and divisive, perhaps. Guy (Help!) 00:05, 19 March 2008 (UTC)

This user thinks censorship and fair use bots are ruining Wikipedia

The offending userbox

• The censorship issue is separate from the fair use issue. No one said that they are any more than tangentially related. Perhaps the userbox should be split in two, one for each issue, to make this more clear.
• The foundation edict was not handed down from on high. We have a right to disagree with it. Disagreement does not mean that we hate each other or that we can't collaborate together. It just means that we should discuss the issue more and carefully consider our opinions.
• The userbox, which I have dug up and posted for reference, is not nearly divisive or inflammatory enough to qualify for speedy deletion. At the very least, it should have been sent through MfD.

—Remember the dot ^(talk) 04:18, 19 March 2008 (UTC)

• The Foundation oversees this project. In so far as editors here are concerned, an edict from them is from on high and carries the strongest voice of any here. It states at Foundation:Resolution:Licensing policy "This policy may not be circumvented, eroded, or ignored on local Wikimedia projects." You certainly have a personal right to disagree with the policy. In so far as the project is concerned, you do not have a right to act in abrogation of it. --Hammersoft (talk) 12:23, 19 March 2008 (UTC)

• Absolutely. And there's always the core mission to be a free content encyclopaedia. Even then, civil disagreement is fine, but personalising the dispute and repudiating core values are simply not on. Let's not forget that the original said "this user thinks Betacommandbot is destroying Wikipedia" - not very nice. Actually I think the obsessive insistence on unfree content and refusal to use proper fair use rationales is much more of a problem. Guy (Help!) 12:30, 19 March 2008 (UTC)

Norman Bettison

• 212.44.32.4 (talk · contribs · deleted contribs · filter log · WHOIS · RDNS · RBLs · http · block user · block log)

Third vandalism this month to Norman Bettison: [66][67][68] Gordonofcartoon (talk) 14:35, 18 March 2008 (UTC)

Not worrisome enough to warrant a block at this time, IMHO. If the problem persists, don't hesitate to poke me on my talk page. -- lucasbfr ^talk 15:37, 18 March 2008 (UTC)

Agreed; there's a few admins watching the page, so if the IP gets more enthusiastic about it and edits more rapidly, someone will surely catch it. Right now, with a frequency of one edit every few days, it's not really block-worthy yet. Tony Fox (arf!) 15:51, 18 March 2008 (UTC)

Request

I would like to ask administrators intervention as I currently being harassed by particular contributor, who yesterday launch shameful campaign on my talk page (initially targeted and wrong person [69]) --- [70][71] [72][73] [74]. He/she was warned about personal attacks [75] but not stopping. May I ask sysop to additionally inform this particular person to stop this campaign and please protect my user talk page. Thank you, M.K. (talk) 14:36, 18 March 2008 (UTC)

I have left the contributor a note regarding our guidelines on harassment, particularly user space harassment. I hope that the contributor will stop restoring the message. If not, a block to prevent further disruption is preferable to protecting your user talk page, which is an important avenue to allow other contributors to contact you. --Moonriddengirl ^(talk) 15:09, 18 March 2008 (UTC)

Thank you for quick response, M.K. (talk) 15:10, 18 March 2008 (UTC)

Repeated article blanking at Thought Adjuster and other articles

Resolved

I reported this to the vandalism noticeboard but was advised it should go here:

User:ScienceApologist has repeatedly blanked a series of articles now despite being warned multiple times that WP:DELETE is being violated. The pages are a series of daughter articles related to a somewhat minor religion, which the editor personally doesn't seem to like. See the edit histories of articles like Thought Adjuster and Cosmology (The Urantia Book) (here and here). Both of which survived AfDs that the user has decided to override by page blanking. See also the discussion at Wikipedia:Fringe_theories/Noticeboard#Universe_reality_and_other_The_Urantia_Book_related_articles and the user's talk page, as well as my own. Wazronk (talk) 16:12, 18 March 2008 (UTC)

Thought Adjuster could stand as a monument to unreferenced soapboxing pontification everywhere. Its continued existence shows that the WP:AFD process is badly broken. Raymond Arritt (talk) 17:35, 18 March 2008 (UTC)

(ec)Both Thought Adjuster and Cosmology (The Urantia Book) should be redirects to The Urantia Book. They're completely unsupported by any independent secondary sources, and there's no reason they can't be covered in the parent article. The resulting walled garden is appropriately dealt with by redirecting them and merging relevant content - doing so is not "vandalism". Personally, I think the entire Urantia Book article ought to be evaluated at AfD as lacking in evidence of notability, but then I'm a mean deletionist. MastCell ^Talk 17:44, 18 March 2008 (UTC)

Entirely not true, there are numerous secondary sources, and they have been added to the references section, since they were requested. There is a claim that there is some kind of "walled garden" when in fact repeatedly editors have been invited to discuss their concerns on the talk page, but they've instead chosen to blank articles. You haven't even tried to look up sources, engage in the matter with editors, or worked to improve the articles you want to somehow pretend are "walled" off. Wazronk (talk) 18:31, 18 March 2008 (UTC)

User:Wazronk is invited to contribute to the main article The Urantia Book where some decent editing could be used. Forking guidelines are clear as to how one should fork articles, and the creation of the collection of a Urantia Book-related walled garden is inappropriate especially with single person accounts watching these articles so closely. I was responding, in point of fact, to a request on the fringe theory board which was properly filed and well-documented. Please direct further inquiries to Talk:The Urantia Book#Work on this article first.

Also note that User:Mangojuice falsely claimed in an edit summary that there were secondary sources for Thought Adjuster when in fact there are not.

