Jump to content

Wikipedia:Administrators' noticeboard/Incidents: Difference between revisions

From Wikipedia, the free encyclopedia
Content deleted Content added
Reneeholle (talk | contribs)
→‎Harassment by Sethie: user cult free is the problem, not sethie
Line 1,129: Line 1,129:


The conflict of interstest page asserts that "Revealing the names of pseudonymous editors is in all cases against basic policy." And yet an editor named Boodlesthecat is attempting to do just that. See [http://en.wikipedia.org/w/index.php?title=Wikipedia%3AConflict_of_interest%2FNoticeboard&diff=198909266&oldid=198898068 this diff]. Putting aside my thoughts on his assumption, inductions, and logic -- which I strongly disagree with -- isn't his attempt to publicly guess and announce my my name a violation of policy? Thanks for you comments. [[User:Gni|Gni]] ([[User talk:Gni|talk]]) 19:15, 18 March 2008 (UTC)
The conflict of interstest page asserts that "Revealing the names of pseudonymous editors is in all cases against basic policy." And yet an editor named Boodlesthecat is attempting to do just that. See [http://en.wikipedia.org/w/index.php?title=Wikipedia%3AConflict_of_interest%2FNoticeboard&diff=198909266&oldid=198898068 this diff]. Putting aside my thoughts on his assumption, inductions, and logic -- which I strongly disagree with -- isn't his attempt to publicly guess and announce my my name a violation of policy? Thanks for you comments. [[User:Gni|Gni]] ([[User talk:Gni|talk]]) 19:15, 18 March 2008 (UTC)
:Based on the recent history, it certainly appears that you are merely hunting through EVERYTHING that Boodles has done and everything he does in the hopes of finding some sort of "impropriety" that you can make "stick". Look, stop trying to seek revenge against him because you consider him some sort of enemy. This is stalking and is wrong. Instead, return to editing articles, though I would avoid editing the CAMERA article, or any articles related to that one, as your edits there have gotten you into some trouble in the recent past. --[[User:Jayron32|Jayron32]].[[User talk:Jayron32|<small>talk</small>]].[[Special:Contributions/Jayron32|<small>contribs</small>]] 20:14, 18 March 2008 (UTC)

Revision as of 20:14, 18 March 2008

    Administrators' noticeboard/Incidents

    This page is for urgent incidents or chronic, intractable behavioral problems.

    When starting a discussion about an editor, you must leave a notice on their talk page; pinging is not enough.
    You may use {{subst:ANI-notice}} ~~~~ to do so.


    Closed discussions are usually not archived for at least 24 hours. Routine matters might be archived more quickly; complex or controversial matters should remain longer. Sections inactive for 72 hours are archived automatically by Lowercase sigmabot III. Editors unable to edit here are sent to the /Non-autoconfirmed posts subpage. (archivessearch)


    Harrassment from probable RichSatan sockpuppets

    WP:HARASS states that "Harassment is defined as a pattern of offensive behaviour that appears to a reasonable observer to have the purpose of adversely affecting a targeted person or persons, usually (but not always) for the purpose of threatening or intimidating the primary target. The intended outcome may be to make editing Wikipedia unpleasant for the target, to undermine them, to frighten them, or to discourage them from editing entirely."

    User:RichSatan and these IPs (which all resolve to the same company on the same street, in the same town, in the same county in the UK) has been making ad hominem and generally harassing trolling comments on Talk:Games Workshop. The purpose of these remarks is to remove User:Cailil from the discussion.

    RichSatan (a confirmed Sockpuppeteer[1] and a user with a history of ad hominem attacks[2][3]) blames me for the policy based removal of unsourced and unsourcable "comments and Criticism" from the Games Workshop article[4]. A number of IPs from Exeter, in Devon (UK), have over a period of nearly a year made the same trolling remarks a) about me and b)insisting on the reinclusion of unsourced original research. If RichSatan had not used sock puppets this would be a content dispute but it is now a behavioural issue and in my view a case of harrassment.

    Both RichSatan and these IPs claim I am on a "one man crusade" to remove criticism from this page for reasons other than site policy. This is not the case. The material is OR and unsourced. Also consensus has been reached a number of times. An RFC[5] was opened specifically in the matter and previous to that Sir Fozzie was ask for a sysop review of my behaviour[6]. On both occasions the community has pointed out to RichSatan and these Exeter IPs that my behaviour is proper and defined by site policy. (For those wishing to verify the content issue see here This is also a direct link to the unsourced comments and criticism these IPs and RichSatan demand be reinstated into the article)

    On Feb 21st User:RichSatan began blanking all references to him on talk pages and in XFDs[7][8][9][10]<link rel="stylesheet" type="text/css" href="http://en.wikipedia.org/w/index.php?title=User:Lupin/navpop.css&action=raw&ctype=text/css&dontcountme=s">iracle_of_Chile&diff=prev&oldid=192702963[11]. He was not only removing comments of his that had been replied to by a number of editors but was altering other users (mainly mine) talk page comments. When this was reverted User:Byaahahaha began engaging in the same behaviour[12][13] . When this was reverted by Sir Fozzie (whom I contacted) Byaahahaha blanked Sir Fozzie's page. That account was then blocked for vandalism and as a probable RichSatan sockpuppet.

    Yesterday IP 91.84.95.68 (from Exter) made the same RichSatan comments to Talk:Games Workshop. I opened an RFCU case to identify whether RichSatan was a sockpuppeteer or note. It confirmed that Byaahahaha is a RichSatan sock-puppet, but made no comment on the IPs (see here). As far as I can see this is a case of WP:DUCK - all these IPs are making RichSatan's comments. All the IPs come from the same ISP in the same location. The problem is that 91.84.95.68 claims that it has never read the page before. Yet like all the other IPs it has made no other contributions to WP. RichSatan and these IPs have engaged in the same behaviour - trying to discredit, intimidate and undermine my editing, demanding that I do not edit the page and stop my "constant involvement". For the record I have not edited Games Workshop in 2008. In fact in the period August 2007 - March 2008 I have made 2 edits to the page. 1 removing link spam (September 2007)[14] the other (on December 10th)[15] in accordance with the findings of the RFC.

    RichSatan's behaviour replicated by the IPs

    Insistence on the inclusion of unsourced criticism at Talk:Games Workshop
    [16][17][18] by RichSatan
    [19] by 91.84.95.68
    [20] by 82.152.179.208
    [21] by 82.152.177.104
    [22][23] by 82.153.198.246
    [24] by 82.152.178.70

    Current situation

    User:Byaahahaha was blocked indef blocked (on Feb 21st[25]) as a vandalism only account and a probable sock of RichSatan. The User:RichSatan is dormant but as yet unblocked for disruption or sockpuppetry (his last edit was Feb 21st[26]). The current Exeter IP is active (User:91.84.95.68) and engaging in the same ad hominem attacks on me and claims of no consensus on Talk:Games Workshop[[27]][28][29]. I'm requesting uninvolved sysop overview and intervention as I think this is a simple case of WP:DUCK - these IPs are probable RichSatan socks and are engaged in a campaign of harassment against me.

    Apologies for the length of this post.--Cailil talk 16:34, 13 March 2008 (UTC)[reply]

    Seeing as it wasn't already, I've added a link to this section to Talk:Games Workshop Darkson (Yabba Dabba Doo!) 19:45, 13 March 2008 (UTC)[reply]
    Thanks for placing that link Darkson.
    Also it might help if a sysop examined whether the main sockpuppeteer account (User:RichSatan) should be blocked and to generally keep an extra pair (or pairs) of uninvolved eyes on the page--Cailil talk 20:13, 13 March 2008 (UTC)[reply]
    I was on from 91.84.95.68 yesterday (I may still be, for that matter). I am not RichSatan. I am based just outside northeast London. Probably my IP looks up to Exeter because that's where Eclipse Internet, my ISP, are based. I wish to repeat and reinforce my objections to Cailil's content edits - there are sourced comments in the referenced section. Notice that my objections are to his edits, not to him personally, and I object to the characterisation of this as ad-hominem. I consider that Cailil is using the ad-hominem rules to defend questionable edits. —Preceding unsigned comment added by 82.152.176.98 (talk) 00:08, 14 March 2008 (UTC)[reply]
    The same user starts a section called "Cailil's constant involvement here"[30] - which claims I'm on a "one-man" crusade" and now they describe it as not being an ad hominem attack? This ANI posting is not about the content - its about the fact that one user - always from the same ISP and same ISP location has been making these same claims and demands since February-March 2007. Using multiple IPs is discouraged. Using multiple accounts to avoid scrutiny is also against site policy. This person has claimed that they only read the page days ago[31], yet their dynamic IP range (91.84.95.68, 82.152.17x.xx and 82.152.1xx.xx) has made the exact same contributions - attacks on me[32][33][34], demands I don't edit the page[35], and insistence on the reinsertion of unsourced and improperly sourced material[36][37]. A carbon copy of User:RichSatan's (again a confirmed sock puppeteer) contributions to the page[38]. This is about sock-puppetry (or perhaps meat-puppetry) not content--Cailil talk 11:32, 14 March 2008 (UTC)[reply]
    Since I am not a "sock puppet", it is not about sock-puppetry - more than one person is questioning you, and you are attempting to dismiss criticism by claiming they're all the same. Again you are attempting to change the subject and attack me until the point where I cannot ignore it. I will ignore it again in the interests of amity but I say again: you cannot expect to continue to act in bad faith and attack me, then make counterclaims in defence. From where I sit, you are making ad-hominem attacks, you are using admin involvement as a threat, you are making questionable edits and you are acting in bad faith. If you continue to do this, I will suggest that you are investigated on suspicion of breaking the rules - not me. Let's make this extremely crystal clear: your abysmal behaviour is being indulged in the interests of amity. I am not under scrutiny here because I have made no edits to the article in question. You are under scruitiny and it is for you to justify your edits. I am the plaintiff here, not the suspect. I will make further comments on the edits in question on the relevant talk page, but I will not be made a victim here. For the record, I have no control over the IP I'm assigned. —Preceding unsigned comment added by 82.152.176.98 (talk) 18:18, 14 March 2008 (UTC)[reply]
    Having been involved with this from the start, I have this to say. I find it likely that the IP's are RichSatan who has been caught sock-puppeting previously, especially with your first edits to the talk page being an attack on the editor who has edited their only a few times in the last six months, and hadn't edited the article at all since December. However without checkuser level proof, I have to Assume Good Faith and leave off things unless there's a a problem. However, I suggest that you leave off attacking Calil, who has been more then fair with regards to the situation. He has correctly applied Wikipedia's core policies (of Neutral Point of View, Verifiability, and Notability especially), and asked for WP:DR via 3rd Opinion and RfC when others would have edit-warred. Please consider yourself warned as to the consequences of your attacks. Discuss the content, not the contributor. SirFozzie (talk) 00:17, 15 March 2008 (UTC)[reply]
    What can I say? I'm willing to undertake any reasonable procedure to verify my identity, but even in that case I can't really prove that I'm not someone you think I am - you're asking me to prove a negative proposition. As such you can warn me all you like, since I am powerless to either obey or disobey. What concerns me about this is that I have offered no attacks upon Cailil whatsoever beyond questioning his edits. If this is a "personal attack" then it is de jure impossible for anyone to ever discuss someone's edits without being accused in this way. Do you not appreciate the problem here? And what on earth do you mean by "discuss the content not the contributor" - doing exactly that (to me!) been Cailil's only contribution here - and I'm the bad guy?! —Preceding unsigned comment added by 91.84.70.216 (talk) 12:30, 15 March 2008 (UTC)[reply]

    During the time that I've worked with Cailil (over a year now), his conduct has consistently met all of Wikipedia's conduct and content standards. Indeed, he is so scrupulously patient and courteous when dealing with incorrigible POV-pushers and sockpuppeteers that I wish he would let me nominate him for adminship. I have checked into the IP editor's very serious allegations, and in my opinion they are spurious. Based upon RFCU results and the IP conduct, I recommend a block. DurovaCharge! 00:40, 15 March 2008 (UTC)[reply]

    I wouldn't call immediately leaping to complain about me on this page courteous or patient, but I had no personal problem with the guy before it happened. It's difficult to express what it's like to turn up fresh to an article, question something that's been done (note - not dive in and start editing!), and immediately be accused of sockpuppetry, but regardless of whather you consider me genuine or not, spare a half-second's thought to how this looks from my perspective. The operative point here is that the admin's review of the removed material does not support summary removal of all of it, a position that is incorrect and will remain incorrect regardless of what you think of me or how much of a reference Cailil is. —Preceding unsigned comment added by 91.84.70.216 (talk) 12:49, 15 March 2008 (UTC)[reply]
    You claim that you've only just found that page. These diffs and the public IP information proves otherwise. The same demand to include the same original research was made over a year ago by the same ISP from the same location (82.153.198.246[39] [40] in March 2007 and 91.84.70.216[41] in March 2008). Every time you come back to the Talk:Games Workshop since June 2007 (after I removed the unverifiable and synthesized section[42]) you have started by attacking me, in the same manner. The only other account that has done this is a proven sock-puppeteer. For the record I asked you to desist from the assumption of bad faith on March 12[43]. But your behaviour continued[44][45][46]. Only then, and only on advice, did I bring the issue here--Cailil talk 13:24, 15 March 2008 (UTC)[reply]
    A further small note. The admin who overviewed the section was Sir Fozzie. If he thought my edits were not supported by his analysis I'm sure he would have corrected me himself. Whereas he has explained to you that the removal of that content is defined by WP's policies (WP:NOR, WP:V)[47]. Secondly consensus was sought and found for its removal, twice--Cailil talk 15:36, 15 March 2008 (UTC)[reply]
    "These diffs and the public IP information proves otherwise" - well, obviously they don't, because I am not RichSatan. Your thesis is self-justifying. I am willing to consider any verification mechanism you find acceptable, but since you are asking me to prove a negative proposition there is probably nothing I can do at this point other restate: I am not he. If I wanted to sockpuppet, I'd walk a hundred yards down the road to the cybercafe and do it from there. The problem we now have is that you have created an atmosphere wherein any future pointing-out of these erroneous edits will be treated as further sockpuppetry, something for which we can all decry RichSatan. This is now a vicious circle which will allow you to dismiss any future support of my position, regardless of the source, on the basis of it being a sockpuppet. In any case, I do not particularly agree with RichSatan. His position is that known fact should be included regardless of verifiability which is quite correctly against site policy; mine is that you have removed verifiable content. Some of it was recently reinserted by someone other than me - are you going to suggest THAT user is RichSatan as well?—Preceding unsigned comment added by 91.84.70.216 (talkcontribs) 16:28, 15 March 2008
    Please don't misrepresent my position by setting-up a straw man 91.84.70.216. "You claim that you've only just found that page. These diffs and the public IP information proves otherwise." The diffs and information above doesn't prove you are RichSatan - it refutes your claim to have read that article for the first time on March 12th 2008. It proves you have been making these demands for the addition of OR for a year. It's proof that this is not the first time you have attacked me personally.
    It's your behaviour that is indicative of a RichSatan sock-puppet. No-one else has claimed or could claim that I have been "constantly involved" on that page - it's just not borne out by the facts. I made 2 edits in 6 months to the Games Workshop article.
    Even if I am wrong about you being a RichSatan sockpuppet you are still harassing me. You have still attacked me and are continuing to do so[48][49][50]. You have never rectified your misleading and incorrect statements - that my editing is "widely criticized". You have never apologized for your demands that I stop editing an article that I have not edited this year--Cailil talk 19:06, 15 March 2008 (UTC)[reply]
    "it refutes your claim to have read that article for the first time on March 12th 2008" - how? Since I really, seriously did read that article for the first time a few days ago, I'd love to see your argument for this. You're just branching off into ever more creative insanity. And I really do resent the comparison: RichSatan was asking for unverified claims to be inserted. I am not. As for attacks, good grief, look at what you are saying to me. Your arrogant presumptiveness is just breathtaking. —Preceding unsigned comment added by 91.84.70.216 (talk) 19:18, 15 March 2008 (UTC)[reply]

    Break down of dynamic IP's disruptive behaviour

    I would appreciate it if an uninvolved sysop would give this evidence a quick review - in regard to my continued harassment. It seems to me to be a case of WP:DUCK as regards sock-puppetry. And if not that a simple case of WP:NOT#BATTLE and WP:HARRASS. The IPs in question are listed above. This current IP user claims not to have read Games Workshop article before March 12th, and is now demanding the reinsertion of OR about prices. As above the same IP range made the same demands and the same personal attacks on me since June 2007. And similarly RichSatan (a blocked sock-puppeteer) displayed the same behaviour.

    The level of incivility I have had to endure from this IP since June 2007 is incredible; I have been accused of COI, I have been repeatedly and personally attacked - culminating yesterday with being called "insane". This IP has made no contributions to wikipedia beyond inserting OR to Games Workshop[51] and making these harassing talk page comments.

    Please note a correction to my earlier statements the IPs actually resolve to London as can be seen in their WHOIS information. The ISP is in Exeter

    Behaviour of this dynamic IP range since March 12th 2008

    Within one week the person using the Eclipse dynamic IPs has

    • Personal attacks against me[52] - called me "insane"
    • Inferred that I have a COI[53]
    • Demanded that I do not edit the article[54]
    • Claimed that I was alone in disputing the inclusion of the OR[55]
    • Demand the reinsertion of OR[56] using a synthesis of old prices and http://www.statistics.gov.uk to prove a price rise above inflation
    • Claimed that I have manipulated site policy[57]
    • Pushing for the inclusion of RPG.net (a web forum) as a reliable source[58]
    Harassment during 2007 by the same dynamic IP range
    • Personal attacks against me[59]
    • Demanded the reinsertion of OR that they admit to writing[60] - using a synthesis of old prices and http://www.statistics.gov.uk to prove a price rise above inflation [61]
    • Inferred that I have a COI[62][63]
    • Claimed I manipulated site policy[64]
    • Pushing for the inclusion of RPG.net (a web forum) as a reliable source[65]
    RichSatan's behaviour
    • Claimed that I was alone in disputing the inclusion of the OR[66] - also accuses me of abusing admin powers (which I don't have)
    • Personal attacks against me[67]
    • Claims I manipulated site policy[68]
    • Demands the reinsertion of OR[69]
    Edit patterns repeated by all 3.
    • Strawman arguments
    • Claims I am the only person disputing the OR
    • Does not sign their comments
    • Demands the reinsertion of OR - especially about price rises above inflation
    • Use of multiple accounts (possibly to avoid scrutiny) - sock-puppetry

    --Cailil talk 19:56, 16 March 2008 (UTC)[reply]

    Harassing users is simply unacceptable. While these IPs are dynamic, efforts should be taken to minimize their ability to behave disruptively. --MZMcBride (talk) 02:00, 17 March 2008 (UTC)[reply]
    What d'you want me to do - respond point by point? Well, OK. Personal attacks against me - I would list all the ways you've attacked and insulted me, but it would take too long. Two wrongs not making a right, let's overlook this and move on. Inferred that I have a COI - Well, you seem to be a fan of WP:DUCK, which I think applies here. Demanded that I do not edit the article - I have not demanded it, I have extremely politely suggested it would make life easier. I have accepted such suggestions myself in the past. My implication here is that for whatever reason you are simply too personally invested in the content of the article to edit it dispassionately, and therefore should not. It's not a criticism, it's just a suggestion. We're all human. Claimed that I was alone in disputing the inclusion of the OR - I have never supported the insertion of OR; I've supported the insertion of good, well-researched content, which has actually since been reinserted by people other than me. Claimed that I have manipulated site policy - Yes. Wikipedia usually calls it WP:GAME - I had no idea there was actually a page on it. I'm sorry if you find this personally insulting but I speak as I find - you can't hide behind "you're being nasty to me!" rules as an excuse for misusing the system in this way. If this were the case, nobody would ever be able to call out bad editing. Again, I reiterate that it seems to me Cailil is trying to misuse the rules to defend questionable edits. I mean, what d'you expect me to do - the only way to refer to the problem is to describe it, and if it's OK for Cailil to bat these criticisms aside as being "ad-hominem" then there's no way to discuss them at all. And yes, I'm damned tired of being accused of sockpuppetry. I've made every concession I can but at some point I'm not going to go and change my ISP because Cailil says so - and it wouldn't prove a thing if I did. Regardless of this Cailil is also required to WP:AGF and has not been subject to admin censure despite his repeated use of this higly ad-hominem argument. One rule for him, one rule for everyone else? —Preceding unsigned comment added by 91.84.70.216 (talk) 11:13, 17 March 2008 (UTC)[reply]

    Thank you for taking the time to look at this MZMcBride. 91.84.70.216 diffs speak for themselves. If you have a specific complaint about me (which you can evidence) please ask a sysop, any sysop, to review it - go to WP:ADMIN and take your pick. And on a point of order I have never asked you to change your ISP--Cailil talk 13:14, 17 March 2008 (UTC)[reply]

    If "a sysop - any sysop" can't see what the problem is from this exchange, it really is beyond my powers of explanation to elucidate. You seem to have an unlimited licence to lie, falsely incriminate, insult, question and criticise people. There's nothing I can do about this other than to point out that under your rules, I should be claiming that MZMcBride is a "sockpuppet" of yours. You seem immune to the irony of this situation, and for that, you will always have my deepest pity. You must be a bloody awful person to work with. —Preceding unsigned comment added by 91.84.70.216 (talk) 18:12, 17 March 2008 (UTC)[reply]
    I haven't lied about anything 91.84.70.216. Please show us the diff where I lied. All I have done is shown is how your dynamic Ip is the same IP that has made the same comments, the same accusations, and the same attacks for over a year. A behavioural pattern replicated by a known sock-puppeteer. Again if you actually have concerns about my edits please take them to any admin--Cailil talk 18:32, 17 March 2008 (UTC)[reply]
    I'm bored with repeating myself. I have demonstrated at least three times what my concerns are with your comments. If you've ignored them to date, there's no reason to assume that saying it all again will help, but here we go, I'll humour you. You have claimed that I attacked you. I didn't. You claimed you don't have a conflict of interest. There is excellent reason to suppose you do. You claimed you hadn't misapplied site policy, which I think it's clear you have. You claimed I "demanded you didn't edit the article". I didn't. You claimed I have wanted OR included. I didn't. All of this is easily established from the text of this very conversation - I don't understand you you can possibly have the brass neck to deny it, as it is quite literally directly in front of you as you are reading these very words. I could go on, but it's pointless: all of this is based on your assumption I'm a sockpuppet, which I'm not even going to bother to deny any longer as you seem intent on acting as if it's the case regardless, even though it's been abundantly proven that you haven't the faintest clue what you're doing. I haven't been to Exeter since the early 90s, for christ's sake.—Preceding unsigned comment added by 91.84.70.216 (talkcontribs) 20:22, 17 March 2008
    If you have concerns bring them to an admin. Show them diffs of the conduct that concerns you. But please don't set-up a straw man. I think RichSatan is probably using this IP. But if not this dynamic IP has been harassing me since June 2007, and making demands for the insertion of Or since March 2007. Please show anything that worries you about my edits to an admin - I don't understand why if you want me investigated "on suspicion of breaking the rules" you haven't ask one admin to do it. Please go ahead and ask--Cailil talk 20:52, 17 March 2008 (UTC)[reply]
    I'm asking now - we know there are several reading this thread. And it's entirely possible that RichSatan is using this IP, or any IP I've been on over the last two weeks. All I'd ask is that anyone who looks at this does so not only from the "anyone who disagrees with Cailil is obviously RichSatan" perspective, but possibly from the "This guy isn't RichSatan" perspective - which, aside from being accurate, makes Cailil look like a right prick. —Preceding unsigned comment added by 91.84.70.216 (talk) 22:51, 17 March 2008 (UTC)[reply]
    Ok,

    IP Blocked

    This is rather more than enough, considering the IP has been previously warned by several administrators about attacking Cailil. 12 hour blocks, and should this IP editor continue, all that will happen is that the IP will meet further blocks. Enough. Is. Enough. SirFozzie (talk) 23:11, 17 March 2008 (UTC)[reply]

    Admin blocked because of questionable use of admin tools; needs review.

    I have blocked Arthur Rubin (talk · contribs · blocks · protections · deletions · page moves · rights · RfA) because, upon review, it seems evident that there was objectionable use of admin tools used in a dispute against another editor. This needs to be scrutinized before proceeding, and protecting the encyclopedia is paramount; in addition, I cannot help but notice that this admin has been blocked three times in the past three months for edit warring. — Coren (talk) 19:28, 15 March 2008 (UTC) (e/c) Further note for the record, the block is set indefinite but the intent is "until such time as things have been reviewed". There is neither significance nor desire in that unbounded duration. — Coren (talk) 19:34, 15 March 2008 (UTC)[reply]

    Unblock now. Dispute is over, admin tools were used once, block by Coren clearly punitive and inappropriate. No reason to block at this time. Christopher Parham (talk) 19:33, 15 March 2008 (UTC)[reply]
    By the way "this needs to be scrutinized before proceeding" is a message you should take to heart before indefinitely blocking other admins who are not an immediate threat to anything. Hasty, unhelpful actions like this fan the flames. Christopher Parham (talk) 19:35, 15 March 2008 (UTC)[reply]
    I was not aware that we got an allocation of tool abuse before something need to be made about it. — Coren (talk) 19:44, 15 March 2008 (UTC)[reply]
    You must be new around here. ➪HiDrNick! 22:15, 15 March 2008 (UTC)[reply]
    There's no allocation; but if the tool abuse was a one-time issue and has obviously stopped, indefinite blocking can no longer be described as preventative. You were welcome to bring up the action here; it's punitive blocking that is inappropriate. Christopher Parham (talk) 19:46, 15 March 2008 (UTC)[reply]

    Could one of you two post some evidence please. We are not mindreaders. Theresa Knott | The otter sank 19:36, 15 March 2008 (UTC)[reply]

    Coren, declining unblock requests of people blocked by you[70] is highly inappropriate, unless they trolled. MaxSem(Han shot first!) 19:39, 15 March 2008 (UTC)[reply]

    (e/c) x 8 To both point above; my mistake. I mostly meant to answer the direct question, and I realize I should have done so outside the context of the unblock template. Will fix immediately. — Coren (talk) 19:44, 15 March 2008 (UTC)[reply]

    If the problem is the single deletion of the opt-out page, then I think this block is both hasty and unnecessary, two things which blocks should not be. I think Arthur Rubin should be unblocked immediately to participate in this discussion, since there doesn't appear to be danger of harm from his actions. Avruch T 19:42, 15 March 2008 (UTC)[reply]

    Just checking the edit history of the MfD. User:Carcharoth explained a policy violation there (diff). If I'd thought of that, I would have said it, but I could just see that it's an unconscionable and possibly illegal "contract". Copying, as well as producing the diff.

    Quoting from this page version (the text has since been removed): "Keep in mind that when you sign this list, you fully are aware that you lose the right to [...] You also lose the right to complain about the bots themselves or the issues they raise." - here the generalised (not the specific) right to complain is not something that can be signed away. We can have a semantic argument over whether we mean complain or criticise, but Wikipedia is a co-operative and collaborative editing environment. Wording such as this, however "voluntary" it is, does not contribute to a collaborative editing environment, because it restricts the possibilities for discussing the bots and what they do. It promotes an environment where bot operators WP:OWN the bots, and contravenes the third of the m:foundation issues: "the wiki process" (we write articles and change community processes by discussion, not by fiat). To sum up: even in principle, people shouldn't be allowed to sign away their rights to make valid comments and criticisms, of a bot or anything (even if that gets labelled as "complaining"). They certainly shouldn't have such rights held to ransom over an opt-out process. Carcharoth (talk) 18:56, 15 March 2008 (UTC)

    Furthermore, although I have separate disputes with beta and the bots ("beta and the bots" would be a good name for a rock band), the number of editors who do not have a dispute with beta is small enough that when I see a clear policy violation by beta, I don't see any reason not to note it.

    Furthermore, I'm not the only one who removed the content from Beta's user page. Apparently someone signed it, then read the page and also found it unconscionable. I think it would be wise to notify User:Obuibo Mbstpo as well as User:Carcharoth of the AN/I thread. I don't want to violate WP:CANVASS. It appears that inciting violations of the pillars is not actually a policy violation, but perhaps it should be. — Arthur Rubin (talk) 19:48, 15 March 2008 (UTC)[reply]

    Arthur Rubin abuse of sysop tools

    I'm in a hurry, work quickly approaching, but here's the basic rundown of issues, hopefully others can expand for me and help explain. I'll clarify anything I may need to when I return from work tonight.

    I believe it's time the community reevaluated his access to administrative tools. LaraLove 19:40, 15 March 2008 (UTC)[reply]

    A.R. seems to have a habit of edit warring, but RFC/arbitration would be better places for this discussion. Christopher Parham (talk) 19:42, 15 March 2008 (UTC)[reply]


    I can see only one bad use of the tools. Maybe this needs an RfC, but there's nothing here meriting desysopping yet. A lot of pointy MfDs, that's all.--Docg 19:43, 15 March 2008 (UTC)[reply]
    I can agree with this summary, and it demands an explanation from Arthur if not more serious proceedings. A block seems totally unnecessary and inflammatory, though. Avruch T 19:44, 15 March 2008 (UTC)[reply]
    I don't have time to build an ArbCase right now, but this is the justification for his well-deserved block. LaraLove 19:46, 15 March 2008 (UTC)[reply]
    Except Arthur's right, Wikipedia should never allow these kinds of agreements to take place (trading one thing for another). Especially trading away ones right to participate in discussion. —Locke Coletc 19:50, 15 March 2008 (UTC)[reply]
    That he is right or not is immaterial; WP:POINT is bad enough without misuse of the tools. — Coren (talk) 19:54, 15 March 2008 (UTC)[reply]
    WP:POINT? How was this misuse, these kinds of pages simply should not exist per my previous comment. —Locke Coletc 19:56, 15 March 2008 (UTC)[reply]
    Deleting pages under criteria explicitly disallowed in userspace, citing IAR (you don't cite IAR, you just use it and if you're good enough, it slips under the radar), and threatening to block under a policy that gives exception to userspaces? Will (talk) 20:04, 15 March 2008 (UTC)[reply]
    How is that page good for the encyclopedia? How does it help the encyclopedia? There's probably a policy somewhere that covers these kinds of "contracts" or "agreements", and I doubt it looks highly on them. Even if there's not, do you really need a policy to tell you what common sense should: We should never tolerate agreements to restrict editing unless they're part of dispute resolution (which this clearly isn't). —Locke Coletc 20:08, 15 March 2008 (UTC)[reply]

    I am unblocking in 3 min, unless someone can tall me what this block is preventing? We can re-block if there's further problems.--Docg 19:47, 15 March 2008 (UTC)[reply]

    (e/c x 11!) I agree with an unblock iff Arthur agrees to lay off the tools until this is resolved. — Coren (talk) 19:53, 15 March 2008 (UTC)[reply]
    I don't believe there is support for requiring that condition. Christopher Parham (talk) 19:55, 15 March 2008 (UTC)[reply]
    Yep, unblock. Take the case to arbcom if necessary. Addhoc (talk) 19:48, 15 March 2008 (UTC)[reply]
    Absolutely. Highly inappropriate block. El_C 19:49, 15 March 2008 (UTC)[reply]
    (ec x8) Looking at the diffs, I agree this should go to LYNCHMOB, if only for a stepping stone to arbitration, as we have no community desysop process. But still, AR's block threat does sound hypocritical, especially as he's had three 3RR this year. Will (talk) 19:51, 15 March 2008 (UTC)[reply]
    You lost me at "agree." El_C 19:53, 15 March 2008 (UTC)[reply]
    It wasn't a reply to you, it was a reply to Avruch and Glasgow - after the fifth edit conflict I got tired of placing the comment midway in. Will (talk) 19:56, 15 March 2008 (UTC)[reply]
    I agree that AR's block threat was wr9ong and had he actually blocked anyone then I would be the first in line in asking the AC to desysop him. But he didn't. Theresa Knott | The otter sank 19:55, 15 March 2008 (UTC)[reply]

    Unblocked to participate in discussion. MaxSem(Han shot first!) 19:57, 15 March 2008 (UTC)[reply]

    • Aye, unblock and use our processes. Deleting that article as T2 was a poor decision (I restored the history after Betacommand re-created it) but probably not worth a block at this time. Black Kite 19:56, 15 March 2008 (UTC)[reply]

    Anyway, he's unblocked now. Christopher Parham (talk) 19:57, 15 March 2008 (UTC)[reply]

    I think the issues of the Betacommandbot/Optout page may be Civility and AGF, I must admit I find the bolded entry somewhat confrontational and not particularly conducive to collaborative editing. Furthermore, AR placing a note warning of blocking for 3RR didn't necessarily mean he was goingto do the blocking, just that 4 reverts places anyone at risk. Those would be my AGF takes on it. I do agree that 3 blocks recently is somewhat of a concern.
    PS: I have not been too involved with the betacommand issues. Do others think the stern approach on the optout page is necessary?Cheers, Casliber (talk · contribs) 19:59, 15 March 2008 (UTC)[reply]
    Personally I think the first bolded sentence is fair enough but so obvious that it's unecessary. The second is clearly wrong and totally ignorable. Theresa Knott | The otter sank 20:16, 15 March 2008 (UTC)[reply]
    We need to specify that it's clearly policy that it's ignorable. I think it's clear, but Lara apparently doesn't believe it's ignorable, and beta clearly doesn't believe it's ignorable, or he would have agreed to the strikeout. I apologize for being baited by beta. I should know better, by now. — Arthur Rubin (talk) 21:18, 15 March 2008 (UTC)[reply]
    And, for the record, I didn't threaten to block anyone. I stated that anyone who agreed to the condition should be blocked. As an involved admin, I wouldn't do the blocking, although I would probably withdraw from Wikipedia if the condition agreed to as a policy. — Arthur Rubin (talk) 22:20, 15 March 2008 (UTC)[reply]

    The deletion and the block relate to issues that may be accepted at an ongoing arbitration request so that can be left aside for now, though I will be suggesting that the main parties involved here that are not already parties to that request, ie. User:Arthur Rubin and User:Coren, be added to the request. Arthur is right, though, that there does need to be a clear statement somewhere in policy that informal gag rules and trade-offs and divisive interpersonal contracts (however voluntary they are) are extremely destructive to a spirit of collaboration. I did struggle to find a policy where this sort of behaviour is disallowed, and my arguments about about WP:OWN and the third foundation principle were rather weak, but we can't expect policy to explicitly cover everything. Carcharoth (talk) 22:59, 15 March 2008 (UTC)[reply]

    Seems like a case of WP:BEANS in action to me. We don't have a policy on it because it's a pretty obscure thing to do. Perhaps we need more of a catch-all policy against behavior that goes against the spirit or goals of Wikipedia to cite in cases like this. --Infophile (Talk) (Contribs) 03:42, 16 March 2008 (UTC)[reply]

    Whew. Long day at work. Good times. So, here's my take. Considering he deleted a page under an invalid criteria and cited Ignore All Rules, then made two pointy MFDs, then threatened to block Beta (or, rather, have him blocked) for an offense that not only has he been blocked three times in two or so months, but for an offense that doesn't even apply to the page Arthur was edit-warring with Beta on... Beta's own subpage. Then, as if that weren't enough, he dropped a template warning on my talk page. Seriously? Telling me to look at the Welcome page so that I, an admin with over 18,000 edits, can learn how to contribute to the encyclopedia. The rest was tldr, but the point is that admins don't drop template warnings on other admin's talk pages. Clearly, in my opinion, he was losing his grasp on wikireality and needed a few hours to chill out and realize what he was doing. He's been with the 'pedia for quite some time, but 2008 seems to be going downhill for him. LaraLove 03:52, 16 March 2008 (UTC)[reply]

    The template on your page seemed like an attempt to be funny and informative. That said, the block was inappropriate as there was no immediate issue, and any long-term problems with Arthur belong at RFC or arbitration. Christopher Parham (talk) 04:05, 16 March 2008 (UTC)[reply]
    Betacommand isn't an admin. And Betacommand hadn't just gotten a final warning telling him to stop using his admin tools in this situation, including warning users, considering his abuse of the tools. LaraLove 05:38, 16 March 2008 (UTC)[reply]
    Actually, beta had gotten multiple final warnings about various things, including misuse of rollback, which used to be an admin tool. But that's not entirely relevant. Then again, I haven't had a valid final warning for misuse of admin tools, either. — Arthur Rubin (talk) 09:00, 16 March 2008 (UTC)[reply]
    Lara, do you see several people saying that the block of Arthur Rubin was inappropriate? Maybe you could consider listening to them? I'm not going to defend what Arthur Rubin did, as that is not how I would have handled things, but Arthur is discussing things and talking to you. Calling for him to be blocked or desysopped is an over-reaction. I will say again that if you and Coren disagree over that, then you, Coren and Arthur Rubin need to take this to arbitration as a "dispute between admins". Unless you want to try and resolve this before it reaches that stage? Pre-emptive blocks of admins because someone thinks they've abused their tools is not how things are done here. In any case, the last time I checked, blocking an admin doesn't stop them using their tools (of course, in practice it does stop them using their tools as using their tools through a block is considered a reason for desysopping). Carcharoth (talk) 10:30, 16 March 2008 (UTC)[reply]
    As I've stated on my talk page in a different context, what I saw was (a) an admin tool (delete) being used in furtherance of a content dispute (b) continuing dispute, and (c) threat that an admin tool (block) will be used. What clearer definition of preventative block would you prefer? — Coren (talk) 14:35, 16 March 2008 (UTC)[reply]
    Arthur, you'll note that Beta no longer has rollback privileges, so if you want to use that as a comparison, are you saying you agree it's time to take your admin privileges? I doubt it. As far as the warning goes, apparently it was valid, because you were subsequently blocked for ignoring it. As Coren pointed out above, you abused your tools, which appears to me is something the community agrees on. So, Carcharoth, while the community does not agree that Arthur should have been blocked, it is something I obviously endorse considering I posted the justification for it above. While blocking admins doesn't technically stop them from doing anything, considering they can unblock themselves, it's understood that if you're blocked, you treat it as such and go through the same venue as everyone else, just as Arthur did. So (a) deletion of page under invalid criteria citing IAR and no policy, (b) two pointy MfDs, (c) threat to block Beta for 3RR (something Arthur has been blocked for three times this year) on his own subpage, which is not a blockable offense, (d) ignored warning. It was my opinion, which I continue to stand by, that he needed to be blocked at that point while it was brought to the community's attention because I believe his block log and actions during this dispute have shown him to lack the necessary judgment and restraint expected of an admin. As Coren noted, a clear example of a preventative block. LaraLove 20:43, 16 March 2008 (UTC)[reply]
    For what it's worth, there is clearly nothing WP:POINTy about the MfDs. Beta has shown no interest in discussion, so it seems to me to be WP:POINTy to attempt to discuss it before making the strikeout edit and then the MfD. The delete may have been inappropriate, but it still seems to be that allowing gag rules is contrary to the principles underlying Wikipedia. As for the second MfD, I should have initiated discussion first, but I thought fairness required that I open MfDs on all copies of the material, and I withdrew the MfD and requested others withdraw their delete !vote as soon as I became aware that ZScout was open to discussion. I'll wait to comment in the RFAr until a few more points are brought up, so I don't use my entire space repeating points made by others. — Arthur Rubin (talk) 01:18, 17 March 2008 (UTC)[reply]
    I'm sorry, Arthur, but I find both MfDs to be pointy. Mostly because they cite no policy, and also considering you cited IAR in your rogue deletion prior to the first one. Betacommand is actually quite receptive to discussions presented to him in a civil manner. Straight up deleting his page as you did, then turning to MfD was not at all the constructive way to go. LaraLove 02:21, 17 March 2008 (UTC)[reply]
    "Betacommand is actually quite receptive to discussions..." is clearly false, but could we defer this until RfAr β2 is resolved. Even though I think it was opened prematurely, it is open, and such discussions should only be in one place. — Arthur Rubin (talk) 14:39, 18 March 2008 (UTC)[reply]

    John254 has pointed out the following at the arbitration case. Wikipedia:BLOCK#Inappropriate administrative actions states: "Blocks may not be used to sanction administrators for the abuse of administrative privileges." - while the wording (which was added by John254 around a month ago) could do with some work, this is, I believe, an already generally accepted principle. Preventative blocks may seem fine, as long as there is a clear danger, but most times people will disagree whether there was a clear danger or not. In general, discussion should be used for a lot longer than was the case here, and then go to arbitration. Blocking between admins can all too easily escalate into wheel-warring. This wasn't the case here, but please let's not risk that in future. Carcharoth (talk) 06:42, 17 March 2008 (UTC)[reply]

    Where is the discussion for this change? And, as an aside, why is he posting as a party despite not being listed as one? LaraLove 13:09, 17 March 2008 (UTC)[reply]
    I noticed this change when it happened and I support it, especially in light of Archtransit's block of me. A change does not need to be discussed. If nobody objects, it stands. Jehochman Talk 13:15, 17 March 2008 (UTC)[reply]
    I agree with it as well. Admins and editors are bound by the same rules, there isn't a special set of rules and offences for admins. Orderinchaos 06:55, 18 March 2008 (UTC)[reply]

    The following was left on my talk page by a user in need of some help. As he says, I don't really want to get involved. I stepped in regarding a naming convention (see Wikipedia talk:Naming conventions (Syriac)‎) but I'm really trying to keep my distance from the overall issue. I'm just posting this here because I don't think Chaldean is aware of this page.