ScienceApologist (talk) 17:45, 18 March 2008 (UTC)

A number of administrators including User:Skomorokh and User:Mangojuice seem content to revert in the face of the above consensus and apparently not wishing to research the issue carefully. Please, administrators, do a little research before wielding a big stick in an misinformed way. It would be nice to see them actually comment before acting. ScienceApologist (talk) 17:58, 18 March 2008 (UTC)

I did a "little research." This is a topic within the (admittedly strange and obscure) Urantia world view that is documented in quite a number of books. See [76]; particularly, note the Larson book which is, partly, an encyclopedia of religions. In any case, you do not simply edit war your way to a redirected article. You've put the article in a redirected state about 6 times in the past few days. Mangojuice^talk 18:14, 18 March 2008 (UTC)

You seem to not be paying attention. Whether the topic is mentioned in certain books in relation to explaining Urantia beliefs is irrelevant: there is neither a connection to these books in the actual article content nor is there any indication that this topic is properly forked from the main topic. Please understand that you yourself are edit warring, and the fact is that there is consensus that these articles should be redirected to The Urantia Book means (irnoically) that it is you who are edit warring in oder to defy consensus at this point. That's some pretty bad precedent you are setting as an administrator. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)

There has not been a consensus and blanking articles is a violation of policy at WP:DELETE. In fact there are extensive discussions in the past that led to the branching into daughter articles but you've been so intent on blanking and reverts that you haven't even stopped to discuss it with the editors who know the history of the articles in question. Wazronk (talk) 18:44, 18 March 2008 (UTC)

The discussion between the two true-believers in The Urantia Book is meant to be binding here? No, we have the FTN discussion that shows clearly that these articles are inappropriately "branched". ScienceApologist (talk) 19:02, 18 March 2008 (UTC)

If you, ScienceApologist, were to do a little research of your own, you might find that I am not, nor have I ever been an administrator. Regardless of the merits of your intentions, your methods are completely unacceptable; WP:FRINGE is no excuse to flout consensus. скоморохъ 18:27, 18 March 2008 (UTC)

I guess it's okay when you are an administrator to throw out WP:AGF completely? I've done FAR MORE RESEARCH on this subject than you. My methods are no more "unacceptable" than your response in kind. Get over yourself: read the consensus that is achieved and add to the conversation or kindly stop acting as an obstructionist.

I agree with your sentiment SA, and how you are carrying them out is akin to petty vandalism. I am not clear how redirecting though blanking the page isn't vandalism? Whether or not the articles deserve to stay, they are here now. Blanking and redirecting, without concensus is not the way. Nominate them for Afd, and I'll vote for a redirect. Hohohahaha (talk) 18:29, 18 March 2008 (UTC)

Have I known you in a previous incarnation? ScienceApologist (talk) 18:59, 18 March 2008 (UTC)

me too. --Fredrick day 18:31, 18 March 2008 (UTC)

The point is that there is consensus demonstrated both here and at WP:FTN. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)

FTN is not the place to create consensus, and.... I don't see a consensus here. I suggest that instead of redirecting the talk pages of these articles, you actually use them. Hohohahaha (talk) 18:34, 18 March 2008 (UTC)

What, in your humble estimation, the flip is FTN for if not to get consensus on issues related to fringe theories? 18:59, 18 March 2008 (UTC)

There absolutely has not been consensus as is being pretended. Wazronk (talk) 18:38, 18 March 2008 (UTC)

We know you own the content. Your ideas are weighted appropriately.ScienceApologist (talk) 18:59, 18 March 2008 (UTC)

SA, can you point out the specific thread where consensus was obtained? Thanks, seicer | talk | contribs 18:40, 18 March 2008 (UTC)

The FTN thread is fairly obvious. Anyway, it's a moot point. ScienceApologist (talk) 18:59, 18 March 2008 (UTC)

← Perhaps the most appropriate approach would be (as mentioned above) to nominate these via AfD and gauge consensus for deletion/redirect/fork articles that way. Even if a consensus exists on the fringe theories noticeboard, it would be a bit of a stretch to apply that without evidence of a similar discussion/consensus on the article talk pages. AfD is also a more "neutral" venue than the Fringe Theories board. MastCell ^Talk 18:44, 18 March 2008 (UTC)

I have followed MastCell's advice thus making this report irrelevant. Please continue the discussion here: Wikipedia:Articles for deletion/The Urantia Book related articles.

Please do note, though, that this kind of politicking is ridiculous. It's patently obvious that these articles are shitty excuses for content. Everyone who takes more than a passing glance at them (except the authors) agrees. Whatever. I'll let the administrators get back to their other power trips. ScienceApologist (talk) 18:56, 18 March 2008 (UTC)

User:Hornetchild16

Resolved

Obvious sock of long time blocked abuser User:Hornetman16. Like the latter, Hornetchild straight away introduces himself to WP:PW (Hornetman16 regulary edited WWE articles), see here. Also see his contribs. Indef-block please. D.M.N. (talk) 17:38, 18 March 2008 (UTC)

Thanks East718 (talk · contribs) for blocking him indef. D.M.N. (talk) 18:06, 18 March 2008 (UTC)

User:In the Stacks repeatedly re-inserting links against consensus

User:In the Stacks has, over the course of the past six months, repeatedly added/restored a collection of links to the CrimethInc. article. I removed them, originally because they directly concerned sub-topics of the article, and later because I had integrated the reliable sources among them as references. Despite their presence as references, his reversion by three different editors, the opinion of three other editors on the talkpage that the inclusion of the links was not an improvement to the article, User:In the Stacks has continued to re-insert them. Attempts by myself and User:Murderbike to resolve the matter on the user's talkpage were unsuccessful. Neither of us want to continue reverting User:In the Stacks, so is there anything else that can be done? See the article's talk archive at Talk:CrimethInc./archive1 for a long history of the dispute. Thanks, скоморохъ 18:18, 18 March 2008 (UTC)

I'd like to add that a total of six users have expressed the opinion that the external links section should not remain, while In the Stacks stands alone in the opinion that it should stay. Murderbike (talk) 18:33, 18 March 2008 (UTC)

Context: CrimethInc. is an anarchist publisher, the disputed links were reviews of books published by CrimethInc. already present on the individual book articles (namely Recipes for Disaster). In The Stacks' contributions appear to be mostly edit-warring or discussion about edit wars. For disclosure, the three users who reverted User:In the Stacks are all members of the Anarchism task force). The CrimethInc. article was awarded GA status in the past few days, after which In The Stacks again added the links. скоморохъ 18:18, 18 March 2008 (UTC)

I'm a bit worried that my assessment of the article as stable may have been premature, but if this is just one user acting against consensus, I don't think it's much of a problem. At any rate, have the rest of the steps in dispute resolution been tried? A request for comment on the article (maybe even on the user's conduct) may be in order. --clpo13_(talk) 18:48, 18 March 2008 (UTC)