    I know you don't want to get involved, but you have to, since the only admin involved is abusing his powers. He is deleting masive amount of source information [[71]] when it is clearly not off-topic. When I ask sources for his big changes, he states he owns the page [[72]] and is not obligated to bring sources to the table. I try to negotiate with, try to work with him, but he continues to put me down [[73]]. It would be one thing if this was a regular user talking this way, but this is an admin. He is moving pages without discussion [[74]] and the madness goes on. The thing I'm must troubled with is that he doesn't want to negotiate. I have been verbially abused so many times by this guy in the past week, for simply asking sources for his edits. And now he is ready to put his master-plan together by moving Assyrian people page, despite the huge opposition to it in the talk page. He doesn't care, his gameplan is to wait until the opposition has died down and then suggest to move it again. You don't go to Greek people page and suggest to move it to Greek/Hellenics people. This guy has a complete monopoly on Assyrian related pages. Chaldean (talk) 13:56, 15 March 2008 (UTC)

    I know the editor who wrote this has some POV issues of his own, but I also think Dbachmann is a little over-involved in this topic and is getting kind of aggressive, as some of his edits show. A few more eyes on the matter might be useful. Thanks, everyone. Kafziel Complaint Department 06:46, 16 March 2008 (UTC)[reply]

    Hmm. Yes. I don't have time myself, but this does look like it needs attention. Fast. For the record, Dbachmann is not using his tools (unless he is moving over redirects), so no abuse I can see. Just a content dispute that may be escalating. Carcharoth (talk) 09:49, 16 March 2008 (UTC)[reply]
    Ri-ight. Lets examine some of the diffs, shall we? "Deleting masive amount of source information" is usually the first thing one has to do on discovering a little walled garden where enthusiasts or fringe nationalists or mysticists of some stripe or another have set up a shrine to something. In this case, Dbachmann removed a long disgression about the stone age from an article about modern names. "Ownership" - I read Dbachmann's edit summary as indicating that he knows where the page has to go, but he's being swarmed with what he assumes are extreme nationalists; I personally can't disagree. (User:Chaldean's username is a bit of a giveaway.) In the same summary Dbachmann pleads for some admin attention. So I suppose this section is useful in a way after all.
    "Moving pages" - as Carcaroth has pointed, out, its over redirects. More to the point, he had a perfectly valid reason: he moved the page "X in the USA" to X's official group name in the US census.
    All-in-all, business as usual. Dbachmann's trying to apply our core policies to another little-visited corner of the project, that's all. His talkpage shows him being relatively restrained with the ensuing commotion. If anyone's interested, I'm sure he'd be happy with some help. Relata refero (talk) 10:17, 16 March 2008 (UTC)[reply]

    I am a little concerned with what I perceive as a growing attitude to consider editors actively trying to implement Wikipedia core policies as "over-involved". Indeed this needs more eyes. I have been advertising for more eyes. I will be grateful if it isn't left entirely to me to look after WP's coverage of "various ethnic groups and nationalisms". It is a deeply flawed attitude to think that the "admin caste" is here for admonishing people, while matters of content should be left to pov pushers of various convictions. I can't believe I am "old school" for actually trying to understand the issues under dispute and trying to fix them within policy, instead of an idiotic approach of "hur, hur, can you believe, some people are arguing over content (as opposed to procedure and red tape). Let's slap them all on the wrist a little bit and go back to Wikipedia-administring on IRC". dab (𒁳) 12:35, 16 March 2008 (UTC)[reply]

    You can spend the rest of your life on IRC and you'll never see me there. I resent the implication that I'm a red tape admin; anyone here who knows me - love me or hate me - knows that isn't true. I know I stepped on your toes a bit with your guideline proposal, but that was because you were abusing it. I backed up my reasons with policy (just as you're doing here) but that doesn't mean I'm any more a slave to procedure than you are.
    I'm curious, though, as to which "core policies" were implemented by this comment or this edit summary. That's the sort of thing that tells me you may be "over-involved". Kafziel Complaint Department 15:58, 16 March 2008 (UTC)[reply]
    That's the sort of thing that tells me only that someone has been over-taxing even Dbachmann's abundant patience. It happens, you know. Fut.Perf. 17:00, 16 March 2008 (UTC)[reply]
    It looks like Dbachmann has been violating our core policy of WP:CONDESCENSION again. Wait, that's a red link. Never mind... John Carter (talk) 16:30, 17 March 2008 (UTC)[reply]
    Give me a break. If a new user had said that stuff, he'd be warned for incivility immediately. It should be more so - not less - when it's an admin. Kafziel Complaint Department 17:07, 17 March 2008 (UTC)[reply]
    Doesn't look that way to me, and i'm NOT one of Dbachmann's biggest fans. I don't always agree with him, but he's out there in the middle of lots of serious POV pushing messes, and usually TRIES to go towards NPOV, though i'm not sure his NPOV matches everyone elses. That he regularly gets hit here for being a wide angle POV pusher is absurd, and that he gets tired of it at times is understandable. I don't see much wrong beyond the condescending tone, which isn't incivil, just blunt. and Wikipedia needs more blunt talk and less obsequious patter. In fact, we just had a thread about how being TOO tiptoe-y can be disruptive. ThuranX (talk) 20:35, 17 March 2008 (UTC)[reply]
    Speaking as someone who's helped out far too little at the fringe noticeboard, it looks to me like Dbachmann is indeed showing signs that he is perhaps overworked, and only a human after all. Shall we, then, provide him with a cigarette, a blindfold, and a sunny bit of wall to stand in front of? I would hope not. Sheffield Steeltalkstalk 21:15, 17 March 2008 (UTC)[reply]
    Who was I kidding. I thought I was done and made my final wiki edit. After all the verbal abuse that I have recieved from dab, I thought it really wasn't worth it anymore. Saying the things dab has said against a person that is pushing POV and is simply wrong would be one thing. But please I ask you to show me what I have done or said that made me deserve the treatment that I got. I wasn't the one that removed massive amount of sourced information, it was him. He creates his own "guideline"[75] and then try to use it to win arguments elsewhere[76]. I was simply asking (over and over again) for sources from dab. The answer that I kept on getting was verbal abuse with the declaration of me not having good enough English skills to work with him. Funny that I have been working on Wiki for 2 years contributed over 10,000 edits and not one other user has accused me of having bad English langauge skills. Chaldean (talk) 15:50, 18 March 2008 (UTC)[reply]
    I try to work with dab and let me give you an example of what I get from him whenever I do so;
    Chaldean - - there are other ternomologies for every single ethnic group. Show me another ethnic group page on Wikipedia that uses /. By your idiology, we should move the Greek people page to Greek/Hellenic people. Again, you continue to create more problems then actually slove them. I awknolged there is an issue and that is why we created the naming disupte page. But to spill this issue on all these other pages is making things ever worse. [77]
    Dab's answer - except the Greeks don't make fools of themselves in the Greek/Hellenic matter the way you people do. [78]
    How is an admin to talk in his tone and let it be ok? Do rules still apply on admins? Chaldean (talk) 19:40, 18 March 2008 (UTC)[reply]

    Technical problem

    I am facing technical problem in adding the checkuser request Wikipedia:Requests for checkuser/Case/Hkelkar in the main page Wikipedia:Requests for checkuser. The particular case in the main checkuser page is not undisplayed in my browser. Can anyone fix it. Otolemur crassicaudatus (talk) 09:26, 16 March 2008 (UTC)[reply]

    Just as a heads up, you could also bring this issue to the village pump, as editors there discuss the technical aspects of wikipedia. Wisdom89 (T / C) 19:52, 16 March 2008 (UTC)[reply]
    Aye, I noticed this too. Emailed Allie, so the checkuser should get done anyway. Moreschi (talk) 21:55, 17 March 2008 (UTC)[reply]
     Done - this kinda needs attention as there are quite a number of socks unearthed - Alison 23:22, 17 March 2008 (UTC)[reply]

    More with Don Murphy

    A couple of brand new accounts have been heavily editing the Don Murphy article. I'm guessing they are socks of one another (there was also an IP edit, probably when the person forgot to log back in). I know we've had a lot of trouble with this article in the past (I watchlisted it after the last AfD) but I don't remember enough about the specifics to know what's going on right now. I should note that this comes on the heels of a bunch of new material being added. I have not looked closely but it seemed fairly well sourced and the editor who added it was asking for comment on the talk page.

    Can someone familiar with the situation take a look? I also left a comment on the discussion page over there.--Bigtimepeace | talk | contribs 00:20, 17 March 2008 (UTC)[reply]

    I briefly protected the page, but I recall this is a can of worms inside a hornet's nest and I'm about to go off-line. -- Flyguy649 talk 00:26, 17 March 2008 (UTC)[reply]
    It's been reverted again by User:Runabrat, with much material removed, using the edit summary "Agreement was made with Wikipedia after repeated conflict with Don Murphy. Please check into this before changing." This needs prompt attention given the past issues.--Bigtimepeace | talk | contribs 00:33, 17 March 2008 (UTC)[reply]
    I would be fine with changes to adhere to WP:BLP, but I don't believe that Runabrat's wholesale revert is warranted. I included details about his personal life and his professional career, and it has both positive and negative perspectives. If the article needs to be altered per WP:BLP, I would be fine with discussion. I just think that the expansions solidify the notability of the producer with multiple references that have significant coverage about him. There is probably even more detail about him in Jane Hamsher's book Killer Instinct. In addition, this is a SPA because Don Murphy has repeatedly warred against Wikipedia for having an article about him with a group of supporters, as seen in this thread. My personal opinion is that I've been reverted by supporters who may be POV-pushing. I hope that my contributions can be reviewed instead and revised accordingly. RTFA (talk) 00:44, 17 March 2008 (UTC)[reply]
    It is good that we are talking. Let's move this to the Talk:Don Murphy article talk page. No more administrator intervention is needed here, at this time. NonvocalScream (talk) 00:49, 17 March 2008 (UTC)[reply]


    I've protected the page for a week to allow discussion to take place. I don't know anything about this article, so I'm not sure what can of worms is being spoken of, but I believe protection was warranted here. LaraLove 00:41, 17 March 2008 (UTC)[reply]

    The subject has objected to this article and there was a lot of high level discussion about it. This AfD might provide some background. This is not a simple content dispute and admins need to look into it further. Two of the accounts, Runabrat and Curiosity Inc., we're created within minutes of one another and are almost certainly related. Again, the former reverted to a certain version with the summary "Agreement was made with Wikipedia after repeated conflict with Don Murphy. Please check into this before changing." We need more eyes on this, particularly from folks who know the relevant background. Any suggestions on who to tell about this? There are serious issues here (I think) but I am not even sure exactly what they are.--Bigtimepeace | talk | contribs 01:09, 17 March 2008 (UTC)[reply]
    Don Murphy has used multiple sockpuppets for his own purposes -- he is indisputably User:ColScott, and the rest of the sockpuppets are here. I noticed the related incident above at #User:TheRealDonMurphy, and he said this on his talk page:
    • "I'll make you a deal- delete the Don Murphy article and I will go away and you and your cult can be safe again- that is all I ever wanted anyway."
    • "Please delete the Don Murphy article and I promise to go away and not reveal who you are- but will you, Coward? Will you?"
    • "Since the first two losers, HighinBc and PhilGronowski started this crap a year and a half ago I have been banned 114 times. Wikipediots have blocked the IP#s of Sony Pictures , Jim Henson Studios and the Walt Disney Company at various times. Just last week they blocked the IP# of one of the biggest resorts in Hawaii. In that time I have outed Fifteen of you cultists."
    Hope this provides some recent insight about how Mr. Murphy feels his article should be handled. RTFA (talk) 01:18, 17 March 2008 (UTC)[reply]
    I've blocked both Curiosity Inc. and Runabrat for being disruptive SPAs. It is highly likely that they are meatpuppets for Don Murphy (he runs a message board where his goons collaborate to out editors). John Reaves 05:08, 17 March 2008 (UTC)[reply]
    • Murphy's legal threats, and the edits of his meatpuppets, should of course be WP:RBId, but I do urge anyone doing so to carefully check that any restored material is compliant with the most rigorous interpretation of WP:BLP. Murphy is an oddball and absolutely not suited to editing Wikipedia, but he does have the right to be treated with some degree of decency in BLP issues, as does any article subject. OTRS backlogs are such that the email back-channel may not be quick enough. So: please watchlist the article and deal firmly and decisively with any editors who are attempting to knock Murphy (not to say there are any at present, but still). As long as we do that, we have nothing to fear, I think. Oh, one final thing: if your RWI is traceable from your Wikipedia account, I strongly recommend you don't get involved, as his forums have in the past resulted in some spectacularly inappropriate off-wiki behaviour. DAMHIKIJKOK. Guy (Help!) 09:37, 17 March 2008 (UTC)[reply]
    He's already tried to find me so I'm not too worried. Maybe we need Category:Admins willing to block Don Murphy. John Reaves 16:31, 17 March 2008 (UTC)[reply]
    Guy, we can review my contributions to ensure that they comply with WP:BLP. I think the majority of the content is necessary in establishing his notability because while the consensus of the AFDs were to keep, there were a few opinions that he was not notable enough. I think that the revision I made establishes his notability much more strongly than any previous revision, and the large portion of details are directly relevant to him as a producer. I think that his dispute with Quentin Tarantino is the smaller portion that does not entail inclusion, though I had included it because I thought it fit Murphy's reputation, which the producer himself had spoken about. The revision reflects both positive and negative traits about the producer as reported independently by reliable sources, so there should be some balance here. RTFA (talk) 16:47, 17 March 2008 (UTC)[reply]


    Just pointing out for posterity, Viridae has since deleted the page under BLP; a stub was created just before I made this post. – Luna Santin (talk) 00:08, 18 March 2008 (UTC)[reply]


    If Viridae has deleted under BLP what gave John Reaves the right to recreate it out of whole cloth? No community discussion, no explanation, he just did it like he was Buddha or something. BonnetonTop (talk) 01:24, 18 March 2008 (UTC)[reply]
    It was a bogus poor deletion. Viridae was probably tricked by Murphy. John Reaves 01:33, 18 March 2008 (UTC)[reply]

    Deletion review here. NonvocalScream (talk) 01:58, 18 March 2008 (UTC)[reply]

    Block of Obuibo Mbstpo

    See also here and here. This editor's contributions have become more problematic. Further to his anti-policy block voting on MfD and AfD, which included such gems as voting Keep for a spamlink page, he has moved on to silly vandalism ([79]), disrupting an AfD with such as this ([80]), and finally an article Obuibo Mbstpo which (unless I'm seriously mistaken) was a complete hoax. I have blocked the user indef for the time being to prevent any other disruption, and bring the matter here. Is indef too harsh and a shorter block should be tried (he does have some productive edits)?. Thoughts invited. Black Kite 01:29, 17 March 2008 (UTC)[reply]

    From the looks of his edits he's practically been begging for a block. Support it. Wizardman 01:36, 17 March 2008 (UTC)[reply]
    Not sure. I think a block for the marriage proposal edit was probably warranted. As for the hoax article, on what basis are we sure it's a hoax? I see that it has zero ghits, but, reading the article, I'm not sure that it was speediable. Support leaving him blocked for now, but I'm very curious and fairly open-minded about his response. Sarcasticidealist (talk) 01:38, 17 March 2008 (UTC)[reply]
    Umuofia is a fictional village from Things Fall Apart, for starters. I support a block. This is getting way out of hand. bibliomaniac15 01:41, 17 March 2008 (UTC)[reply]
    Yeah, that's pretty damning. I'm still interested to hear his response, but my mind just closed a little. You know, for some reason this user has been reminding me all along of User:Zenwhat (which is funny given their polar-opposite approaches to deletion). Not sure why. Sarcasticidealist (talk) 01:43, 17 March 2008 (UTC)[reply]
    I guess creation of that article was something to do with his (self-described) extremism stance that "nothing should be deleted" - I'm sure he's fill us in at length about what it was meant to achieve/be an example of. --Fredrick day 01:45, 17 March 2008 (UTC)[reply]
    • Note: It's late here, so if any sort of a consensus forms that the original block should be modified (though it doesn't look like it) please go ahead and do it. Black Kite 01:48, 17 March 2008 (UTC)[reply]
    • I had previously blocked them for using multiple accounts and serious disruption.[81] (Absidy was one of the many former accounts.) After a bit of discussion, I decided to unblock because they had stated an intention to contribute productively. Unfortunately, the level of disruption has not decreased at all. While there is a bit of signal mixed in, the amount of noise is overwhelming and on balance the account is hurting the project. A second chance has been provided, and squandered. Jehochman Talk 01:49, 17 March 2008 (UTC)[reply]
    He's currently active on his talk page, if anybody's interested. Sarcasticidealist (talk) 02:16, 17 March 2008 (UTC)[reply]
    Given his fondness for using multiple accounts, don't be surprised if a suspiciously familiar editor should happen to show up at some of his old stomping grounds. TenOfAllTrades(talk) 02:43, 17 March 2008 (UTC)[reply]
    Mbstpo has been very open in the past. I'll do what I can to encourage him not to evade the block. If he does evade it, it will certainly complicate ensuing process. I do think he is attempting to commit wiki-suicide, a wikibreak is probably just what he needs. I saw that marriage proposal prank. It was funny, to be sure. After all, marriage proposals do often come as a result of pregnancy. On the other hand, he knows, he's been here long enough, etc..... Meanwhile, there are the causes for that suicide attempt which are going to require some attention. I just hope he hasn't spiked his account like he did the previous ones. I'm seriously worried about him.--Abd (talk) 03:13, 17 March 2008 (UTC)[reply]
    • If you examine the history of this user (which can be seen back to 2005 with relative ease, I'll assist any administrator who needs the information, privately), you will find a clean block log until very recently. (the former account, started in 2005, had one block that was quickly unblocked as an error). Then there was one block by Jehochman, of User:Absidy. First block is indef with a "do not unblock without consulting" message. No ignored warnings, on the contrary, Jehochman had warned Absidy and Absidy had stated no intention to continue, and did not continue. Cause of block obvious, and not what Jehochman has stated above. Absidy was rude to Jehochman. If this is taken to ArbComm, high probability Jehochman would lose his bit, or at least have a face smelling of wikitrout. Abdisy was unblocked because Jehochman was willing to relent, so no further process ensued from that. Sock puppetry and use of multiple accounts was not a factor in that block, it's blatant, and only one account was involved, the one he blocked. Now comes another block. Stated reason: vandalism. No serious vandalism alleged. One edit. One questionable article. A warning, not ignored. What's the real offense? It's looking very much like a Rule 0 violation. That rule. The one we can't state, because it would violate Rule 0. So we make up other names, like "Disruption," "Trolling," "Voting in AfDs Openly with an Agenda," "Corrupting the Youth." Never mind, the last was Socrates. The brightest people in societies often violate Rule 0, and societies which punish Rule 0 violations die if the conditions under which they arose change, for these are the people who can see beyond the unstated assumptions of a society. Healthy societies contain Rule 0 violators, and do not punish them (except for, sometimes, a certain level of ostracism). Societies which vigorously exile Rule 0 violators are doomed in a changing world. Don't say you were not warned! In any case, since I don't want Wikipedia to go the way of Ancient Greece and all the rest, I would intend, if this cannot be swiftly resolved, to pursue standard Wikipedia dispute resolution. I did last time, it started with having a friendly talk with the administrator involved. Will that be enough this time? I won't know unless I try. Good night... --Abd (talk) 03:57, 17 March 2008 (UTC)[reply]
    "No serious vandalism alleged"? What about the vandalism of marriage proposal and the creation of what looks very much like a hoax article? I'll thank you for not acting as an enabler, Abd. Sarcasticidealist (talk) 04:05, 17 March 2008 (UTC)[reply]
    That's right. No serious vandalism. Is that edit to Marriage proposal serious? If some editor vandalizes like that, what's the standard response? First offense for vandalism. You know. I know. I've watched it. Hint: it is not "indef block." As to the article, at worst that would be a second offense. Did it take place after he was warned? Was he warned? I didn't see it. Has it been shown that the article was a hoax? If it was, would this be an indef block offense? No, the offense is obvious. It is made even more obvious by the comments of User:Equazcion below.
    • The spouting of long examples of elitism or closed-mindedness in history in a sarcastic manner sounds exactly like OM to me. I find this irritating and unnecessary. All of your responses can be summed as "Wikipedia is a society like any other, history is repeating itself, and only smart people like me are aware of it". At least a toning down of the sarcasm would really be appreciated, Abd. Most of us in serious conversations try to say what we mean, despite the temptation to resort to sarcasm. A return of that favor would really be appreciated, and would be more likely to garner serious consideration of the points you're trying to make. You catch more flies with honey, or something. Equazcion /C 04:07, 17 Mar 2008 (UTC)
    "Elitism in history?" Forgive me, but that makes no sense to me, so I can't respond, I don't think I wrote about elitism at all. And I was not sarcastic. And, yes, people who write like me can be irritating to those who don't understand. I can't tone down sarcasm that does not exist. Well, there is one possible exception. My reference to "Voting in AfDs Openly with an Agenda," could be considered sarcastic. Except that this is actually what Mbstpo did. I said what I meant and I meant what I said. "Sarcasm" is a projection of emotional content onto the written word. I've been communicating on-line for over twenty years, and one of the biggest mistakes people make is projecting emotional states onto written language. You don't have the facial expressions, the body language, and far too many readers will supply them in imagination, thus reacting to what they themselves create. This is why we have WP:AGF, and, folks, it's a policy, not a guideline. To continue, I'm not trying to catch flies. If I wanted flies, I'd use honey. Instead, I use argument I consider cogent, participating in The Search for Signs of Intelligent Life in the Universe. I've found some signs. Mbstpo is one of them. Wikipedia is another, by the way. --Abd (talk) 04:28, 17 March 2008 (UTC)[reply]
    Oh, I understand. Trust me, I understand. When you have a free couple of hours, read through my talk archives. But there's a time and a place. I left a comment at your talk page. Let's keep this discussion about OM's block. Equazcion /C 04:41, 17 Mar 2008 (UTC)
    Vandalism? I don't see it. Seriously, the edit to Marriage Proposal was perfectly legit. Disruption? Again, I don't see it. All I see is someone putting forth ideas that a lot of people disagree with to try and rectify what he sees as massive problems with Wikipedia. But please, don't let sanity interfere with a good hardcore two-minute hate. Kurt Weber (Go Colts!) 04:33, 17 March 2008 (UTC)[reply]
    • Don't template the regulars. That warning is meant for people who require the benefit of the doubt. OM assuredly knew at that point that jokes shouldn't go in articles. Equazcion /C 18:15, 17 Mar 2008 (UTC)
    • Could I in the spirit of good faith propose a compromise. Obuibo Mbstpo (talk · contribs) is unblocked and a namespace restriction is placed on his account. He will be able to edit Mainspace, Talk, User, User talk, Image, Image talk, Category, and Category talk. He will not be permitted to edit Wikipedia, Wikipedia talk, Help, Help talk, MediaWiki talk, Portal, Portal talk, Template, Template talk. Newyorkbrad has made the point before that he contributes good parli pro ARTICLES and that its really the Meta stuff that makes us all cringe (at least me), so this would seem to be a compromise. MBisanz talk 07:37, 17 March 2008 (UTC)[reply]
    • I think MBisanz has actually made a good suggestion. Like many good suggestions, it makes no sense unless one considers the unwritten laws of Wikipedia. It will cause, in my opinion, minimal disruption, and whatever mess remains can be cleaned up in an orderly fashion. A standing indef block of a user with some support is practically guaranteed to be disruptive. Now, can I get Mbstpo to accept it? I think so, but, my meat puppet he is not, nor I his. On the other hand, he's half my age. Hmmmm.... Is there any way to merge the content?--Abd (talk) 18:10, 17 March 2008 (UTC)[reply]
    I agree with Sarcasticidealist here. I would support a namespace restriction, as MBisanz suggests, if this were an isolated case. However, looking at every incarnation of this user, I would be highly surprised if Obuibo/Ron/Sasp/whatever would even accept it. His/her main purpose and goal here on-wiki seems to be to participate on a meta-level, and in a disruptive manner (IMO). How long will he/she go along with this, if/when he/she actually agrees to it in the first place? My guess is about a week. For this reason, I support an indef block with no compromise. How many strikes do you get in baseball? Three. How many strikes do you get in Wikipedia before the majority of co-editors wash their hands? Keeper | 76 | Disclaimer 18:23, 17 March 2008 (UTC)[reply]
    Wow. Majority rule. Should we make this into Policy? What I see here are not strikes at all. There are a couple of foul balls, very few, actually. When Mbstpo was blocked before, it's obvious it was for a single act of impulsive incivility to an administrator. First foul ball. Could have gotten him a 24-hour block. See any warnings before that? (He was warned for canvassing, responded with an expression of no continuance, but also was rude, and was then indef blocked by that admin. So the warning is part of that incident, not a prior.) Then, he was not doing anything worthy of blocking without warning, until the "vandalism." As vandalism goes, it's about as mild as one could get, I see much, much worse, commonly, with a response of nothing other than a warning. For this, he gets, not a 24-hour block -- which would still have been excessive -- but an indef block. So what's the real reason? It's obvious that it is the WP space work. But it would have been quite troublesome to block him for that. However, he provided an excuse, making a joke in mainspace. Something that could result in a warning, normally, particularly with his quite clean record (about such things). Anyway, we could go over and over this, and will if the block continues, I'd predict all the way to ArbComm; on the other hand, what I expect to be the most likely outcome is that a settlement is negotiated. Want to keep fighting? I'd suggest that you find another community to disrupt, for that is exactly what is happening. Mbstpo's actions are at most minor disruption, if any at all. For example, there are quite a few editors who make what are essentially canned responses in AfDs. Are they ever even warned? The difference is that Mbstpo was explicit about it. As has been pointed out (as a counterargument to Mbstpo) closing admins might disregard his comment. Quite a few editors felt it worthwhile to point out that the comment was a standard one, though it was pretty obvious. Now, if a standard comment is cogent, it should count. If not, it shouldn't. What's the harm? What if a hundred editors made such comments? It's quite simple: they would be moved to Talk space, quite likely. In fact all votes that don't present actual arguments relevant to the case should be moved to Talk. Not just Mbstpo's. Essentially, his canned comments were not disruptive. Attempts to stop him, with comments to AN/I, bringing critics out of the woodwork, were disruptive, and this is generally true. Attempts to censor Wikipedians are always disruptive. Sometimes they are necessary, to be sure, but that doesn't change the fact: people resent, typically, being told to shut up. It's disruptive, and should only be done if the speech to be ceased is itself more disruptive. In any case, the suggested remedy deals with the real cause of the block; it's patently obvious that it was not the "vandalism." By the way, I hadn't read the block log comment, when I wrote what is above, the block log comment was more detailed, and vandalism was only one of the causes given. On the user Talk page, only vandalism was mentioned, in fact. What has been proposed would settle the immediate fuss, and I think the blocking admin might accept it. Failing that, I'll suggest to Mbstpo that he request unblock and follow WP:DR and we will see where that goes. But I can guarantee one thing: the latter is more disruptive than the former. More editor time is wasted arguing about Wikipedia ediorial process, diverted from actually working on the project. Given that Mbstpo's concern has become the process itself, this would be, I'd suggest, playing into his hands. If he is unblocked with the compromise, his work on process will continue, but moderated. It's actually a classic on-line solution, used for many years with success. It's about time it is tried here. (Maybe it has been. Any links, anyone?)--Abd (talk) 19:02, 17 March 2008 (UTC)[reply]
    Abd, what OM was doing is called WP:POINT. That's what led to his earlier block, and that's what led to this block. He's done this many times and he will probably continue if he continues editing. Now, can you please stop agitating for his unblock: whether or not he is blocked (or should I say, whether he will be allowed to use a new account) is up to him and whatever admins he discusses the situation with. You can't make promises for him, so admins can't "deal" with you over this. Mangojuicetalk 04:20, 18 March 2008 (UTC)[reply]
    he's scrambled his password, so I guess in that sense the matter is resolved --Fredrick day 22:09, 17 March 2008 (UTC)yes of course he's be back within 24 hours under a new name.[reply]

    An indef block is very much overkill and needs to be undone. Regardless if he's scrambled his password or not, this still needs to be discussed. Blocking is a last resort, and indef blocking is an extreme last resort. -- Ned Scott 04:24, 18 March 2008 (UTC)[reply]

    I agree with Ned Scott above me. Too extreme it seems. Plus, from a quick glance at his recent contribs, his contributins to MfDs and AfDs are usually either spot on or at least actually witty and help to make those typically needless discussions more enjoyable and tolerable. Best, --Le Grand Roi des CitrouillesTally-ho! 04:58, 18 March 2008 (UTC)[reply]

    Lucifero4

    Lucifero4 (talk · contribs · deleted contribs · nuke contribs · logs · filter log · block user · block log) has vandalized after final warning on Ergastolo (diff). This user insists on creating (and in two cases recreating) redirects for Italian words, rather than treating them as foreign words with links to the English language articles and cross-language-version links to Italian language articles on Italian Wikipedia, and insists on using only Italian language sources - our sources need to be English language or at least have the relevant paragraphs translated to English per WP:RSUE. These issues appear to be too complicated for WP:AIV, as my report there was skipped by multiple admins for over two hours. Parsecboy has warned this user again, but previous warnings have not even garnered responses.   — Jeff G. (talk|contribs) 03:43, 17 March 2008 (UTC)[reply]

    Left user a note requesting their comment/responsiveness. If this keeps up without any response on their part, be sure to bring this up again. Beyond that, leaving the floor open for others on this thread. – Luna Santin (talk) 04:13, 17 March 2008 (UTC)[reply]
    To clarify, this sort of situation isn't really what WP:AIV is for. AIV is for the most obvious vandalism that's occurring presently. Creating foreign-language redirects isn't really vandalism, so you probably would've been better off waiting to give Lucifero4 time to respond (your notices for the Italian redirects created today were after he made his last edit). If, he began editing later on, and ignored your warnings (which, I gather he has a habit of doing), you could've just come here directly.
    He doesn't seem to be acting in bad faith, so I don't think any kind of block is in order; he may just be unfamiliar with the guidelines.
    On the other hand, he's been around since November 2006 with close to a thousand edits, so he's certainly no newbie. He really should know what he's doing here, or at least answer comments left on his talk page.
    Given that he appears to be acting in good faith, I suggest sitting tight for the moment, and give him the opportunity to explain himself. Parsecboy (talk) 06:03, 17 March 2008 (UTC)[reply]

    I have create the redirect articlefrom sottotenente to italian military ranks in order to explain what mean as sottotenente, it's the same for tenente. Regarding the case of the article named ergastolo I remind to everyone that ergastolo is not the traslation of Life Sentence in italian.

    For Raffaele Cadorna Jr I have used to write the article news from books or websites written in italian so that is why I have decide to use as reference a website or a book written in italian. User:Lucifero4


    Lucifero4, I think we've just gotten off on the wrong foot. The article on Raffaele Cadorna, Jr. is a valuable addition to en.wiki. Thank you for writing it. I have worked on the translation a bit, and ask that you recheck it for accuracies. It is too bad there are not more sources about the general in English, as he sounds like an interesting and important player in the beginnings of modern Italy. --69.226.108.255 (talk) 22:18, 17 March 2008 (UTC)[reply]
    I don't know what the quibble about ergastolo article is, but in Italy a "life imprisonment" sentence is not a single thing, there is an indeterminate sentence that may lead to life imprisonment, but isn't designed as such, because it specifically grants parole-like circumstances at certain times, but this is different from another type of life imprisonment sentence which is given to terrorists which cannot lead to any parole. This may require that editors consider the input of Italians with legal backgrounds to make certain it is correct. There was another quibble about sottotenente, what is this about? This also, I believe, can be variably translated from Italian to English, depending upon era and army. En.wikipedia is lucky to have so much help from native speakers of other languages who can write accurately on topics not well covered in English. Disclaimer: my Italian is nonexistent. --69.226.108.255 (talk) 22:28, 17 March 2008 (UTC)[reply]
    I can explain the issues with sottotenete and tenente; they're the Italian names for Lieutenant and Sub-Lieutenant, as you can see here:[Italian Army Ranks]]. We don't generally have other-language redirects. It's the same for ergastolo, which is the Italian interwiki from the Life Imprisonment article. Parsecboy (talk) 00:10, 18 March 2008 (UTC)[reply]
    Thanks, I see. I think there are plenty of "other language redirects" for words from other languages that are commonly used in English. English is notoriously known for being a language of other languages, after all. Yes, they are the Italian words for the army ranks Lieutenant and sub-Lieutenant, although maybe Second Lieutenant is better (well, "lieutenant" depending upon context, grammatical construct). And police ranks, remembering that Italian tv lieutenant. "Tenente," though, is a word used in literary English, having been made famous in the early twentieth century in American Literature. Lucifero4's concern with ergastolo is the use of the word in the article about "life imprisonment" because of details of the Italian legal system which make the usage not quite correct as it is in Wikipedia. To translate precisely one must understand the meaning, not just the translation. Conceptually a life sentence in the Italian legal system has a glich that makes it different, although in practice it is more like Texas (if you are an American). This I do not know enough about, but suggest it is requiring of Italian legal and social experts to clarify. I would make the redirect of Tenente to Italian Army Ranks and A Farewell to Arms or the Lieutenant if he has his own character article. Wikipedia often includes articles on fictional characters, although they seem limited to animated series and children's books. It is fine by me the way it has been done except the impoliteness to Lucifero4 who is adding of important articles should be changed to working with him. --69.226.108.255 (talk) 03:07, 18 March 2008 (UTC)[reply]

    Michael & Hephaestos, the last chapter

    Not the most pressing problem Wikipedia has, but this has gone on for way, way, way too long.

    Once, long ago, there was a vandal fighter by the name of Hephaestos. This was back at the dawn of Wikipedia, before most of you had even heard of Wikipedia. In his time, he was the preeminent vandal fighter, a model that such legends like Zoe & RickK modelled themselves on. Then he encountered a problem user by the name of Michael, who in the end drove him from the project.

    In any other story, that would be the end; this has been the end of the story of many vandal-fighters. But I've since discovered that this saga has continued, below the radar.

    Even before Hephaestos left, it was clear that Michael could be obsessed with certain things. Like a punk band called Crass -- & with Hephaestos. Michael created countless sock puppets to harass Hephaestos -- & since Hephaestos ended his time with Wikipedia, he has used these to vandalize Hephaestos' user & talk pages. Have a look at the history of those pages. So I decided enough is enough: no one needs to edit the page of a long-departed user, so I sprotected indefinitely the user page.