I chose here rather than a request for comment because that seems like an overreaction; this dispute is rather silly, the editor is fighting a one-man battle trying to duplicate quoted references as external links. I was hoping if a posse of non-anarchism-related editors pointed out to the editor that he was acting against policy and ask him nicely to stop, we would not need to resort to formal mediation, topic blocks etc. I don't think your "stability" assessment is premature; as you allude to, a 1 vs 6 dispute about a fraction of the article's content is not a serious cause for concern. Thanks for weighing in, скоморохъ 18:58, 18 March 2008 (UTC)

Please, could any experienced editors offer advice? This issue has already fallen on deaf WP:EARS. Thanks, скоморохъ 12:47, 19 March 2008 (UTC)

Harassment by Sethie

I don't understand as why this particular user is after me, kindly have a look at his contribution's, [77] Since 11 March, he has used this account for single purpose which is to harass me, and has almost no contribution's on any article whatsoever, how can i prevent him from vandalizing my userpage or talk page ? --talk-to-me! (talk) 18:49, 18 March 2008 (UTC)

Taking clue from what is stated below, is giving a person any name, violates wikipedia rules, as Sethie has done here, [78]. I am not aware of this person, or name, hence i simply ignored such wage imagination of Sethie, but his continual vandalizing my userpage, and giving warnings after warning on my talk page, forced me to report the matter here.--talk-to-me! (talk) 19:36, 18 March 2008 (UTC)

Answered on your talk page. He has a point about your userpage though. You could settle this matter immediately if you simple removed your accusations. Theresa Knott | The otter sank 19:42, 18 March 2008 (UTC)

Note also he was not asking you to reveal your real name only a previous wikipedia username. See [here] for why that account was banned. Theresa Knott | The otter sank 19:45, 18 March 2008 (UTC)

User:Cult Free World/talk-to-me is using his user page for soapboxing and attacking various meditation groups. Please, please examine his contribs, he is not on Wiki to contribute meaningfully in any way, but to provocate and soapbox.

As background, please note this user was blocked for one week here for making personal attacks.

Upon return from his block, he continued the same vein of personal attacks, calling editors or admins cult-promoters and/or accusing them of being paid to post on Wiki (the following are just since his return from the block).

1. Here he provocates by suggesting I am a paid member of a group. (a lie)
2. Here he seeks an admin's help, and blatantly lies by saying "if you notice the time there was no edit from my side during that time frame" when he had numerous attack edits documented here, but they do not show now because the pages were deleted. This is an intentional ruse to mislead and manipulate an admin.
3. Also, please note on the dif above that again he tells lies about several editors, saying we "are paid members from respective cults."

A few editors have warned him on this, he has been given warnings on his user page, and he ignores all of these. It seems unlikely that his goal is to contribute meaningfully to Wikipedia. Renee (talk) 19:59, 18 March 2008 (UTC)

Ok so we have Renee also here :), and hence this has once again looped back to user:jossi, I seriously doubt that Renee IS a paid member of that group, as user:jossi is of prem rawat [79]. Given the fact, that Renee approach only user:jossi for deleting a cult related page, [80] which was promptly deleted, by user:jossi even though he had declared that he would not get involved in cult related article, the way Renee has attacked me personally, and is continuously attempting to prevent an article from getting published in wikipedia, clearly indicates something fishy, I am really surprised at her continuous efforts to report about me, given then fact, I am all involved in responding to them, and hence unable to contribute effectively, her association with jossi is evident here also [81] where she approached jossi immediately after filing a case against me at yet another forum, WP:IU [82], which was rightly rejected [83] All this is only to prevent ONE article from getting published on wikipedia, which I became aware of after I noticed user:jossi deleting it, and subsequently i filed a COI notice [84].

Sum of all this information is, wikipedia is being manipulated by member's of certain group, which should not be allowed, wikipedia is there to give information and not hide it. Since my personal knowledge of the subject, which i suspect Renee has close connection is limited, hence my attempt was to translate the same topic from wikipedia's French twin, I noticed same subject present in french wikipedia as well, and i suggested to translate the same, and have an english article as well, this is all what concerns, these member's, Kindly note there is not a single comment from me on their page, which would indicate any sort of POV regarding any other user, same is more then clear in case of Renee and Sethie,it appears both of them belong to same group, called sahaja marga. --talk-to-me! (talk) 20:39, 18 March 2008 (UTC)

Attempt to reveal the name of a pseudonymous editor

The conflict of interstest page asserts that "Revealing the names of pseudonymous editors is in all cases against basic policy." And yet an editor named Boodlesthecat is attempting to do just that. See this diff. Putting aside my thoughts on his assumption, inductions, and logic -- which I strongly disagree with -- isn't his attempt to publicly guess and announce my my name a violation of policy? Thanks for you comments. Gni (talk) 19:15, 18 March 2008 (UTC)

Based on the recent history, it certainly appears that you are merely hunting through EVERYTHING that Boodles has done and everything he does in the hopes of finding some sort of "impropriety" that you can make "stick". Look, stop trying to seek revenge against him because you consider him some sort of enemy. This is stalking and is wrong. Instead, return to editing articles, though I would avoid editing the CAMERA article, or any articles related to that one, as your edits there have gotten you into some trouble in the recent past. --Jayron32.talk.contribs 20:14, 18 March 2008 (UTC)

I was all ready to point out exactly why this doesn't violate policy, but what do you know, my addition didn't stick. I guess we have no choice but to ban Boodlesthecat. —Random832 20:40, 18 March 2008 (UTC)

I wish people would learn to handl conflict of interest suspicions sensibly. Just email info-en@wikipedia.org and ask one of the nice volunteers to sort it all out. --Anticipation of a New Lover's Arrival, The 20:48, 18 March 2008 (UTC)

If you think COI/N is not an appropriate process, where were you during the MFD? —Random832 20:49, 18 March 2008 (UTC)

The User talk page for every IP editor includes a WHOIS link at the bottom on which anyone can click. In this case, the WHOIS information is decisive regarding the organization from which access to Wikipedia occurred, though not about the particular individual who edited. Since Wikipedia continues to make that button available, there appears to be a consensus that it has value and should be kept. There is more information about this case at the COIN report. Personally, I would prefer that Boodlesthecat not speculate publicly in such detail about this editor's identity, but the tie connecting the IP edits (discussed more clearly at COIN) to the CAMERA organization is clear. EdJohnston (talk) 22:32, 18 March 2008 (UTC)