    If this doesn't put an end to this obsessive behavior, I will then protect both. The saga is now over; Hephaestos deserves to exercise his right to vanish. It's time to start enforcing his right. -- llywrch (talk) 05:09, 17 March 2008 (UTC)[reply]

    Sounds reasonable. I remember dealing with a bunch of those socks, back in the day. Not sure if this will bring a complete close, but it may help a bit. – Luna Santin (talk) 05:15, 17 March 2008 (UTC)[reply]
    I'm surprised it hasn't been fully protected already. We often do that with userpages of retired users, even if they aren't a vandalism target. Hut 8.5 07:45, 17 March 2008 (UTC)[reply]
    I'm fairly sure everything is protected. I know I did such to the talk page last year.—Ryūlóng (竜龙) 08:07, 17 March 2008 (UTC)[reply]
    C.Fred -- of whom I never have heard -- protected the user page last July, but that protection expired this January. You did protect the talk page a week ago, after BetaCommand -- for reasons I cannot imagine -- unprotected it in January 2007. What's-his-name apparently discovered the protection of the user page had expired this month & resumed his attacks. -- llywrch (talk) 02:22, 18 March 2008 (UTC)[reply]
    (ec x 2) I'm more than familiar with dealing with the vandal involved and, yeah, he's still active. Please feel free to indef protect both user and talk pages. I certainly endorse your actions here. If Hephaestos needs his account re-activated, he should be able to contact someone via email who can then do the necessary - Alison 08:08, 17 March 2008 (UTC)[reply]
    IIRC it used to be protected, and we used to get the socks posting lots of unprotect requests, make sure the protect message is clear and keep an eye on it for the almost inevitable new admin honouring such a request. --81.104.39.63 (talk) 19:28, 17 March 2008 (UTC)[reply]
    I've gone ahead and indef full-protected his userpage (I see Ryulong did the talk page). Hut 8.5 07:36, 18 March 2008 (UTC)[reply]

    Page move? --Goon Noot (talk) 12:16, 17 March 2008 (UTC)[reply]

    I can find no discussion on a proposed page move at either the talkpage of the article or Requested Moves. THe moving editor's contribs (see also DHeyward (talk · contribs)) show no participation in such a debate, and this is the second time the editor has moved this article to a different title (per his move log, see 12 July 2007). Unless someone has an overwhelming argument for keeping the new title, either during a discussion on the matter or because it's better in some way I'm not seeing, I'll move it back. UltraExactZZ Claims ~ Evidence 12:30, 17 March 2008 (UTC)[reply]
    • MOved back. There was no discussion I can see, and this is a high traffic article so discussion is definitely needed before a move to a title which embodies a value judgement. Guy (Help!) 14:23, 17 March 2008 (UTC)[reply]
    If moved again without consensus, perhaps it should be move-protected until such a consensus is reached. I'm not a fan of protecting an article in this manner but, given that this user has already moved the article twice without any involvement in the article, a third move is likely. - 52 Pickup (deal) 14:28, 17 March 2008 (UTC)[reply]
    The issue of renaming this article has been discussed at length, as shown in the talk page archives here. Note that that archive is at the wrong title, but I'm not going to move it back until this settles down. My concern was that, whatever the consensus for or against the move, the article was moved and has been at a title for almost two months. If indeed consensus was strongly against this title, then someone would have moved it back sooner. The proper course would be to post on the talk page, asking about moving it back and citing the weak or missing consensus to move in the first place. Given that so much discussion had taken place about this article's title, it's unreasonable to move it without at least asking about it first. JzG was exactly right to move the article back - had I not been sidetracked, I would have done so myself. UltraExactZZ Claims ~ Evidence 16:44, 17 March 2008 (UTC)[reply]
    The article was moved to it's current title unilaterally and against consensus anyways. The only reason it wasn't moved back to "Allegations of state terrorim" etc etc is because it's not possible to move to an existing page. Jtrainor (talk) 02:08, 18 March 2008 (UTC)[reply]
    What a mess...that article is hopeless.--MONGO 07:36, 18 March 2008 (UTC)[reply]

    Biomass sucks apparently

    Biomasssucks21 (talk · contribs) blanks the Biomass article. Coincidence? I think not! A block perhaps is in order.

    Didn't know where to report this, as WP:UAA wouldn't really solve the problem, and it doesn't fit the strict criteria of WP:AIV --Closedmouth (talk) 13:49, 17 March 2008 (UTC)[reply]

    Nothing special here, I don't think; I'd treat it like a regular vandal account. If the account was adding lots of unsourced content about how much Biomass sucks, that might be cause for concern, but this is probably just a bored kid.
    For the record, correct username is Biomassucks21 (talk · contribs). -- Vary | Talk 13:59, 17 March 2008 (UTC)[reply]
    Fair enough. And I guess that means biomass ucks. --Closedmouth (talk) 14:06, 17 March 2008 (UTC)[reply]
    Or that Biomas sucks. עוד מישהו Od Mishehu 14:44, 17 March 2008 (UTC)[reply]
    Well, Biomas fails WP:CORP, but it may not suck. Relata refero (talk) 14:56, 17 March 2008 (UTC)[reply]
    Surely, it's Bio mas sucks. --ÐeadΣyeДrrow (Talk | Contribs) 14:49, 17 March 2008 (UTC)[reply]
    Funny, I read it as Biom Assucks. Keeper | 76 | Disclaimer 15:13, 17 March 2008 (UTC)[reply]
    No, no. It's a SPAM account for german granny porn ... Bi Omas Sucks. ThuranX (talk) 20:43, 17 March 2008 (UTC)[reply]

    This is a complicated case involving vandalism, possible sockpuppetry and WP:BLP issues, so I wasn't certain where to report it and came here instead! Justpassinby has a long history of tendentious editing of Pure Reason Revolution, including past vandalism (see User_talk:Justpassinby) and a past sockpuppetry incident. The sockpuppetry case included a possible sockpuppet account of User:Joncourtney. Jon Courtney is the name of the lead guy in the band Pure Reason Revolution, but the one edit made back then was insulting towards the band and seemed to be by Justpassinby. Subsequently, Jon Courtney was created as an article. Justpassinby tried a speedy delete, which was rejected, then an AfD that failed (narrowly). During that time, he made claims of plagiarism against Courtney but then agreed to withdraw these. Since then, Justpassinby vandalised the article.[84] There was then one edit by the Joncourtney user[85] — I presume this was Justpassinby. Of course, if it really was Jon Courtney, then there are conflict of interest issues. Also see discussion on WP:BLP noticeboard. Basically, help! This all needs investigating, but I also think some quick action could be taken by admins. Thanks. Bondegezou (talk) 15:12, 17 March 2008 (UTC)[reply]

    Further dubious editing continues... I've also reported possible sockpuppetry at Wikipedia:Suspected sock puppets/Justpassinby (2nd). Bondegezou (talk) 17:32, 18 March 2008 (UTC)[reply]

    Image:Techcrunch-transparent-photshop.gif

    Resolved
     – Uncopyrighted, trademarked-only logos do not fall under WP:NFCC. EdokterTalk 16:26, 17 March 2008 (UTC)[reply]

    Image:Techcrunch-transparent-photshop.gif

    Is there a way to get User:BJBot to use some kind of exception tag or whitelist entry for fair-use images that are exceptions to the rule that fair-use images must be used in at least one article. Discussion at User talk:BJBot#Image:Techcrunch-transparent-photshop.gif is not occurring soon enough, because the bot keeps adding the template. Is there some kind of "hang-on" tag to use so at least some discussion can occur without the bot continuing to add the template?

    This is important also because User talk:BJBot sections get archived if no discussion occurs in 3 days in those sections.

    Here is the last version of the image with the template: [86]

    This image meets Wikipedia:Non-free content criteria exemptions. See the image page for the reasoning. --Timeshifter (talk) 14:49, 17 March 2008 (UTC)[reply]

    Hang on a minute. The fair use reason is that it doesn't render properly because it is a transparent gif? I don't understand. Why do we need to use a company logo for that? Theresa Knott | The otter sank 15:19, 17 March 2008 (UTC)[reply]
    Hardly matters, since {{PD-font}} obviously applies. —Random832 15:22, 17 March 2008 (UTC)[reply]
    Doesn't look obvious to me. This is a company logo. Presumably trademarked. I removed the resolved tag. Let let others take a look. Theresa Knott | The otter sank 15:32, 17 March 2008 (UTC)[reply]
    The Coca-cola logo, which does not violate NFCC to use here (and good luck getting it deleted from commons)
    Trademark has nothing to do with copyright. Image:Coca-Cola logo.svg is both a lot more trademarked, and a lot more public-domain, than the image we're discussing. —Random832 15:43, 17 March 2008 (UTC)[reply]
    Indeed. Trademark is not considered in WP:NFCC so it's restriction do not apply. Marking as resolved again. EdokterTalk 16:26, 17 March 2008 (UTC)[reply]
    Theresa, I have argued on Commons and elsewhere that our focus on copyright in deciding whether an image is free is unhelpful and that other commercial rights such as trademarks need to also be considered as they represent a considerable restriction on the uses images can be put to. That argument has not seen much success, it seems that "free" in the Wikimedia context has been widely interpreted to mean "not subject to copyright" not "not subject to any commercial right which may limit the legally permissible uses of the image". As well as trademarks, we ignore other rights - like that of museums and galleries to disallow photography. The works being photographed may be out of copyright but those that own the collections have a commercial interest in limiting photography - to sell their own photographs, postcards etc. Such rights have been successfully vindicated in many jurisdictions, but again isn't something that we seem to factor in when describing an image as "free". WjBscribe 16:30, 17 March 2008 (UTC)[reply]

    (unindent) I don't understand the technicalities too well, but thanks for keeping the image. --Timeshifter (talk) 17:31, 17 March 2008 (UTC)[reply]

    The problem is that, unlike copyright, trademark is heavily context-dependent. The H&R Block logo is simply a green square. Any green square, if used in the context of promoting a tax preparation company, would be a trademark infringement. Should we ban all images of green squares from Wikipedia? Of course not. There are words that are trademarked - many of these are used as article titles. —Random832 18:03, 17 March 2008 (UTC)[reply]
    This is confusing. I've seen images marked {{PD-textlogo}} and {{trademark}} get removed from an article as unjustifiable fair use, then deleted as orphaned fair use. Are logos subject to NFCC or not? Gimmetrow 21:51, 17 March 2008 (UTC)[reply]

    I think the points WJBscribe raises are interesting. The Coca-Cola logo we count as free, even by Commons' definition of free. But, imagine what would happen if you tried to use it commercially. It's not really free. --Hammersoft (talk) 17:49, 18 March 2008 (UTC)[reply]

    Admin abuse

    Yes, I know, yet another thread by an IP about admin abuse has about a snowball's chance in hell of being paid attention to. However, User:JzG has taken it upon himself to protect his own version of a page move: [87]. The worst part is that he was reverting a page move because it was "undiscussed" - and yet this page title itself had been moved there only a few weeks back... in an undiscussed and controversial page move (thus the current move war). I would demand that something be done, but that tone doesn't come across right. Therefore I humbly request that this page be unprotected or moved back to the previous title, as this is against the protection policy. You will note this is not the first time JzG has edit warred on a protected page: see Al Gore III, whose page history is now deleted. 71.58.56.181 (talk) 16:11, 17 March 2008 (UTC)[reply]

    Hasn't this problem arisen with JzG before? Justin(Gmail?)(u) 16:15, 17 March 2008 (UTC)[reply]
    Yes, it's currently being discussed at Wikipedia:Requests_for_comment/JzG2. Nothing is going to happen, however. -- Naerii · plz create stuff 16:19, 17 March 2008 (UTC)[reply]
    What problem? That he fixed a blatantly POV title and prevented the problem from recurring? I wish all of our admins were that abusive... Gavia immer (talk) 16:21, 17 March 2008 (UTC)[reply]

    Note that this is also being discussed above as well. Gavia immer (talk) 16:24, 17 March 2008 (UTC)[reply]

    Discussion above and on the article talk page suggests that others felt it was a problem that the move had been made with zero discussion on the part of the mover; the page had been moved to contentious titles in the past as well. Protection is quite suitable until discussion actually occurs. Tony Fox (arf!) 16:36, 17 March 2008 (UTC)[reply]
    • You know, one of these days if we all live long enough somebody might eventually post here that they disagree with an admin action without calling it abuse. In this case, for example, the only reason I introduced move protection was because the log for that page shows a series of disruptive non-consensual moves, and there is some likelihood that the user who made the last such move will do so again. But hey, why bother being calm and reasoned when we can shout ZOMG! ADMIN ABUSE! instead, since that works soooooooo much better. Anyone care to count the number of articles I've protected against moving in the last month? Shouldn't take long, you know where the logs are. Guy (Help!) 17:12, 17 March 2008 (UTC)[reply]
    • This looks like a good protection. He reverted an undiscussed move on a page with what looks like a history of move wars. Whats wrong with this protection? Bad Guy! Bad! Lawrence § t/e 17:15, 17 March 2008 (UTC)[reply]
    • I see nothing wrong with the protection or the revert of a controversial and undiscussed page move. There was no consensus towards the move, and those that have complained about Guy's actions haven't given one good reason why the page move was even needed in the first place, instead focusing on a trivial and unrelated RfC. seicer | talk | contribs 17:19, 17 March 2008 (UTC)[reply]
    • Very active new anonymous friend, I wonder if we've met him before under another name, perchance? Anyway, I thought his choice of example was amusing, seeing as how that article is now deleted by consensus, thus showing I was actually right at the time! Guy (Help!) 17:20, 17 March 2008 (UTC)[reply]
    I support Guy's action here. --John (talk) 17:44, 17 March 2008 (UTC)[reply]
    Another case of an admin protecting something on The Wrong Version (tm) and thereby becoming the root of all admin evil. FCYTravis (talk) 17:49, 17 March 2008 (UTC)[reply]
    Umm - looks fine to me. The article's been moved out of process a number of times already. It looks like Guy is reverting to the consensus(-ish) version and protecting to prevent abuse - Alison 18:09, 17 March 2008 (UTC)[reply]
    (Ec) This is ridiculous. Move-protecting so issues can be worked out is evil now? Its not even as if Guy was in any way involved in the discussion, he just responded to the problem stated higher on the page. Relata refero (talk) 18:06, 17 March 2008 (UTC)[reply]
    RR and others, you don't understand. You see, we need Guy's head on a pike, so accusations must continue at a steady pace. HTH. Raymond Arritt (talk) 18:22, 17 March 2008 (UTC)[reply]
    "The beatings will continue until morale improves". Guy (Help!) 19:27, 17 March 2008 (UTC)[reply]

    Admin assistance needed FOR admin assistance in Articles_for_deletion/List_of_hooligan_firms

    Man, I never thought I'd have to file one of these, but:

    On March 13, I submitted "List of hooligan firms" for deletion via AFD
    [88] as it violated WP:NOT#DIR. Yes a few of the users involved with that particular article & group protested. That's normal.
    March 16, I decided in the name of WP:BOLD to simply close the thing, considering it was a list and therefore a violation of policy:
    dif of course, it got removed a few times, which I expected:
    [89]
    [90]
    [91]
    At that point I gave up for the evening and came back the next morning. An admin Rambling Man had been called in and he and I spoke about the revert, very civiliy. However, he decided to "shut the door" as it were with this message [92] The users contesting the deletion as well as the admin are all members of a group that would have contributed to this list, as such, his involvement is COI. Additionally, he has stated that he will allow a violation of WP:NOT#DIR by allowing this list to be retained, even go so far as to actually ask if this is a list. I'm specifically asking that his conduct be examined as I belive that it constitutes COI, and that his involvement in the aforementioned AFD is not allowed. It's still standing so a DRV wouldn't be appropriate at this time.

    Kosh Sez We don't need no stinkin FUR!! 18:25, 17 March 2008 (UTC)[reply]

    Kosh, you are specifically not allowed to close AfDs for any reason that you are the nominator for. Had you not done that, I don't believe there would be any problem here. Rambling Man has done absolutely nothing wrong and has been way more civil than other editors/admins would have been in the same situation. He was friendly, to the point, and corrected where you were obviously in the wrong. What action do you want here? Because, so far, all you've done is draw attention to yourself. I would recommend a "back away slowly and quietly" approach...but that's just me. Keeper | 76 | Disclaimer 18:31, 17 March 2008 (UTC)[reply]
    So you closed an AFD you started... after three days... when you're not an admin... accused others of vandalism for reverting it... threatened anybody who stayed in your path... edit-warred to restore your bogus close... and then decided step into the lion's den here? You should just fall back and count your graces that you didn't run into a block-happy admin. east.718 at 18:34, March 17, 2008
    Yeah. What he said. And said better than me. Keeper | 76 | Disclaimer 18:36, 17 March 2008 (UTC)[reply]
    Indeed. That article is actually a drama, vandalism and sockpuppet magnet (I've got it watchlisted, and have had to make a number of reverts and blocks because of it recently), but it's undoubtedly a valid article. The OP would be well-advised to read up on deletion policy before submitting another AfD. Black Kite 19:07, 17 March 2008 (UTC)[reply]
    SO this is ok:

    Sorry, I'm confused, if we disallow lists, why do we have so many featured lists? You raised the AFD to make a point. Read the text, " the deletion process proceeds based on Wikipedia community consensus" - not on your single decision that this is "just a list" which fails to meet policy. You're the only editor who believes that this article does violate policy. You do not have the consensus, the article will be kept. Simple as that. And, while we're here, consensus can overrule policy, that's how policies evolve and improve. The Rambling Man (talk) 17:12, 17 March 2008 (UTC)

    I don't think so. I was accused of WP:POINT, despite my explaining twice that this was not a WP:POINT. Let's also not overlook the fact that he;s stating "Consensus over-rides policy" which has been proven false. Policy CAN be changed by consensus, but that's seperate to this AFD. While we're at it, check WP:NOT#DIR and note that it states that lists are one of things Wikipedia is not (outside of the listed exceptions). OH, and I love the part where you said I edit warred. I reverted vandalism to that AFD 3 times. I closed it per WP:BOLD WP:IAR with a note showing only that. As far as the "revert and be reported" That's not threating, it's a statemnt of fact, that why we have WP:3RR. Now, AGF and have a nice cup of tea (to quote an admin I know :) ) Kosh Sez We don't need no stinkin FUR!! 19:50, 17 March 2008 (UTC)[reply]

    Regardless of how you think the AfD should have been closed, you shouldn't have closed it. You were the nominator. Everyone knows what you think. By closing it, you have pushed your own POV, nothing more, nothing less. Rightuflly reverted. If not by Rambling Man, by any other admin or even non-admin that would have stumbled into it. I strongly suggest you move on. Move on. Keeper | 76 | Disclaimer 19:54, 17 March 2008 (UTC)[reply]
    IAR only works when you're right. Also, I'd suggest on reading up on our policies about conflicts of interest, edit-warring, and what vandalism is and isn't. Throwing around acronyms without actually knowing what they mean isn't really the best way to get your point across. east.718 at 20:07, March 17, 2008
    I'm sorry but I have to comment here. KoshVorlon has pointed out that mention was made (by me) that the AfD came across as if it was being done to make a point, which with respect it did. That is exactly how it looked and still looks. However, bear in mind that Kosh has also used an edit summary to make an accusation of sockpuppetry without any evidence, and has npot replied when asked to back up his claim; he has also accued me of having a "conflict of interest" without it would seem having a clear understanding of what WP:COI actually involves. I, like BlackKite, keep the article in my watchlist for the very same reasons as BlackKite, to root out POV pushing & vandalism and to also ensure it is correctly sourced, as it is a topic where there are a number of sources that are not reliable, and that can attract strong POV. The topic matter is not the most pleasant, but that is irrelevant to whether it should be on wikipedia. How exactly my comments on the AfD and my "keep" qualify as COI, I really don't know. Kosh has also accused a number of others, again including myself, of being in "a group" and claimed that therefore all our comments are irrelevant because we all apparently have a conflict of interest. This whole thing has been blown up totally out of proportion and seems as if it is being used to push Kosh's views about Lists on wikipedia. I've no idea how many "lists" there are on wikipedia but I know that there are good articles and guidelines which specify how lists should be formatted etc. There is also this list, Wikipedia:List of Wikipedians by number of edits. If all the Lists on wikipedia were put forward for AfD we would be here for a very long time.♦Tangerines♦·Talk 21:15, 17 March 2008 (UTC)[reply]

    Kosh, WP:IAR only applies, not when only you're "right" as pointed out by someone above, but when the absence of your action seems to the undermine the spirit of what Wikipedia is about. In other words, you ignore all rules when a procedure prevents wikipedia from being what it's supposed to be. You went against clear consensus and closed (as delete mind you - that's a no no) an AfD that you were the nominator of. I believe this is pretty cut and dry and extend to all those people involved in the discussion to consider the matter closed. Kosh, if you continue to badger the point, you will only succeed and illuminating yourself in the bad light. Wisdom89 (T / C) 23:28, 17 March 2008 (UTC)[reply]

    As one of the contributors to the discussion at Wikipedia:Articles for deletion/List of hooligan firms, and one of those who reverted the editor's unfortunate closure of his own nomination, I have to say that I see nothing wrong with the consensus at that AfD, and that it seems to pretty clearly say Keep, given that lists are allowed in Wikipedia. I mention the AfD because it is the core reason we are here today. I was on the point of posting here myself in relation to the accusing editor, but he has saved me the effort. His over-bearing need to have this list deleted has clouded his objectivity, to the point where he will use all ends to achieve it, and his conduct now borders on uncivil. Myself and fellow editors are struggling to maintain our cool and desist from sinking to insults. I am putting this in as strong a way as possible without being impolite. As far as I personally am concerned, the editor must follow the laid-down guidelines and policies put in place at AfD (and elsewhere, as this ANI is frivolous to the extreme), or risk removal from our community, for whatever length of time. Unlike the editor, I am unable to decide one way or the other on that, because I don't have the tools (I have pointed out to him his lack of the same for deleting articles he takes a dislike to). I am hoping, however, that he, as a fellow editor with much to offer us, will step back and let the AfD process take its course, then return to making solid contributions to the encyclopedia. Thanks. Ref (chew)(do) 11:03, 18 March 2008 (UTC)[reply]
    Ref, say WHAT?!?!?!? Dude, why don't you read Wikipedia is not a list.