HolyMuslimWarrior (talk · contribs)

The name of this user speaks for itself, and their userpage says, in particular: "I believe Zionism is a poisonous cancer to this world, and is the greatest obstacle to world peace. I do not like fake Muslims, who profess to be Muslim but do not reflect Islam in their behavior (hypocrites)." The contribution history reveals the following:

• creation of a talk page section titled "Damn Shia"[85] and beginning with "The Shia are notorious for forging hadiths, making things up, passing along innovations and mixing in legends and outright lies and treating it like factual information..."
• creation of a talk page section titled "Do the Jews own Wikipedia too?"[86]
• addition of a statement suggesting that the United States is controlled by the Jews: "Some have suggested that the shape of these stars resembles a Jewish Star of David, which would imply a conspiracy involving Jewish control of the American government."[87]
• repeated removal of well-sourced factual material on spurious grounds[88][89][90]

The timing of contributions suggests this account is probably a sleeper sock, but I leave it to more experienced people to suggest who might be the puppeteer. Beit Or 20:51, 18 March 2008 (UTC)

Sock or not, I think the biggest issue is whether or not the account is potentially disruptive. The username itself is on the fringe on violating policy. Wisdom89 _{(T / ^C)} 21:06, 18 March 2008 (UTC)

The username and the nature of the user's contributions are such that an indefinite block is warranted. Ice Cold Beer (talk) 21:08, 18 March 2008 (UTC)

Indeed, the removal of sourced content like that warrants warnings and a report to WP:AIV anyway. Wisdom89 _{(T / ^C)} 21:10, 18 March 2008 (UTC)

I have blocked him indefinitely. -Jéské ^{(v^_^v Detarder)} 21:17, 18 March 2008 (UTC)

Seconded. bibliomaniac15 Midway upon life's journey... 21:46, 18 March 2008 (UTC)

I second that as well. I asked the user to change the username way back but the user completely ignored me. --Be happy!! (talk) 00:16, 19 March 2008 (UTC)

As do I. ···日本穣^{? · Talk to Nihonjoe} 00:27, 19 March 2008 (UTC)

Too disruptive - the name, the incivility, the trolling, the drama. I endorse the block. Bearian (talk) 00:34, 19 March 2008 (UTC)

He's starting to make unblock requests; I declined his first one as trolling (for the record, my genetic mix is Irish/German/Cherokee). -Jéské ^{(v^_^v Detarder)} 00:46, 19 March 2008 (UTC)

Has there ever been an editor who uses the phrase "baseless lies" in a non-ironic manner worth keeping around? JuJube (talk) 01:01, 19 March 2008 (UTC)

Baseless lies, check. "Jewish Wikipedia editors", check. Yup what we've got here is a conspiracy...a C-O-N...spiracy. :) Wildthing61476 (talk) 01:10, 19 March 2008 (UTC)

Vandalism

The article Cone sisters is being vandalized by a group of related IP addresses. Can someone please look at the pattern of ip addresses being used. Wanderer57 (talk) 21:03, 18 March 2008 (UTC)

Activity and anons suggest a single individual with a dynamic IP. I would revert block ignore for now. If it gets really disruptive, request semi protection at WP:RFPP. Wisdom89 _{(T / ^C)} 21:09, 18 March 2008 (UTC)

They all resolve to the Palo Alto School District, and based on this, probably to Gunn High School. Corvus cornix_talk 21:38, 18 March 2008 (UTC)

Vandalism to Random Archive Pages

Some random IPs (all different) are going around to archived pages replacing content with "(random characters) Cool bro" (example and another example). I'm not sure whether this is a coincidence or what? --EoL talk 21:21, 18 March 2008 (UTC)

I've just encountered three anonymous users vandalizing users' Talk pages and, in particular, users' Talk page archives, replacing the content with a random string of characters followed by "cool, bro!" They all resolve to AT&T, and they keep changing IPs rapidly, so rapidly, in fact, that two edits in the Recent changes were back to back vandalisms in the same vein by different editors, which makes me wonder if this is some sort of coordinated attack, or else some amazingly fast address jumping. The three I've encountered so far are: 68.94.114.62‎ (talk · contribs · deleted contribs · filter log · WHOIS · RBLs · block user · block log), 75.18.48.96‎ (talk · contribs · deleted contribs · filter log · WHOIS · RBLs · block user · block log) and 71.142.0.218 (talk · contribs · deleted contribs · filter log · WHOIS · RDNS · RBLs · http · block user · block log). Corvus cornix_talk 21:25, 18 March 2008 (UTC) ‎

My money's on coordinated attack given the timing you state above. -Jéské ^{(v^_^v Detarder)} 21:26, 18 March 2008 (UTC)

Same vandalism from this one 84.65.198.195 (talk · contribs · deleted contribs · filter log · WHOIS · RDNS · RBLs · http · block user · block log) now blocked.— Ѕandahl 21:32, 18 March 2008 (UTC)

They're now moving on to other types of archives - [91]. Corvus cornix_talk 21:28, 18 March 2008 (UTC)

Just struck again on recent changes, [92]. AndreNatas (talk) 21:29, 18 March 2008 (UTC)

I've noticed this, too (apparent from the ANI post I made just before yours). They'll get tired eventually (I hope). Until then, I'll rollback whatever I can. --EoL talk 21:29, 18 March 2008 (UTC)

There's been a considerable increase in open proxy spambot and vandalbot activity such as this in the past few days. They are mostly zombies. Look out for "nice site!"[93] too. -- zzuuzz ^(talk) 21:31, 18 March 2008 (UTC)

Also 24.47.55.108 (talk · contribs · deleted contribs · page moves · block user · block log) who I just warned before seeing this on ANI, should we block them instead? Georgewilliamherbert (talk) 21:33, 18 March 2008 (UTC)

I would say block them immediately, for how long is a matter of opinion. -- zzuuzz ^(talk) 21:36, 18 March 2008 (UTC)

You could probably get away with a year-block as a {{zombie proxy}}. --EoL talk 21:55, 18 March 2008 (UTC)

On that note, how do we know they're zombies, and not misconfigured or regular open proxies? Nwwaew (Talk Page) (Contribs) (E-mail me) 01:57, 19 March 2008 (UTC)

Potential COI / sockpuppets / meatpuppets again at American Apparel

For the past week I've been dealing with likely WP:SOCK, WP:MEAT, and/or WP:COI editors over at the American Apparel and Dov Charney articles. Without more I can't prove it, but it looks like it may be American Apparel officials (or people meatpuppetting for their cause) trying to game Wikipedia again.