    It contradicts what you just said. Bottom line here, the "article" is a list. That's just a fact. Wikipedia isn't for list, that's a fact, per WP:NOT#DIR. Yes, I closed it per BOLD and IAR and contrary to popular opinion, I was right. Policy states it as such. If I create a page about an actor and I have it referenced to the gills, but it's defaming him, it doesn't matter how many people say "KEEP". I'm violating BLP and therefore, by policy alone the article has to be deleted, consensus or not. GO back and read policy then tell me Wikipedia is for list. I'll leave the your list be. Kosh Sez We don't need no stinkin FUR!! 12:19, 18 March 2008 (UTC)[reply]

    forget the list itself, you were simply WRONG to close the AFD, numerous people have told you this whatever you'd like to claim about IAR and BOLD. You can argue the toss about this all day but nobody agrees. I'll leave the your list be. this sounds like a threat to me? what is you plan to do? run another AFD? blank the page? --Fredrick day 12:23, 18 March 2008 (UTC)[reply]
    Sorry, no can do. If it's a list then it fails policy. Fail policy and your "article" , list whatever, gets deleted, that's just fact. By the way, "I'll leave the list be" sounds like a threat? No way ! It means just what it says, I'll leave it alone. I won't touch it. No further action. Kosh Sez We don't need no stinkin FUR!! 12:38, 18 March 2008 (UTC)[reply]
    Kosh, what part of the fact that Wikipedia allows lists do you not understand? You are seriously misreading what WP:NOT#DIR says. What it actually says is "Lists or repositories of loosely associated topics such as quotations, aphorisms, or persons (real or fictional)." It goes on to say "Of course, there is nothing wrong with having lists...". Simply being a list does not make something eligible for deletion. You also may not ever close a deletion discussion you initiated unless you have decided to withdraw the nomination, and even then it may not be appropriate if there are several editors who believe deletion is the correct course of action. Simply put, you are wrong on all accounts. - auburnpilot talk 14:52, 18 March 2008 (UTC)[reply]
    Comment - "I'll leave the your list be" denotes that he still believes that I, or my fellow consensors at the particular AfD which stoked him up, actually seriously contribute to, or maybe even own, the article List of hooligan firms. For my part, I simply happened across this AfD and decided to vote as a one-off, which I do regularly on a variety of topics, and as I expect to be allowed to do peacefully, as long as I don't disrupt Wikipedia doing it. Exactly the behaviour we are viewing at the moment - but not from myself, I assure you. Thanks. Ref (chew)(do) 16:02, 18 March 2008 (UTC)[reply]

    'Not a list' has the specific footnote - This provision is not intended to encompass lists of links to articles within Wikipedia that are used for internal organization or to describe a notable subject. MickMacNee (talk) 16:13, 18 March 2008 (UTC)[reply]

    This has got completely out of hand. As has been poined out above, a number of editors have tried dealing with this civilly and in the face of unfounded accusations of "conflict of interest", vandalism and sock puppetry and somehow of being part of a group, all because they all disagreed with Kosh's opinion. Regardless of the consenus of the AfD, Kosh still refuses to accept that he was wrong to close the AfD despite being told that as nominator he is not allowed to close it, and especially so when he has no powers to delete the article. This should not even be an issue. Surely it is time to move on. Also, given that Kosh as nominator of the AfD has now said, "I'll leave it alone. I won't touch it. No further action." then presumably he accepts the consensus, albeit still fully disageering with it, which he is perfectly entitled to do.♦Tangerines♦·Talk 17:04, 18 March 2008 (UTC)[reply]

    Don't know if this is the right place to bring this up, but I've had enough of this user. He keeps being arrogant and sarcastic in discussions, and is constantly rude to other users. An example is this comment here. He also made some false accusations about other users in this discussion here, and began attacking every single user who disagreed with him. If someone could please talk some sense into this user, I'd appreciate it, because I'm fresh out of ideas. The Prince (talk) 18:31, 17 March 2008 (UTC)[reply]

    Your first link that you've provided from Talk:Mario is indeed quite rude, non-productive and incivil and shouldn't be tolerated. However, have you attempted to engage this user on your or his/her talkpage? Have you notified "Link" of this thread so he/she can defend/articulate him/her self? I can't find evidence of either. Keeper | 76 | Disclaimer 18:42, 17 March 2008 (UTC)[reply]
    I can't say I have, in fear of being attacked by him. I have tried to reason with him on several occasions, but he doesn't listen to me. The disputes between me and Link are due to the fact that he makes controversial edits that should have been discussed first. And when we start discussing he can never agree on a compromise, and has to have it his way, even though numerous other users disagree with him. All in all, I think maybe he would listen to an admin instead of me. The Prince (talk) 19:00, 17 March 2008 (UTC)[reply]
    I understand your concerns about being "attacked". I've left a talk page message for ALTTP. Hope that helps. Beyond that, and pending his/her response, there's really not much more I (or any admin) can do. I recommend, if at all possible, to try to avoid "link" until this is resolved. Cheers, Keeper | 76 | Disclaimer 19:48, 17 March 2008 (UTC)[reply]

    Thanks, I appreciate it. The Prince (talk) 19:53, 17 March 2008 (UTC)[reply]

    I'm confused - so what, you expect people to treat you with the utmost respect after accusing them of borderline stalking and being "jaded" about losing an argument? Your initial response was rude, and my response to you rests on your head, because you "asked for it". At what point did you act respectful in that discussion? Neither to the person who initiated the section did you show any respect, nor to me, and yet you're whining about disrespecting you? Grow up. At no point should you be able to complain about me hurting your feelings when you initiated the tension in the first place. So at what point is this not your fault, may I ask? Give me a single good reason why you didn't initiate the tension? - A Link to the Past (talk) 21:22, 17 March 2008 (UTC)[reply]
    Link, I have no idea who you are talking to. Too many ambiguous pronouns. Are you talking to me, another admin, or Prince? What is your problem? I've looked at many of the links, and overall I see that you generally have a quite confrontational style to your edits. What is your problem? Keeper | 76 | Disclaimer 21:30, 17 March 2008 (UTC)[reply]

    Link: You've been blocked dozens of times because of this. Your rude, sarcastic, disrespectful, and you seem to enjoy making other users feel bad. You are very close to another block, so I suggest you straighten up your attitude and behave appropriately. The Prince (talk) 21:48, 17 March 2008 (UTC)[reply]

    I asked you a question. What was your purpose in trolling me with an irrelevant comment? Can you give me an explanation why your intention was not to create tension?
    Really, I'm just kind of curious why you will neither confirm nor deny what I asked, and instead threatened that I will be blocked for my "disrespectful attitude". I'll take your silence as admission, thank you. - A Link to the Past (talk) 21:51, 17 March 2008 (UTC)[reply]
    Again, I'll ask: Who are you talking to? You are, again, using ambiguous pronouns. Keeper | 76 | Disclaimer 21:58, 17 March 2008 (UTC)[reply]
    The person who's involved in the discussion at Talk:Mario. He brought up an irrelevant discussion which had only one possible goal, which is to create tension. - A Link to the Past (talk) 22:02, 17 March 2008 (UTC)[reply]

    I said: "You are perfectly capable of doing it" to a user who wanted others to do something for him. He had no problems with my comment, only you. I was not trying to be rude or anything, I was just pointing out that there is nothing wrong in adding content to an article yourself. The Prince (talk) 22:09, 17 March 2008 (UTC)[reply]

    1. There's nothing wrong with merely posting an article's flaw on the talk page. You never thanked him for the work, or acknowledged it. Simply told him to "do it himself", assuming that he had enough knowledge to do so.
    2. The comment in question was, however, not that one - it was the comment of "Mario Galaxy". - A Link to the Past (talk) 22:18, 17 March 2008 (UTC)[reply]
    But it's true; your only reason to make false accusations of me was because you didn't get your way on the SMG article. It was immature of you to do so, and you should have dropped it. The Prince (talk) 22:23, 17 March 2008 (UTC)[reply]
    Anyone with a bit of sense would know that such a statement would instigate a negative response. So if we're going on your rules, the only reason you were trolling that discussion is because I provided a better argument than you did. - A Link to the Past (talk) 23:46, 17 March 2008 (UTC)[reply]

    Your arguments were not constructive at all. They did nothing but create a ridiculous accusation of me being some sort of bad guy. I still don't understand why it says you've retired on your user page, when you're still making edits on Wikipedia. The Prince (talk) 23:57, 17 March 2008 (UTC)[reply]

    Seriously, all I want is to edit the Mario article without the unnecessary drama such as this post. Here is a compromise to combined the beliefs of The Prince and ALTTP. When a new user comes and posts an error on the talk page, we thank them and encourage them to be bold. But when a user constantly badgers people to make the edits for them, again we tell them to be bold, but we should also tell them directly to edit the article for themselves in a more polite way. We should help out each other edit the article, instead of arguing it incivilly all for nothing. I'm pretty sure all of us should review WP:CIVIL, so tensions won't rise between the article and the editors. PrestonH 01:56, 18 March 2008 (UTC)[reply]
    At this point, the response to you is less relevant than being accused of holding some silly grudge over someone of whom I'd forgotten about, who clearly is holding a grudge, as he seems to remember me quite well. - A Link to the Past (talk) 02:03, 18 March 2008 (UTC)[reply]

    Block review

    Resolved

    Bearian (talk) 20:15, 17 March 2008 (UTC)[reply]

    I'd like some community input on a block I performed. I just blocked a user called Theasssss Nutsssss indefinitely, without any warning, but for the following reasons:

    1. First edit was to copy the top text from User talk:A. B. to create their own talk page.
    2. Second edit was to copy this section of User:A. B. to create their own user page, but with some modifications.
    3. Third edit was to remove some text on their talk page, evidently a fake archive box, but was originally on User talk:A. B.
    4. Final edit (admin only) was to create an RfA, which was evidently a copy of Wikipedia:Requests for adminship/A. B., with some modifications.
    5. Their username came across to me as "The ass nuts", probably a borderline violation of the username policy, but combined with the above, gave me more incentive to block.

    I reckoned that they were trying to impersonate A. B. Was this a good block, or should I remove it and apologize? Acalamari 19:01, 17 March 2008 (UTC)[reply]

    I endorse such a block. Creates a fake userpage/talkpage, then tries to apply for adminship while impersonating a user? seicer | talk | contribs 19:03, 17 March 2008 (UTC)[reply]
    I suspect it's "these nuts" but yeah- there's nothing to remotely indicate this editor is here for any useful purpose. Friday (talk) 19:04, 17 March 2008 (UTC)[reply]


    Well I don't reckon they are actually trying to impersonate, the username is not similar. But the RFA suggest a troll, so I endorse your block. Theresa Knott | The otter sank 19:05, 17 March 2008 (UTC)[reply]
    Endorse..troll ban..--Hu12 (talk) 19:06, 17 March 2008 (UTC)[reply]
    As soon as I saw this, I couldn't help thinking of the "ay did did did whats-a-name done get at you yesterday? / who? / deeez nuuuts!" skit from The Chronic. :-) Endorse block, by the way. east.718 at 19:20, March 17, 2008
    Back as Futures Trader (talk · contribs) and created Wikipedia:Requests_for_adminship/Futures_Trader..blocked--Hu12 (talk) 22:06, 17 March 2008 (UTC)[reply]
    I'm the real User:A. B. and I approve this block. --A. B. (talk) 23:05, 17 March 2008 (UTC)[reply]
    Thank you. :) Acalamari 00:00, 18 March 2008 (UTC)[reply]

    Troll user: The Dominator aka Dominik92

    I have a problem with the above user. Yesterday we had a disagreement about sourcing on a couple of maps. I believe this ended well and everything was ok. However last night he rv several of my edits. Ok no big deal! Today I was havin a coverstaion with an admin and he jumped in out of nowhere. I asked him to stop and he did not. Again not really a big deal, however this user has posted this "Thanks, I'll keep an eye on the user though, because he does many unhelpful things that aren't blatant vandalism and attempts to manipulate the system" on djsasso's talk page. I feel from this users trolling actions he will follow me around wiki for the next several weeks. Here is what was posted yesterday, "Is this civil?

    Left by Dominik92 on my talk page:

    I see nothing on the talk that suggests consensus, all in all I really don't care, but I find the maps useful. An admin's opinion holds no more weight than any other user's opinion. I really don't think that a new users who violates policy with nearly every edit should be asking me to review policy. PS: we're building an encyclopedia here, and I see you're approach disruptive. For example, barnstars are given out to users who you feel have done exceptional work and mean absolutely nothing more than a pat on the back. And I think you're too new a user to be voting at RfA even though there is no official cutoff, sucking up to admins has nothing to do with building an encyclopedia. I suggest you refrain from giving out tips (that are 99% of the time incorrect) as a new user. About the same-sex marriage page, I really don't give a shit, I would prefer some visual representation, but eh. comment left on my talk page. by Dominik92


    My responce: I find the above comment ill-hearted and unjust. No proof has been given how I have violated policy, and that I am disruptice because I award users who desire to be praised with barnstars? ALso the user is upset that I vote on wiki issues and admins?? In any case I have been around wiki for several months and decided recently to create an account because I like the project. Dominik assumes that I am 'new' when in fact I am not. I would be worried with some of his answers, "all in all I really don't care", "I really don't think that a new users who violates policy" no proof, "I see you're approach disruptive, [for giving out barnstars], "And I think you're too new a user to be voting at RfA", he thinks, is he the policy maker?, "from giving out tips (that are 99% of the time incorrect)" again where is the proof, and "I really don't give a shit" this was just rude.Thright (talk) 20:48, 16 March 2008 (UTC)"

    I thought it was over, however with dominiks92 need to troll me, and watch me, it is not. Please see the number of times I had to rv my talk page, after I said it was over, over an hour after he posted the last comment. Please help thank you.Thright (talk) 19:09, 17 March 2008 (UTC)[reply]

    I'm not even going to respond as it is a bit obvious to anybody who looks through the contributions and talk page histories. The Dominator (talk) 19:13, 17 March 2008 (UTC)[reply]
    cause in point, no less than 4 minitues pasted and there is a responce. Why so fast?Thright (talk) 19:17, 17 March 2008 (UTC)[reply]
    You mean case in point, and "why so fast" is probably because you were rather predictable here. Guy (Help!) 19:38, 17 March 2008 (UTC)[reply]
    He was absolutely correct to re-insert the maps. There was no consensus to remove them and no evidence that any of the information on them was incorrect. The message left on your talkpage was a bit uncivil, but hardly worth branding as a "troll". Black Kite 19:24, 17 March 2008 (UTC)[reply]
    While still pretty early in his career, Thright (talk · contribs) is looking like a good case for mentorship, in that he's an apparent good faith editor whose lack of understanding of policy keeps landing him in hot water. I'd offer to mentor myself, but we've had some run ins (including one in which he accused me of not understanding the alleged policy that made Fuck (disambiguation) speediable), so I doubt he'd be thrilled with me. But I really think that mentorship would be advisable. Sarcasticidealist (talk) 19:26, 17 March 2008 (UTC)[reply]
    (ec) The message was a misunderstanding as Thright has admitted here. The Dominator (talk) 19:28, 17 March 2008 (UTC)[reply]
    Have to agree with Black Kite here, his actions were completely justifiable. Maybe a little harsher than needed in his comments, but hardly is he being a troll and trying to pick fights. I suggest, that the two of you just stop talking to each other for awhile to have a cool off period. -Djsasso (talk) 19:30, 17 March 2008 (UTC)[reply]
    I did stop talking to him, and as a reward I got reported here : ) I think Thright is good faith on most occasions, but his accusing everyone that disagrees with him of not understanding policy is unacceptable behavior. I agree that mentorship would be of some benefit.The Dominator (talk) 19:34, 17 March 2008 (UTC)[reply]
    My comment was more aimed at him that you, because I already talked to you about it. I do agree with you that he has to stop accusing people of not understanding policy when he himself is incorrect. But, that is mostly because he is brand new and he will figure it out as he goes along as long as people don't bite him to much. -Djsasso (talk) 19:36, 17 March 2008 (UTC)[reply]
    Perhaps a checkuser should be done. I have been wondering by his edits if he was a sock of someone, and hadn't until now seen that someone already accused that other user of being a Thright sockpuppet. -Djsasso (talk) 19:41, 17 March 2008 (UTC)[reply]

    Let me be clearer I am worried about this, "Thanks, I'll keep an eye on the user though, because he does many unhelpful things that aren't blatant vandalism and attempts to manipulate the system" If dominik92 agrees to stop following me around, - which is trolling is it not? - I will be happyThright (talk) 19:38, 17 March 2008 (UTC)[reply]

    No trolling is when you purposefully say stuff to pick a fight. Users are more than welcome to watch your edit history to make sure you aren't causing trouble. That is why edit histories exist. -Djsasso (talk) 19:40, 17 March 2008 (UTC)[reply]
    So that's considered uncivil by you, but calling me a troll and a vandal also on somebody else's talk page is OK? I want to watch your edits to make sure you aren't making mistakes, all in good faith. The Dominator (talk) 19:43, 17 March 2008 (UTC)[reply]
    FOrget it, you all win This is not worth my time. I thought I liked the idea of wiki, butit turns out that most, - not all - people here just attack everyone. I am done with wiki, my time will be spent better somewhere else. I will take my masters degree and my managerial skills elsewhere.Thright (talk) 19:46, 17 March 2008 (UTC)[reply]
    Please, I would love for you to stay, there's nothing I hate to see more than a discouraged user that could be a quality contributor, I just think that you should take the mentorship and not try to be so radical, like deleting the "fuck" page or blanking your user talk not that it violates policy, but just because it's not generally done and is somewhat rude, I strongly suggest that you get mentorship and give it another try here. The Dominator (talk) 19:52, 17 March 2008 (UTC)[reply]
    Ok I thought about it I am leaving, I would like to thank everyone, - even those who opposed me - and wish you all the best here and in life. I have based my decision on the above and I belive that I cannot add value to wiki. Furthermore, this whole issue started with tags, and thus I find that a tag has been placed on SIP Magazine (Philippines)again! It turns out that this page was deleted a few days ago, yet my talk page gets flooded that I was in the wrong for placing the tag. In any case, it is not about one tag, but rather about interpersonal skills, and thus I say goodbye.Thright (talk) 20:13, 17 March 2008 (UTC)[reply]
    Sigh. Left a (hopefully} positive message for Thright on his talkpage. Keeper | 76 | Disclaimer 20:40, 17 March 2008 (UTC)[reply]

    Hi, I may be misinterpreting something here so would appreciate someone else's take on it. This spin-off article was just "kept" from AfD and the nominator blanked via redirect (diff here). I reverted and now the same user has installed an super-sized clean-up tag. Was this AfD wrongly closed? If so could it be re-opened? Benjiboi 19:30, 17 March 2008 (UTC)[reply]

    At best, the AFD should have been closed as "no consensus to delete" rather than as "keep" since there were 6 keep votes to 4 delete votes, which is hardly a consensus to keep. But since the people who voted to "keep" didn't present a single argument why the article is not a policy violation, it really ought to have been closed as "delete" since what counts at AFD is discussion, not nose-counting. —Angr If you've written a quality article... 19:35, 17 March 2008 (UTC)[reply]
    I couldn't help but smile at the tag which says "It contains a plot summary that is too long compared to the rest of the article.". There is no "rest of the article" - it's all a plot summary. Should've been deleted. Black Kite 20:05, 17 March 2008 (UTC)[reply]
    If I had found a tag that said "This article consists of nothing but plot summary", I would have used it. —Angr If you've written a quality article... 20:06, 17 March 2008 (UTC)[reply]
    WP:DRV would not be inappropriate here. It is possible for the article to become encyclopedic, but experience suggests that such improvements are rare. Black Kite 20:08, 17 March 2008 (UTC)[reply]
    There was no consensus to delete that article and this thread isn't really appropriate for ANI. --Pixelface (talk) 20:10, 17 March 2008 (UTC)[reply]
    The article clearly fails policy and so consensus (which was fairly even anyway, and thus not consensus) is irrelevant. However, you are correct that this is the wrong venue. Black Kite 20:14, 17 March 2008 (UTC)[reply]
    Pixelface, or anyone, where should this thread go; also per comments above could someone revisit the AfD and correct if "keep" should actually be "no consensus"? Benjiboi 20:21, 17 March 2008 (UTC)[reply]
    It's now at DRV. —Angr If you've written a quality article... 20:43, 17 March 2008 (UTC)[reply]
    Now that I think about it, this thread may be appropriate for ANI. Angr, you really shouldn't be redirecting articles after a deletion discussion has closed if you're the one who nominated the article for deletion. --Pixelface (talk) 21:56, 17 March 2008 (UTC)[reply]

    Black Kite, you have it ass-backwards. Policy does not trump consensus; rather, consensus trumps policy (which is totally non-binding and non-normative). Wikipedia is not a bureaucracy. If people agree that X is the right thing to do, then it should be done, regardless of the "rules". Kurt Weber (Go Colts!) 23:59, 17 March 2008 (UTC)[reply]

    In this case, however, the policy has consensus, and the AFD didn't. There was no consensus to keep this article. No one disputed that the article violates WP:NOT#PLOT. The people who voted "keep" simply didn't care that the article violates policy. —Angr If you've written a quality article... 00:04, 18 March 2008 (UTC)[reply]
    So what? So-called "policy" on Wikipedia is totally non-binding anyway. It merely describes what people have done in the past; we are under no obligation to obey it in the present, in any situation. If there's not a consensus that the right thing to do is to delete the article, then there is no consensus to change the status quo, so the article should stay. Kurt Weber (Go Colts!) 00:12, 18 March 2008 (UTC)[reply]
    The problem is that AfD is not a voting process and should not be treated as such, those who voted keep only made a difference because the closing admin decided to count their arguments as "votes", so in this case, definitely in violation of WP:PLOT and should be redirected. The Dominator (talk) 03:34, 18 March 2008 (UTC)[reply]

    Arguing about the pointless rather than the issue.. the issue here is an article was closed at AfD as Keep but someone came along and blanked it and redirected it somewhere else - against Keep. So what's being done about that. - ALLSTAR echo 03:39, 18 March 2008 (UTC)[reply]

    Well Angr was warned about redirecting the article after the deletion discussion closed and Black Kite took the article to DRV, so I'd call this thread resolved. --Pixelface (talk) 04:02, 18 March 2008 (UTC)[reply]

    Threat posted on Roberto Carlos(singer) page

    - - : this threat was posted not to long ago by a long term vandal. What should we do about it. So I just brush this under the carpet ; the same thing that Wikipedia does when ever this site has a death threat, or do I get law enforcement on the phone. I'm going to file a report on user:Mmbabies for making a death threat. Its a federal felony. Wikipedian Foundation ; keeps just standing there like some pole , and lets this idoit have a field day out there. I'm going to do something about this idoit for once okay.Rio de oro (talk) 20:16, 17 March 2008 (UTC)[reply]

    Um OK! Don't let the trolls get to you. That is what they want. Theresa Knott | The otter sank 20:21, 17 March 2008 (UTC)[reply]
    (ec) The edit introducing inappropriate content was quickly reverted and the user making the edit warned. What else should we do, bearing in mind the edit was made by a dynamic IP? Stifle (talk) (trivial vote) 20:22, 17 March 2008 (UTC)[reply]
    This is User:Mmbabies, who has a history of making death threats, and who has been reported to his ISP, but nobody there seems to care. Corvus cornixtalk 20:34, 17 March 2008 (UTC)[reply]

    Hmm could another admin take a look at Rio de oro 's contributions list. I smell a rat here but maybe I'm being overly suspicious. Theresa Knott | The otter sank 20:31, 17 March 2008 (UTC)[reply]

    Uh.. Theresa . What you mean I'm a rat. —Preceding unsigned comment added by Rio de oro (talkcontribs) 20:40, 17 March 2008 (UTC)[reply]
    She said she smelled a rat, not that you were a rat. -Djsasso (talk) 20:41, 17 March 2008 (UTC)[reply]
    I dont get her deal here. I was just reporting a death threat that Mmbabies entered on a article. Okay. I was trying to follow WP:TOV Rio de oro (talk) 20:43, 17 March 2008 (UTC)[reply]
    From your edit contributions you seem obsessed by him. Theresa Knott | The otter sank 20:47, 17 March 2008 (UTC)[reply]
    Okay first off Miss. I filed aWP:ABUSE on him on 3 February 2008 on one of his latest socks okay. Second, me and several other people have been trying to get law enforcement to deal with his bs he HAS been CAUSING . OKAY. So Stop saying that. I dont what gives you the right to be "digging" around my contributions. That was a violation of my privacy. I didnt agree to you do that . Okay miss.Rio de oro (talk) 20:53, 17 March 2008 (UTC)[reply]
    You have no rights of expectations of privacy concerning your contributions. That's what your Contributions page is for. You do have the right to expect privacy concerning your personal data. Corvus cornixtalk 20:57, 17 March 2008 (UTC)[reply]
    A variety of editors appear to have sought the attention of ISPs and law enforcement to Mmbabies as described at Wikipedia:Long term abuse/Mmbabies and its Talk page. It appears there is no official response, but Wikipedia has tried the experiment of imposing very large range blocks which have not been completely successful. New ideas for dealing with this editor are welcome. EdJohnston (talk) 21:16, 17 March 2008 (UTC)[reply]

    How many times do we have to say it here, Rio...revert, block, and ignore. That's all you have to do. These 'death threats' by him are never serious, and are more annoying than something to be freaked out about at all. He does this all the time, it's part of his sock modus, has been for months and months. There is no need to overreact to his threats because they're always the same, every time. I have been dealing with his vandalism for a year and the best thing to do for him until he gives up is to just hit revert on every edit and block him to discourage him from editing further. I understand your zeal in wanting to control him, but making a big deal out of every one of his Control+V'ed threats isn't going to help anybody and just give him more of the attention he desires. Nate (chatter) 21:20, 17 March 2008 (UTC)[reply]

    Revert, block, ignore is the only way to effectively deal with this type of vandal. If we freak out of these "death threats" or for that matter suicide threats then we simply encourage the troll to continue. Rio de oro your repeated posting here even though the IP's are blocked and the police have already been contacted achieves nothing except giving the troll the attention he craves. Theresa Knott | The otter sank 21:25, 17 March 2008 (UTC)[reply]

    I know by every comment we make here that troll gets fatter and fatter but it's very simple: If we stop talking about him, he'll just go away. Wildthing61476 (talk) 21:26, 17 March 2008 (UTC)[reply]
    Agree, and Rio has been told this way too many times. Tiptoety talk 22:04, 17 March 2008 (UTC)[reply]
    Hmm so he has. Theresa Knott | The otter sank 23:06, 17 March 2008 (UTC)[reply]

    Request for deleted articles

    Resolved

    These diffs explain the situation fairly well: [95] [96]

    Should the deleted articles be provided? I think the fact that he's blocked is irrelevant here, as it wasn't related to mainspace content. Nousernamesleftcopper, not wood 21:02, 17 March 2008 (UTC)[reply]

    I'd say provide 'em; if somebody reposts them to the mainspace, it's just going to quickly expose them as a sock. Sarcasticidealist (talk) 21:26, 17 March 2008 (UTC)[reply]
    Dloh supported it too, so I've sent them. Nousernamesleftcopper, not wood 22:39, 17 March 2008 (UTC)[reply]

    Possible Rms125a sock

    Resolved
     – All in all it's just another sock in the wall. SirFozzie (talk) 23:22, 17 March 2008 (UTC)[reply]

    One Night In Hackney (talk · contribs) has just reverted an edit by Sovietjewelry (talk · contribs) to the article Roland Arnall‎ with the edit summary "rv sockpuppet of banned editor". On his/her talk page, Hackney explained that Sovietjewelry (talk · contribs · deleted contribs · page moves · block user · block log) was the sockpuppet of Rms125a@hotmail.com (talk · contribs · deleted contribs · page moves · block user · block log). I have never dealt with Rms125a, so I have no idea if this is reasonable. I therefore want to request the input of admins who have dealt with Rms125a. If this is true, Sovietjewelry should obviously be blocked. AecisBrievenbus 23:10, 17 March 2008 (UTC)[reply]

    It's pretty straightforward. User:Danapointca is an RMS sockpuppet, who frequently stalks my edits. I reverted their edits to John Magee (bishop), then RMS as an IP (check the RMS SSP category) made this pair of edits. Another NY based IP (where RMS openly admits to living) reverted to the previous version, then lo and behold Sovietjewelry makes this edit, to the exact previous version. SirFozzie and Alison have ample experience, I'll ask them now. One Night In Hackney303 23:17, 17 March 2008 (UTC)[reply]
    Yup. Pretty straightforward here. I've done the needful on the latest sock's page, and blocked. SirFozzie (talk) 23:22, 17 March 2008 (UTC)[reply]
    Totally an RMS sock. Just block and move on. I've already blocked one or two today, but there'll be more tomorrow. And on it goes ... - Alison 23:25, 17 March 2008 (UTC)[reply]

    FYI: Ronald Kessler's editing of his own article on Wikipedia, specifically his scrubbing of a correction he was forced to make on a recent NewsMax column, is starting to receive significant off-wiki attention. Shem(talk) 23:26, 17 March 2008 (UTC)[reply]

    The article wasn't close to OK, with large parts of it sourced to political blogs. I've fixed that. Someone may want to drop a line on User:KesslerRonald's talkpage directing that account to WP:AUTO if it applies. Relata refero (talk) 23:53, 17 March 2008 (UTC)[reply]

    I'm edging up on 3RR...

    ...for a candidate for the WP:LAME Hall of Fame. An IP, 209.247.22.149, insists that the site visited by Curious George and The Man With the Yellow Hat in one episode is "The United Kingdom". Per the show's website, it's Scotland. I've placed this on the talk page. The IP is, ahem, compromising, by changing "Scotland" to "The United Kingdom (Scotland, to be exact)". Even though it makes my brain ache to see that, I'm leaving it alone--because I've already reverted them 2x today. Am I right to be unsatisfied by this particular compromise? And strictly speaking, hasn't the IP crossed 3rr by reinserting the edits? (Apologies if this is really as lame as I think it is...)Gladys J Cortez 01:30, 18 March 2008 (UTC)[reply]

    Pointless to argue. I've changed it to just Scotland, and if readers don't know where that is, they can follow the Wikilink; that's what they're for. I've watchlisted the page and will resist any attempt to introduce language barbarisms. --Rodhullandemu (Talk) 01:59, 18 March 2008 (UTC)[reply]
    You have my gratitude. Gladys J Cortez 02:06, 18 March 2008 (UTC)[reply]

    IP block

    Could somebody look at the block of 58.120.227.83? It's indefinitely blocked after one contribution, and the talk is IP protected so that it can't be {{unblock}}ed. The block log of the talk doesn't exactly explain the protection or indef block. It's listed as a TOR node, but it was my impression that these weren't supposed to be blocked indefinitely (and there hasn't been any vandalism of the talk to warrant the protection there). Thanks 74.220.207.195 (talk) 02:14, 18 March 2008 (UTC)[reply]

    (ec) I've notified Ryulong, the blocking admin according to the log. If I can offer a suggestion, you might want to start there next time.... --jonny-mt 02:25, 18 March 2008 (UTC)[reply]
    Block looks OK per Wikipedia:Open proxies, and User:Ryulong knows what he's doing. Have you asked him and why should it be unblocked anyway? --Rodhullandemu (Talk) 02:27, 18 March 2008 (UTC)[reply]
    The protection expires, that's no big deal. I've reduced the block to 1 year, they usually (correct me if I'm wrong) stop being TOR nodes after awhile. Keilana|Parlez ici 02:32, 18 March 2008 (UTC)[reply]
    It's still a TOR node.—Ryūlóng (竜龙) 03:52, 18 March 2008 (UTC)[reply]
    Oh, and the IP posting this request is on a hosting server, which are mostly open proxies.—Ryūlóng (竜龙) 04:03, 18 March 2008 (UTC)[reply]
    And it has an open port 80 too. Odd, that someone using proxies would want a proxy unblocked. Thatcher 06:28, 18 March 2008 (UTC)[reply]

    User Viridae violating WP:CANVASS

    It would appear that Viridae is violating Wikipedia's policies on canvassing to influence the outcome of a deletion review. See the edits here and here. Bongout (talk) 02:58, 18 March 2008 (UTC)[reply]

    That's not really canvassing, he's just notifying 2 people that will likely want to comment. John Reaves 03:01, 18 March 2008 (UTC)[reply]
    He solicited the opinion of someone he knew would be in agreement with him: "...because you are the person most likely to get the deletion reason, something that sails far above the heads of many others." Further action needs to be taken against Viridae for his highly inappropriate unilateral conduct because there was ongoing discussion, and he chose to dismiss all of it of his own accord. RTFA (talk) 03:07, 18 March 2008 (UTC)[reply]
    He's cherry-picking people he knows will likely want to comment in favour of his position, something that is made very clear by those edits. Bongout (talk) 03:12, 18 March 2008 (UTC)[reply]
    It may not be entirely appropriate, but it certainly doesn't require sanctions. John Reaves 03:14, 18 March 2008 (UTC)[reply]
    I don't believe this is a good interpretation of Canvas and Durova and Doc glasgow's views are indeed to be hoped for in such a DRV. Thanks, SqueakBox 03:16, 18 March 2008 (UTC)[reply]
    This may be the case, but the guideline clearly states Always keep the message neutral and Viridae's message to Doc glasgow clearly violated this. It also states Do not attempt to sway consensus by encouraging participation in a discussion by people that you already know have a certain point of view and Durova has very well known views on BLPs. Bongout (talk) 04:06, 18 March 2008 (UTC)[reply]
    Contacting two users isn't canvassing, and is perfectly appropriate. It's especially appropriate for an issue such as this, where there is certain to be a prolonged discussion. — Carl (CBM · talk) 03:19, 18 March 2008 (UTC)[reply]

    Oh pull the other one. Durova had already discussed the article in question and possible deletions of it. Doc is the most clued in person on the project BLP wise, even if I don't always agree with him and is likely to want to be involved in an issue such as this. ViridaeTalk 03:33, 18 March 2008 (UTC)[reply]

    (EC)::I agree with Squeakbox, CBM and John Reaves. Carefully reading WP:CANVASS reveals that there are only very slim arguments that could be made for a violation by Viridae. The scale was definitely limited. Votestacking, per WP:CANVASS, involves mass talk messages - these were two individually worded messages (one was simply "Heads up, D"). One could make an argument that the first one was not neutral - although no effort was made to TELL Doc to vote one way or the other. Was he campaigning? Well, again, the policy paints a gray area on this one - you have to take scale into account. Here, it was only two people. Was this action completely appropriate? Possibly not. Are there any warranted sanctions (or really, any warranted actions at all)? Not in my opinion. Although that last addition by Viridae wasn't exactly mature. Tanthalas39 (talk) 03:36, 18 March 2008 (UTC)[reply]
    Doc is often involved in deletion reviews and it appears that Durova was involved with this article previously. So, not canvassing. Cla68 (talk) 04:11, 18 March 2008 (UTC)[reply]
    It is canvassing because the message was clearly not worded neutrally and it was an obvious attempt to sway consensus. Bongout (talk) 04:14, 18 March 2008 (UTC)[reply]
    No one agrees with you, nothing is going to happen, so just drop it. John Reaves 04:18, 18 March 2008 (UTC)[reply]
    There are well-respected people who agree with me, both in this section and in the deletion review. Bongout (talk) 04:33, 18 March 2008 (UTC)[reply]
    At the present, the only person in this section who has agreed with you is RTFA, a sockpuppet. If Viridae's talk page messages violated WP:CANVASS, the problem is with the canvassing document rather than with the actions. In particular, there is no reason that every talk page message has to be neutrally phrased. — Carl (CBM · talk) 04:38, 18 March 2008 (UTC)[reply]
    It is not my contention that every talk page message need be worded neutrally. Also, while RTFA is a sockpuppet, as explained here, this they are a well-established user in good standing merely attempting to separate edits on subjects. This isn't a violation of policy, of trust, or of anything else.Bongout (talk) 04:48, 18 March 2008 (UTC)[reply]
    Not even every message that tells someone else you want them to support you in an AFD or DRV. Your responses here seem to alternate between wikilawyering over the wording of CANVASS and wikilawyering over the manner in which others respond to you. I think I'll take John's advice. — Carl (CBM · talk) 04:52, 18 March 2008 (UTC)[reply]

    If WP:CANVASS were to prevent wise folks like Durova or DocG from commenting anywhere, I'd say there was a bit of a problem. ;-) --Kim Bruning (talk) 04:15, 18 March 2008 (UTC)[reply]

    No one is suggesting that they be prevented from commenting. ;-) Bongout (talk) 04:16, 18 March 2008 (UTC)[reply]
    (ec. *2) ... okay... so what are you suggesting? --Kim Bruning (talk) 04:21, 18 March 2008 (UTC) (ec)[reply]
    That Viridae be prevented from consensus canvassing. Bongout (talk) 04:48, 18 March 2008 (UTC)[reply]
    Which would mean that you are opposed to Durova and DocG having been contacted, (as that is canvassing, according to you) correct? --Kim Bruning (talk) 05:47, 18 March 2008 (UTC)[reply]
    Incidentally, is it just me, or do several folks consider BLP to override all else? --Kim Bruning (talk) 04:18, 18 March 2008 (UTC)[reply]
    That's because it does, IMO. It's our most important content policy, because it takes all the other content policies we have and distills them down for a single issue where it is vitally important that we not screw up: the lives and reputations of living people. FCYTravis (talk) 04:23, 18 March 2008 (UTC)[reply]
    When used correctly, it should. John Reaves 04:22, 18 March 2008 (UTC)[reply]
    Yes, I'd say that both Doc G and Durova's input generally substantially improves the quality of discussion in any BLP matter. FCYTravis (talk) 04:20, 18 March 2008 (UTC)[reply]
    Which anyone would think who is generally in favor of deletion. The bottom line is that anyone paying attention to BLP-penumbra issues at all knows exactly how Doc would respond and know how Durova would likely respond as well. At best, this Viridae should have ealized that this looked bad. JoshuaZ (talk) 05:06, 18 March 2008 (UTC)[reply]

    This is asinine. I move that Bongout be censured for violation of WP:AGF. Jtrainor (talk) 05:16, 18 March 2008 (UTC)[reply]

    (ec) That's as blatantly absurd as Bongout's idea that this was canvassing. I suggest that this section's discussion be closed as it's just rehashing now. ···日本穣? · Talk to Nihonjoe 05:24, 18 March 2008 (UTC)[reply]
    Censured? We can do that? :-) --Kim Bruning (talk) 05:53, 18 March 2008 (UTC)[reply]
    See, it would be a proof-by-counterexample sort of thing. We would show that Assuming Good Faith is important by failing ourselves to do it for him, and letting him know how it feels. Disputes can be kept alive for years that way, if you're dedicated enough. -GTBacchus(talk) 06:02, 18 March 2008 (UTC)[reply]
    And that, of course, would be a textbook example of disruption to make a point <GRIN> --Kim Bruning (talk) 06:07, 18 March 2008 (UTC) You wouldn't believe how many people get WP:POINT wrong. Basically, if you're not grinning from ear to ear at the sheer creative audacity of it all, even while preparing to click the block button... it probably wasn't a WP:POINT violation. ;-)[reply]

    Not sure if anyone mentioned this yet, but there already was a related discussion on Durova's talk page when Viridae left a message. -- Ned Scott 05:22, 18 March 2008 (UTC)[reply]

    Which is kinda sorta why I left her a message. Ned You have a great skill in pointing out the obvious sometimes when other people have been entirely oblivious to it. Keep it up. ViridaeTalk 07:05, 18 March 2008 (UTC)[reply]
    Yup, Ned nails it. I was already considering nominating that article myself. Don Murphy falls within my standing offer for courtesy BLP nomination. Viridae followed up on the active discussion to mention he'd already taken action. I've got some concerns about his decisions today on a process level, but canvassing isn't one of those concerns. DurovaCharge! 09:37, 18 March 2008 (UTC)[reply]
    Look at the last AfD which I initiated. It's pretty clear that simply deleting the article is not considered acceptable by large numbers of people. Where is the on-wiki discussion prior to this deletion? Guy (Help!) 14:15, 18 March 2008 (UTC)[reply]
    If he called to view the discussion 2 people he knew would have a similar desired outcome for it to him, he should have also asked a couple of people he knew to be on the other side of the debate, otherwise it does risk skewing it. The special, the random, the lovely Merkinsmum 18:03, 18 March 2008 (UTC)[reply]

    A new vandalism-only account?: Roosterpunk430

    Left a warning. In the future, please use WP:AIV for a more direct response (remember to warn them first!). Thanks, Master of Puppets Call me MoP! 07:38, 18 March 2008 (UTC)[reply]

    Reporting user for continued Wikipedia disturbance, including repeated sock puppetry

    I, WalterGR (talk · contribs · deleted contribs · page moves · block user · block log) am reporting Kilz (talk · contribs · deleted contribs · page moves · block user · block log) for repeated sock puppetry use during edit wars and continued disruption of the editing process. (Please forgive the length of this entry - I just wanted to make sure I thoroughly documented the sock puppetry.)