The problem started in November when a company PR person editing as User:Leftcoastbreakdown manipulated the articles to add fluff and downplay controversy (see the old AN/I incident here) The editor was warned and went away, and things were quiet until March 11 when a cadre of editors showed up to slant the article again with the same goals and tactics. The COI and SOCK editing is a problem in its own right. On the substance they've been inserting unverified material, edit warring while refusing to discuss on the talk page, making BLP attacks on the company critics, inserting and re-inserting WP:NONFREE violations, adding argumentative synthesis and analysis, etc.

I chronicled these issues at Talk:American Apparel#COI +POV watch: 6 named accounts and 9 anonymous IP editors editing in unison. Two have names matching American Apparel officials, and two made edits directly indicating they are using IP socks. All are WP:SPAs who joined Wikipedia recently to edit war on these two articles, and most are from the Los Angeles area where the company is headquartered. They're getting bolder and I can't continue without violating WP:3RR so it's time to act. Is that enough to go on or is there an intermediate step I should take before administrative action? Should I file for a WP:SSP, WP:CHECK, or WP:COIN? Thanks, Wikidemo (talk) 21:36, 18 March 2008 (UTC)

Have you discussed this at WP:COIN? Corvus cornix_talk 21:39, 18 March 2008 (UTC)

No, not yet. I was wondering where to go next. The sock/meatpuppet issue is more certain and a lot easier to prove than COIN. It's possible these editors are not officially sponsored by the company (e.g. somebody adopted the company officials' names as a hoax). Also it would be good to have a sanity check to make sure I'm not just seeing things. Wikidemo (talk) 21:49, 18 March 2008 (UTC)

A COI can't always be proved, but a pattern of promotional editing should be clear. There is an all-purpose clause in WP:COI that allows blocking for a consistent pattern of such editing:

Accounts that appear, based on their edit history, to exist for the sole or primary purpose of promoting a person, company, product, service, or organization in apparent violation of this guideline should be warned and made aware of this guideline. If the same pattern of editing continues after the warning, the account may be blocked.

In such a case you would try to get a discussion going with the editor, and if you could get no response after warnings, you might need to issue blocks. Since discussions may take time, the advantage of making a report at WP:COIN is that it would stay up for several days and you could collect some data. Here, anything is usually gone 24 hours after the last edit. EdJohnston (talk) 02:03, 19 March 2008 (UTC)

Update - an American Apparel executive has admitted that two employees have been editing the article, but denies any knowledge of any of the other meatpuppet / sockpuppet accounts.[94][95] This is stunning to me considering they did this only four months ago, and (thanks in part to me) they got off incredibly easy with nothing but a warning, at a time when companies were earning national headlines for editing their own articles. Since the COI is now confirmed it's probably time now to sort things out and clean up the mess. Not sure at what point we need to run a checkuser but that's probably the only thing that would lay to rest any questions of just how far this went. Unless anyone says otherwise I'll take this to WP:COIN as the next step. Thanks all. Wikidemo (talk) 04:21, 19 March 2008 (UTC)

This should also be examined in relation to BLP, the whole 'he's a sex perv' angle being edit-warred over probably violates our BLP standards. ThuranX (talk) 04:29, 19 March 2008 (UTC)

• You should have first filed a request for review at WP:SSP, then filed the checkuser request and wrapped this whole thing up with a posting to COIN so that more people can monitor the page. It's obvious that it's either the same guy or a group of very closely minded people working together to insert a bias. Even without their connection to the company, they've still acknowledged that they're violating POV and said they don't intend to stop. You don't have to worry about getting permission to begin the process, this is the reason we have one. Cumulus Clouds (talk) 07:55, 19 March 2008 (UTC)

• I can confirm the COI issues. There's an OTRS complaint that I am working on right now that concerns the bio. So please be sure that everything is sourced and that the sources are good ones. John Reaves 08:14, 19 March 2008 (UTC)

Issues with Microprose and user EconomistBR

There has been a series of events at the MicroProse entry that leads me to believe user EconomistBR has recently operated on WP:Ownership, and has also now engaged in disruptive editing. He has now taken the History of Microprose entry and edited it to become his original version of the MicroProse entry, retitling it and and subsequently editing all appearances of MicroProse wikilinks in other Wikipedia entries to point to that entry. I have tried to engage with the user and explain things to work them out, as can be seen on the MicroProse talk page, and this was his response. I would like some form of administrator intervention in this matter, as his actions moved it beyond a simple content dispute. --Marty Goldberg (talk) 21:45, 18 March 2008 (UTC)

That's wrong, Marty Goldberg has had total freedom to edit that page in whatever way he desires without any opposition or discussion.

User Marty Goldberg has been accusing me of WP:Ownership, that's in incorrect I've accepted all edits made so far. Over 40 edits have been made to that article in March alone, I've only reverted once.

User Marty Goldberg is operating on WP:Ownership since he only accepts edits made by him or by User:Microprose itself. I edited that page 3 times, in all of them user Marty Goldberg altered my edits.

MicroProse Software Inc and MicroProse Systems LLC are 2 different companies, he wants to pretend that they are the same company. MicroProse Software Inc ceased to exist in 2001. This company didn't simply change its name or change owners it ceased to exist completely.

The fact is that an entirely new company under the name MicroProse has appeared, so distinction is important, otherwise we're mixing their corporate histories.⇨ EconomistBR ⇦ Talk 00:27, 19 March 2008 (UTC)

All of that is completely untrue, the only thing I've edited of yours is a statement you added that did not follow NPOV and whose wording was done in direct spite of the conversation on the talk page. Everything I've stated is fact and easily verified by looking at your edit history vs. the history of the conversation on the talk page. Likewise, the properties transfered to a new company, that simple - it did indeed change owners. --Marty Goldberg (talk) 03:04, 19 March 2008 (UTC)

Untrue??? Let's analize my claims then:

1. "Marty Goldberg has had total freedom to edit that page in whatever way he desires without any opposition or discussion". Fact
2. "Over 40 edits have been made to that article in March alone, I've only reverted once". Fact
3. "I edited that page 3 times, in all of them user Marty Goldberg altered my edits". Fact
4. "MicroProse Software Inc and MicroProse Systems LLC are 2 different companies". Fact
5. Marty Goldberg"wants to pretend that they are the same company". Plausible

My claims reflect the truth and are correct. Now your claim:

• "the properties transfered to a new company". Incorrect, absolutely incorrect, and you know it.

The Civilization franchise, the Railroad Tycoon franchise belong now to different companies. Hence they weren't transfered to MicroProse Systems LLC. Besides those 2 big intellectual right losses is not yet know which intellectual right properties, if any, were transfered to MicroProse System LLC together with the brand MicroProse. This fact of property right losses further reinforces the need for a distinction between MicroProse Software Inc and MicroProse Systems LLC. ⇨ EconomistBR ⇦ Talk 04:14, 19 March 2008 (UTC)

Once again the name and the properties not sold off by Infogrames/Atari Interactive have transfered, the new company is the holder of these, that is indisputable and not at issue here. Arguing about what properties they were able to purchase is also not the issue and has little to do with the brand being transfered to this newer company. Other companies also have had multiple corporate holders as you've been pointed out, or ceased to exist for a time and come back and their entries here have not been held to your viewpoint on the need to differentiate by recreating completely separate entries rather than just identifying the difference in corporate name. Other editors simply have not shared these viewpoints. What the issue is, is your conduct, which you've continued to demonstrate here. Unlike your growing and ever changing list of attempted counter-accusations, I said they are one in the same line of companies owning the Microprose brand, which they are. You keep trying to say otherwise, making further accusations about me, that company, etc. and claiming "fact" because you say so. You've claimed I've been editing without any opinion or discussion....and I suppose I've been imagining the entire talk on the discussion page and here....or if I really wanted to edit without opinion or discussion I could have just taken the same route as you and completely reproduced my version in another article and subsequently change all links in other entries to point to that one as your edit history shows you have. Finally, once again, I've done nothing editing wise you're claiming I have and once again the edit history clearly shows this. Your "3 edits" were a) A fact tag you put on an alternative company name (that someone else put there) that you considered dubious, to which I rewrote the paragraph to remove the dubious name in question, and to further differentiate the corporate names as you requested on the talk page. b) A removal of a link from the external links section (which you were right to remove from that section per WP:EL) that someone else had put there, which I thought might have worked better context wise as a reference within the article and proceeded to use as a reference, c) A paragraph consisting of an arbitrary list of demands you wanted answered by Microprose on the talk page, which when they were not answered to your liking you decided to turn it in to a paragraph in the article, which violated NPOV and WP:OR. "MicroProse Systems LLC states that software development has begun, there is however no information available about which games are currently under development or about which platform those games are for or about the location of MicroProse's new development studio." All the same things you demanded responses for on the talk page, and as the edit history clearly shows, you ran to the main page in spite when you didn't like the answers you were getting. You could have also added "Have not announced a CEO, have not given their office location, have not stated what retailers are carrying their software,..." and a plethora of other arbitrary statements, which shows the actual nature of that paragraph. Rather than delete the paragraph completely, I compromised (as I have attempted to do throughout) and conveyed your concern with the much more neutral and less rambling "They have also stated software development has begun, however no further information is currently available." So where is the sinister context you're trying to paint these edits in to claim ownership on my behalf? Ownership on my part would be if I just reverted everything you did, or say...just recreated everything I wanted in this article in another article instead to try and circumvent any consent issues. Honestly, your attempts to try and throw this back on me are thinly veiled, and the attitude which prompted the filing of this incident report is shining through. There is no discussion with you, there's just running around in circles and getting more accusations thrown. This will be my last response on this page, as I'm not interested in being any more of a part of this ridiculous and disruptive volley that you've instigated here and on the microprose talk page. I can only hope for once you can resist the urge to continue your conduct and post yet more of the same content here. I believe the admins have everything they need to go on at this point, and any further back and forth would simply further obfuscate the issues. --Marty Goldberg (talk) 05:42, 19 March 2008 (UTC)

Soccermeko, one more time

Resolved

 – Blocked... --Jayron32.talk.contribs 00:31, 19 March 2008 (UTC)

Judging from Nicolewrayeditor's contributions, it's probably time for a preemptive strike (or at least careful monitoring. Methinks he doth protest too much.Kww (talk) 00:10, 19 March 2008 (UTC)

Yeah, it's Soccermeko. Rule number one of sockpuppet accounts: Don't make your FIRST edit ever a denial that you are a sock puppet. Don't deny crimes you aren't accused of... Jeesh. They have been duly blocked... --Jayron32.talk.contribs 00:31, 19 March 2008 (UTC)

USS Potato Salad and other vandalisms.

I know a few people at my college that have taken upon themselves to vandalize the Potato Salad article with nonsense about a fictional ship they found online, which I corrected: [96]. Someone reverted my edit, and I re-reverted it: [97]. After I reverted the article the first time, Matt vandalized my user and usertalk pages: [98] and [99]. I yelled at him about it, in person a few minutes ago, but I doubt he will stop. I also just left a message on his talk page about it: [100]. And I am 100% sure that the IP address 68.13.207.235 is not a sock of Matt's. He/she probably just thought that I had wrongly reverted a good edit. Also, Matt lives in Virginia (like the rest of us), while the IP is from Georgia. Take that back, he also is from Virginia, based upon a different IP locater, but not from the college. He/She probably isn't involved. Perhaps the admins can do something about it, as I don't want to get caught by 3RR.

And the "threat to punish" is nothing serious. He had a twinkle in his eye when we talked. Rebelyell2006 (talk) 00:25, 19 March 2008 (UTC)

Forgot to mention that it was also added to the List of mine warfare vessels of the United States: [101]. Rebelyell2006 (talk) 00:30, 19 March 2008 (UTC)

You will never be "caught" by 3RR for removing vandalism. If you're in doubt then take it to the talk page, but here there really is no doubt. All Wikipedians should remove with extreme prejudice any content that is purely fiction, or made in bad faith to deceive readers. --PeruvianLlama^(spit) 01:28, 19 March 2008 (UTC)

Sockpuppet case

User:24.127.22.57 started vandalizing Honus Wagner at 00:36. User:Boys beware was created at 00:38 and vandalized the same page at 00:41. User:David willham was created at 00:39 and joined in on the vandalism at 00:42. I blocked both accounts and the IP address (WP:DUCK, obvious sockpuppets). Things were moving so quickly that I may have messed something up and just wanted to check in here and ask if any other admins wanted to double-check my work. Useight (talk) 01:10, 19 March 2008 (UTC)

Looks 100% right to me. Good catch. ➨ REDVEЯS is a satellite and will be set alight 10:16, 19 March 2008 (UTC)

Please unblock User:CreepyCrawly

CreepyCrawly (talk · contribs · deleted contribs · logs · filter log · block user · block log)

CreepyCrawly registered his account in November 2006 and made one edit. Since then, he claims he has edited anonymously. He logged in on March 15 in order to bypass semiprotection on the global warming article. He made a few edits disputing the notion that the global warming trend is agreed upon by the "overwhelming majority" of scientists, and was quickly drawn into a brief revert cycle and a talk page discussion. That same day, Raul654 blocked him indefinitely as a probable sockpuppet of the banned user and prolific sockpuppeteer User:Scibaby. Since then, he has made three unblock requests, all declined, and Raul654 has tried to rebuff arguments I've made in CreepyCrawly's defense. I have agreed to advocate for CreepyCrawly, and he has agreed to allow me to argue on his behalf. Since Raul654 did not unblock after I appealed to him, my next recourse is to this noticeboard.

Raul654 has reported that checkuser does not link CreepyCrawly to Scibaby's socks, but on the other hand, Scibaby has been using anonymous proxies. The upshot is that checkuser can't help us here. We're left with the duck test.

I've noticed differences in the writing style between CreepyCrawly and Scibaby: compare edit summaries to global warming and you will notice a difference in tone. CreepyCrawly seems familiar with some policies and guidelines, but that is understandable for someone who has been editing for more than a year, and he has written that he read talk page discussions and policy pages. The arbitration committee has ruled unequivocally that familiarity with policy as a newbie does not indicate that a new user is a sockpuppet of anybody. Remember what happened to User:!!, who was blocked for just 75 minutes? CreepyCrawly has been blocked for three days, and he's still waiting to be proven innocent.

I've assembled as much evidence as I can on my user subpage: User:Shalom/Drafts and archives/CreepyCrawly. Please read it, along with User talk:CreepyCrawly, and draw your own conclusions. Wikipedia:Assume good faith means, at a bare minimum, that we assume users are innocent until proven guilty. I believe that CreepyCrawly is innocent. If I could, I would unblock him myself. But I can't. Someone needs to step up and do the right thing.

Let me note, in passing, that I commend Raul654 for responding so aggressively to Scibaby's numerous disruptive sockpuppets. Without him, anarchy would have engulfed Wikipedia's coverage of global warming long ago. Nevertheless, if Raul654 continues to believe that CreepyCrawly is a sockpuppet, than someone else needs to come forward, undo the block, and state unequivocally that CreepyCrawly is unrelated to Scibaby.

Someone please do me a favor and let Raul654 know about this discussion. I'll be going to sleep now, and I won't see how people respond until tomorrow. Shalom (Hello • Peace) 01:58, 19 March 2008 (UTC)

I admit that I don't find the duck test persuasive here. Is the I.P. that CreepyCrawly is agreed to have used - 70.105.244.192 - an open proxy? If not, is it geographically related to Scibaby's non-open proxy I.P.s? Sarcasticidealist (talk) 02:12, 19 March 2008 (UTC)

I don't know if he is a sock of SciBaby, but I'm convinced that he is one of a group of POV-pushing sock or meat puppets. Compare Special:Contributions/CreepyCrawly, Special:Contributions/Spamsham, Special:Contributions/Grecian_Formula, Special:Contributions/Sword_and_Shield. I also have my doubts about his story - his IP address has been stable as far as checkuser can make out, but there are only two edits by the IP address. Where is that long list of non-logged-in edits that lead to him being so familiar with Wikipedia rules and jargon? --Stephan Schulz (talk) 02:20, 19 March 2008 (UTC)

Unfortunately, we have no way of knowing whether CreepyCrawly used the same I.P. throughout. Do we not have any record of Scibaby's non-proxy I.P.s? Also, I certainly agree that the last three of those four are socks of one another, but I don't see the similarity between them and CreepyCrawly. Also, I agree that CreepyCrawly's attitude towards all of this doesn't look promising, but unless we're pretty sure of sockpuppetry, let's give him sufficient rope for a self-hanging. Sarcasticidealist (talk) 02:46, 19 March 2008 (UTC)

Not sure if it's coincidence or what, but User:Creepy_Crawler may be of interest to this discussion. ThuranX (talk) 04:27, 19 March 2008 (UTC)

Just a coincidence. I don't see any relationship at all. And there was User:Kreepy_krawly, a very strange case who also was apparently unrelated. (Is there a cartoon character or something that all these folks are named after?) Raymond Arritt (talk) 04:35, 19 March 2008 (UTC)

So, do editors besides Mr. Schulz and me have opinions on whether or not this meets the duck test? Sarcasticidealist (talk) 04:48, 19 March 2008 (UTC)

I applied the Obedium-test and it came back positive (you know, like the turing test...jk) What really does it is the excitement about getting his ip snooped. Lets not forget that checkuser cannot be used to prove innocence because of proxies, and to me, its a red flag big time. Now, creepy's familiarity with sock procedure could have come about during the claimed anon editing period, but it is very unlikely that it would have come if he was a casual editor as opposed to an editor who works on a set of articles constantly (thats how you get the drama.) At least in my experience, I did not become familiar with this sort of thing until I became more of a project worker (Nicaragua, GW.) Finally, how did he know that Raul ("your friend") was going to snoop the IP? In this thread he seems to know who the checkuser is even before anything went down. Raul did a good job on creepy's page on showing some evidence, on the mean time, I will see if I can match a diff 100% to a prior sock. Brusegadi (talk) 04:52, 19 March 2008 (UTC)

• Do I believe Creepy Crawly's story? No. I've heard variations on the same so many times that it simply rings hollow. Guy (Help!) 11:14, 19 March 2008 (UTC)

Infinite block of Majorly by East718

All useful discussion now on appropriate talk page; no need to further propagate needless wikidrama. —Kurykh 03:10, 19 March 2008 (UTC)

Rampant pagemove vandalism

Can administrators please help urgently repair this? скоморохъ 02:15, 19 March 2008 (UTC)

That really calls into question the reason for unblocking Seand59 (talk · contribs) January 15, 2007; there's got to be a story behind that, no? Sarcasticidealist (talk) 02:22, 19 March 2008 (UTC)

Oh, never mind - different users. Sarcasticidealist (talk) 02:23, 19 March 2008 (UTC)

Huh? No, looks like you were right the first time. Seand59 was unblocked and recently became Grawp (talk · contribs). Compromised account perhaps? —Wknight94 (talk) 02:25, 19 March 2008 (UTC)

Oh, I see now too. User was renamed and then Grawp took the old username. Odd. —Wknight94 (talk) 02:27, 19 March 2008 (UTC)

"19:57, January 15, 2007 User:Danny unblocked User:Seand59 ‎ (really foundation staff)"

apparently...скоморохъ 02:29, 19 March 2008 (UTC)

After a rename, the block log stays with the old name. —Wknight94 (talk) 02:34, 19 March 2008 (UTC)

Actually, there is a bug that prevents block logs moving during renaming and renames are generally not performed where this will lead to that information being lost. Tiptoety ^talk 04:23, 19 March 2008 (UTC)

Can the edit history be redacted to take out the link to the website on each edit? Nate • (chatter) 02:33, 19 March 2008 (UTC)

Probably not worth it. Grawp would do this constantly if we went to that much trouble. —Wknight94 (talk) 02:34, 19 March 2008 (UTC)

I would assume this site is at the very least blacklisted though? Nate • (chatter) 02:38, 19 March 2008 (UTC)

It is. Mr.Z-man 03:23, 19 March 2008 (UTC)

Relentless spammer

Posting here because this might be too complex for AIV or speedy deletion...JoshuaJude (talk · contribs) is a single purpose account who has done nothing but add spam about himself and the websites/organizations he has created. The affected articles are Tucson, Arizona Community Organizations, Heptagram, Decriminalization of non-medical marijuana in the United States, List of people from Tucson, Arizona, Video game culture, and essentially every other page in his edit history. He recently created a page on himself, Joshua Jude Chesser. He was even blocked in october for spamming, but that was overturned after he claimed he wasn't aware of policy. I'd presume he understands it now, and he's even using an army of IPs to add spam about himself, I think it's about time he got blocked with severe prejudice, and the article about himself deleted. Someguy1221 (talk) 04:33, 19 March 2008 (UTC)

I've blocked indef. on the basis of spamming numerous articles with his biographical information and that of his "company", and for abusing varying IP addresses after I had given him notice previously of such infraction. seicer | talk | contribs 06:18, 19 March 2008 (UTC)

Where is my posting?

I posted a thread here on this page on March 15 or so (I believe) entitled "Abuse by an Admin" (or some such). Where did that disappear to? Why did it disappear? And where is it? Thanks. (Joseph A. Spadaro (talk) 05:47, 19 March 2008 (UTC))

It was posted on March 15, and it was titled "Abusive Administrator". Thanks. (Joseph A. Spadaro (talk) 05:48, 19 March 2008 (UTC))

Your thread is archived here. There seemed to be a consensus that no admin abuse actually occured. Someguy1221 (talk) 05:53, 19 March 2008 (UTC)

WP:UFA

There's a backlog if someone wants to head over that way. Gracias. AgnosticPreachersKid (talk) 10:20, 19 March 2008 (UTC)

User:Mikehunt11

Just noticed this user making vandalism edits such as this and this. Does his name imply that there have been 10 other "Mikehunts" before him? Is there a way to block the creation of new usernames MikehuntXX? Ed Fitzgerald (unfutz) ^{(talk / cont)} 12:15, 19 March 2008 (UTC)

Added "mikehunt" to User:HBC NameWatcherBot/Blacklist - 52 Pickup (deal) 12:19, 19 March 2008 (UTC)

There is certainly a User:Mikehunt, but that was a SPA that was only active in 2005. - Caribbean~H.Q. 12:20, 19 March 2008 (UTC)

I would like to point out that there are no other mikehunt's before this one, numerically speaking. [102] --ÐeadΣyeДrrow (Talk | Contribs) 12:21, 19 March 2008 (UTC)

There are a lot after "11" that need to be checked, "12" for example. - Caribbean~H.Q. 12:23, 19 March 2008 (UTC)

We should probably watch out for "Mike Hintz" [103] as well. I will begin blocking the vandalism only SPAs. - Caribbean~H.Q. 12:33, 19 March 2008 (UTC)

• Several of these blocked per WP:UN, User:Mikehunt11 blocked as a sock of Mikehunt21 (talk · contribs). --Rodhullandemu (Talk) 12:35, 19 March 2008 (UTC)

I just finished blocking several vandalism-only "Mikehunts" as well as issuing UN blocks to some inactive accounts that may be sleepers, nothing better than a game of Whac-A-Mike in the morning. The only account that remains is "Mikehunt", wich I believe should be tagged as the puppeter of all these other "Mikes". - Caribbean~H.Q. 12:54, 19 March 2008 (UTC)

The name is UUA blockable anyway. Now, I have an appointment with Mr Jass and Mrs Huggenkiss Will ^(talk) 12:57, 19 March 2008 (UTC)

Possible sockpuppet?

User:Meucci was idefinitely blocked, partly for making disruptive edits to Alexander Graham Bell. Now, a new user, User:Beppinu, is making the same edits, in almost exactly the same words: Beppinu, compare Meucci. Could be two people with the same idea, or it could be Meucci evading the block. Another question, is this related to the appearance of Use:Mikehunt11 on the same article, making the kind of vandalistic edits that Meucci also made? Did Meucci decide to come back under two names, one to make defensible edits, and one to vandalize? Ed Fitzgerald (unfutz) ^{(talk / cont)} 12:31, 19 March 2008 (UTC)