    Previous incidents:

    Incidents not yet reported:

    • Of Kilz's approximately 1,200 edits, about 1,100 - over 90% - are related to controversy he has stirred up in the following 3 articles:
    • I have identified 4 sock puppets which Kilz uses to make edits during these edit wars, and to agree with his arguments in discussion pages:
    • Use of Loki144:
    • Kilz argues for the removal of a reference for benchmark data which shows Swiftfox is faster than Firefox:
    • "The site is also a private site listing the findings of only one person with no editorial oversight and is therefore not a creditable source [WP:RS]..." (diff: [100])
    • Loki44 backs Kilz up:
    • "The browser speed test site is also a private site and not a reliable source." (diff: [101])
    • Use of IDontBelieveYou:
    • When Kilz argued for the removal of the reference for benchmark data, he also said:
    • "If we cant find information on the 2.0 version from a reliable source the section needs to be removed IMHO." (same diff as above: [102])
    • IDontBelieveYou backs Kilz up:
    • "I agree with you Kilz... This article should be about 2.0. If we can't find references for the speed section for 2.0, the section should be removed." (diff: [103])
    • Kilz doesn't believe Swiftfox is faster than Firefox.
    • Kilz removes the text "The name Swiftfox implies a faster browser than Firefox" (diff [104]). It gets added back in. Kilz then adds a {{fact}} tag (diff [105]). It gets removed. Kilz adds an {{unreliable}} tag to the section instead (diff [106]). It gets removed. He adds it again (diff [107]). It gets removed again.
    • IDontBelieveYou comes to Kilz's aid:
    • He makes the following edit: "The name Swiftfox comes from the animal Swift Fox which coincidently implies speed". (diff [108])
    • That edit gets removed, then Kilz "restore[s] edit of idontbelieveyou" (diff [109])
    • Use of IDBYou and StVectra:
    • StVectra agrees with Kilz:
    • "Microsoft in this instance is not a reliable source. It is writing about itself WP:SELFPUB clearly says it cant be used as a reference when it includes claims about third parties." (diff [111])
    • Kilz later responds:
    • "You cant use the source. It is self published , and has claims about a third party." (diff [112])
    • Sock pupped IDBYou backs Kilz and StVectra up:
    • "WP:VER is very clear, you can not use self published sources. I think the section needs to be removed as it also has claims against a 3rd party" (diff [113])
    • Kilz later argues that blogs cannot be used as sources:
    • "This is from a Blog, blogs are not usable as sources WP:SPS." (diff [114])
    • StVectra agrees:
    • "I agree that blogs should not be used as sources or references. They all to often have bias that is impossible to remove." (diff [115])
    • Kilz agrees with the bias point:
    • "Every blog has bias." (diff [116])
    • Kilz later disagrees with blogs I have removed:
    • "Ars Technica is a news site. That they use Groklaw as a source in no way makes them unusable. FanaticAttack is not a blog in my opinion but an news site that covers a wide range of topics. The article is neutral. That it has a place for comments is besides the point. GrokDoc is a wiki, but it is not an 'open wiki'." (diff [117])
    • StVectra agrees with Kilz:
    • "Use of information on Groklaw is not a reason to remove another site. Fanaticattack is not a blog IMHO, and the neutral style they use is that of most news sites. I am not so sure about Grokdoc more because of a neutral point of view problem. Open wiki's are those that allow anon posting, it is not open." (diff [118])
    • Kilz removes information (diff [119]) that later gets restored. IDBYou removes the same information (diff [120]).
    • IDBYou removes some quotations from the same section (diff [121]) that are later restored. Kilz removes some of them again (diff [122]).

    Kilz's periods of editing activity - whether via sock puppets or his logged in account - are directly correlated to edit wars and controversy within those articles.

    • Swiftfox: This dispute was summed up here. Kilz believes Swiftfox is non-Free Software and is opposed to non-Free Software: "There are a few of us on the Ubuntu forums who oppose non free software... Jason has tried to stop me from telling people Swiftfox is non-free... I think I know how unethical he is, and know he will lie to win." (diff: diff).
    • Office Open XML and Standardization of Office Open XML: On Kilz's talk page, "Groklaw - I find the site facinating. When I found it 2 1/2 years ago I was still using Windows. The site has changed how I feel about freedom and the court system. Ubuntu - I have completely removed Microsoft from my life. I do not miss it in any way." (diff: [123]) Groklaw is critical of Office Open XML standardization.

    While every editor has a point of view, Kilz is extremely and continuously disruptive.

    If necessary, I can provide more info on request.

    Thanks, WalterGR (talk | contributions) 10:15, 16 March 2008 (UTC)[reply]

    Kilz may also be using the Tor (anonymity network) to make untraceable anonymous edits during edit wars. I can provide diffs if desired. WalterGR (talk | contributions) 01:15, 17 March 2008 (UTC)[reply]
    Restoring unresolved section archived by MiszaBot II. WalterGR (talk | contributions) 06:41, 18 March 2008 (UTC)[reply]
    Your best bet is WP:SSP. ColdmachineTalk 09:47, 18 March 2008 (UTC)[reply]
    It was suggested I come here given the past violations of this account, the ongoing sock puppetry, the use of TOR during edit wars, and continued disruption. But if WP:SSP still really is the best place to post this, then I'll go there. Let me know. Thanks, WalterGR (talk | contributions) 16:37, 18 March 2008 (UTC)[reply]

    User:Nicolaas Smith: repeated personal attacks

    I (and others) are being repeatedly attacked at the Talk:Inflation page. I am hard-pressed to place all the diffs due to the editing storm by this user:
    (Note: this user is a confirmed sockpuppeter who has recently used different log-in names and frequently does not log in - see my note to him that I would only mention this if he appeared to be sockpuppeting by not logging in or using different names: Diff from talk page. In this same communication on his talk page, I also requested he stop referring to me when there is no connection. This is repeated in subsequent communications, politely; this conversation was then posted to the inflation talk page: cross-posting of info.
    1. "What is the talk page for then? Here we are suppose to state things and discuss things. If you remove it from the talk page then what is this talk page for? Are you crazy or what? Nicolaas Smith (talk) 22:10, 16 March 2008 (UTC) the sockpuppet"
    2. Accusation of censorship: :"although editor Gregalton wants to censor me..."Nicolaas Smith (talk) 15:33, 16 March 2008 (UTC)
    3. Accusations of puppetry: "Puppet Gregalton will hate the fact that I can add my knowledge to Wikipedia...Puppet Gregalton will certainly find ways to still bannish my work from Wikipedia. Nicolaas Smith (talk) 18:57, 17 March 2008 (UTC)
    4. Comparison to Mugabe: "If you do not want me to mention your self-puppet name - it is not your real name - on Wikipedia you will have to leave Wikipedia. Have you never heard about freedom of speech? You will do well in Robert Mugabe´s government. Nicolaas Smith (talk) 19:38, 16 March 2008 (UTC)"
    5. Denial of comparison in response to polite request: "I did not compare you to Robert Mugabe. I said "You will do well in Robert Mugabe´s government." Signed: Nicolaas Smith - Gregalton´s favourite sock puppeteer. —Preceding unsigned comment added by 87.103.77.114 (talk) 07:18, 17 March 2008 (UTC)"
    6. Don't even know what to say about this: "Don´t give me the story about "personal attack". Are you here in person? No. You are not here in person. You are here as a puppet of your real self. No-one knows who you are. I am here as myself, Nicolaas Smith. I am not a puppet. You are the puppet. I can attack your puppet, if I want to - and bear the consequences. I did not compare the puppet Gregalton to Robert Mugabe. I said that the puppet Gregalton will do well in Robert Mugabe´s government. The real person who uses the puppet name Gregalton will most probably behave differently when not hiding behind the anonymity provided by the puppet name Gregalton. It is impossible for me to attack your person. I do not know who you are. You are not here as a person but as a puppet of a person. A person who no-one knows"
    7. More of the same: "There is a difference being on here as a person in your personal name and being on Wikipedia as a puppet. You know that very well. Puppets like you have the advantage of anonymity. You have already abused that advantage in the past with attacks against me personally or against my puppet self when I was on here as a puppet (not a sockpuppet) - I can´t remember whether you attacked my puppet self of me personnally. I will not waste time to check. I do remember it happened."
    8. General rudeness: "It is absolutely reprehensible and contrary to the spirit of Wikipedia that a very experienced editor like Gregalton knows about the Citing Oneself Wikipedia Policy and does not point it out to inexperienced editors like me. Nicolaas Smith (talk) 21:16, 17 March 2008 (UTC)". Since this whole bizarre history with this editor started some time ago, and he was confirmed as a sockpuppeter July 2007, hard to say inexperienced.
    As further background, this editor has repeatedly attempted to push his own theory, self-published (although may have been published recently, as "truth." (See " I think the fact that I say that accounting and accountants destroy real value is what people do not want to hear. Unfortunately it is true. But, the whole world is unfolding, as it should (is that a quote from Khalil Gibran?). So why not accounting too? Not updating constant real values is a serious matter and changing that assumption will change the current Historical Cost paradigm. So, it is a big thing. That is why everybody is so much against it." and numerous others."
    Grateful some attention to this, this is out of control on this one page (and this user keeps returning with editstorms every few months and then leaves in a huff, only to return more out of control).--Gregalton (talk) 07:42, 18 March 2008 (UTC)[reply]
    Eh, this is messy. I think there's an unnecessary amount of animosity between you guys. I'll drop a note on Nick's talk page about civility, though the issue here is that you guys are making your differences personal. That's not the way to go. Also, if you think there's sockpuppetry going on WP:SSP might help. Given the user's history, sockpuppetry will lead to an indef block. Master of Puppets Call me MoP! 07:51, 18 March 2008 (UTC)[reply]
    Thanks for your note. I think you will see from my note on the user's talk page that my interventions have been polite. It should be obvious from interactions with other editors the issue is a more general one - although the bulk of the animosity is directed at me.--Gregalton (talk) 08:02, 18 March 2008 (UTC)[reply]

    Dreadstar

    I am having trouble with an Administrator who goes by Dreadstar. I have continuously asked him for explanations and he has only been ambiguous and pushy.--UhOhFeeling (talk) 07:46, 18 March 2008 (UTC)[reply]

    Can you clarify (with diffs) what the problem is please? Cheers, Casliber (talk · contribs) 07:48, 18 March 2008 (UTC)[reply]
    How do you do diffs? He insist on adding citations which I would consider incorrect. Also, he is accusing me of making personal attacks and adding fact tags to try to promote a view or something, not really sure exactly what he means and he won't really respond directly to questions.--UhOhFeeling (talk) 07:51, 18 March 2008 (UTC)[reply]
    Well do you consider this a civil statement? he only noted the policy. - Caribbean~H.Q. 07:54, 18 March 2008 (UTC)[reply]
    No that's not my point, really wasn't trying to be rude, just all the darth and stars and stuff, that's besides my point. Apologies...nothing wrong with being young though.--UhOhFeeling (talk) 07:57, 18 March 2008 (UTC)[reply]
    See Help:Diff for information on diffs. Also, sometimes you can inadvertently push a point of view by bombing particular sections of articles with tags because you disagree with them. I'm not saying that's what you're doing, but that may be the perceived outcome. Master of Puppets Call me MoP! 07:58, 18 March 2008 (UTC)[reply]
    I understand, I really just don't see how my edits could be perceived as such. I usually just add the tag to statements that sound iffy or info I though needed clarification--UhOhFeeling (talk) 08:00, 18 March 2008 (UTC)[reply]
    Permit me to add my completely unsolicited 3rd party opinion, as it's late, I'm bored, and I happened to look into what UhOhFeeling is talking about. He's not drive-by tagging. He clearly was reading articles about pubs and drinking, and added {{fact}} tags in completely appropriate places.
    He did his duty in questioning whether curry is a common US/Canadian pub food, because that's absolute nonsense. ("Rubbish?") I'm from the US and have traveled across it. A citation about a single restaurant in Brooklyn does not make curry a common pub food in North America.
    I don't know who was being civil and who wasn't, but UhOhFeeling was not drive-by tagging.
    WalterGR (talk | contributions) 08:13, 18 March 2008 (UTC)[reply]

    UhOhFeeling most certainly is drive-by tagging. Three different administrators have had issues with UhOhfeeling's behavior. Also, Dreadstar tried to be informative and was met with the an insulting remark about his age, see here. As for drive-by tagging, well, make your own judgments, but several other editors complained about Uhohfeeling’s seeming over-tagging of articles. It certainly appears to me that they were correct. One article, Bhumibol Adulyadej, is an example where UhOhFeeling added a very large number of fact tags:[124][125][126][127][128][129][130] And on other articles as well: [131][132][133][134][135][136][137] As a matter of fact, out of UhOhFeeling's 51 mainspace edits, 46 of them were fact tag-related (about 90%). Anyway, several have tried to help and explain things to him, but it doesn't seem to have done much good. RlevseTalk 09:58, 18 March 2008 (UTC)[reply]

    Rlevse, you're not an innocent party either. A day after he created his account, you put on his talk page: "You're trolling and I doubt you're a brand new user." and later got upset when he responded to your accusations on your talk page. (Look - I've been editing for months and I'm still not sure what the proper protocol is for talk page back-and-forths.)
    In your guys' trying to help, I've only seen accusations of drive-by tagging, telling him to stop adding {{fact}}, and threatening to ban him.
    Keep in mind that different people contributes to Wikipedia in different ways, according to the volunteer time they choose to donate. Having information pointed out that needs references is useful, not something to be discouraged.
    So I'd say do this:
    • This all seems to be the fallout from edit wars. Let's cool down.
    • UhOhFeeling - check out {{refimprovesect}} which is documented here: Template:Refimprovesect. It's usually better to just put one of those at the top of the section, rather than several {{fact}} tags within the section.
    • Rlevse and Dreadstar: don't bite the newcomers. I didn't see anyone suggest {{refimprovesect}}.
    But then again, I'm no admin. Just a 3rd party. And I should have been in bed hours ago.  :) WalterGR (talk | contributions) 10:34, 18 March 2008 (UTC)[reply]
    He's not so new. He used to be User:Nigazblood. He's been talked to many times, and by more than Dreadstar and I. Tag-bombing to the point he did is counterproductive. He's had his chances. RlevseTalk 11:52, 18 March 2008 (UTC)[reply]

    Cardiff - repeated IP vandalism

    The article Cardiff has been repeated vandalised by an anonymous user who persists in inserting spurious and unsourced claims, as can be seen from the article's history page. The vandal appears to be using a dynamic (probably dial-up) IP address so even though warnings have been left in the past they seem to have done no good. Therefore, could someone semi-protect this page so that only registered users can edit it? Bettia (talk) 09:32, 18 March 2008 (UTC)[reply]

    Done. Cheers, Casliber (talk · contribs) 09:34, 18 March 2008 (UTC)[reply]
    Thanks matey! Bettia (talk) 09:40, 18 March 2008 (UTC)[reply]

    Actually, would it also be possible to semi-protect Wales as this user has also been 'active' on there as well? Bettia (talk) 09:46, 18 March 2008 (UTC)[reply]

    Yup - both semi-protected for 3 months. We'll see how it goes. Happy to reprotect after that date if the shenanigans continue. There is a specific page, WP:RFPP, for requests as well :) Cheers, Casliber (talk · contribs) 09:50, 18 March 2008 (UTC)[reply]
    Many thanks again. Bettia (talk) 10:05, 18 March 2008 (UTC)[reply]

    TFD closure overdue

    This TFD was "relisted". It is however, over 7 days old. Can someone close? http://en.wikipedia.org/wiki/Wikipedia:Templates_for_deletion/Log/2008_March_18 (irrel) NonvocalScream (talk) 09:57, 18 March 2008 (UTC)[reply]

    It's sort of pointless at this point. The consensus was for delete. I was browbeaten for closing it that way. So I relisted it and suddenly we have a slew of keep votes almost at once. 10:03, 10:24 and 10:27. The main complaint of the keep side was that there was "recruiting" on an IRC channel for delete votes. Well now I think we have it going on for the keep side. I say, scrap the whole thing and start over. Obviously, we have alot of passion on both sides and a fair vote is not going to happen. I tell ya. Unless it's overwhelming on either side, XfD votes have become a major pain. --WoohookittyWoohoo! 10:45, 18 March 2008 (UTC)[reply]

    my thoughts on assuming good faith. NonvocalScream (talk) 12:21, 18 March 2008 (UTC)[reply]

    Today's featured article vandalism

    Today's featured article contains unreverted vandalism in the first sentence. The word "Lesbian" remains as the result of this incompletely reverted vandalism edit [[138]]. Could an administrator please get on it? AKAF (talk) 10:54, 18 March 2008 (UTC)[reply]

    The article looks good now, but as a point of order for the rookie admin (me) - do we full protect the main page article, or just semi unless high levels of vandalism warrant a full protection? UltraExactZZ Claims ~ Evidence 12:18, 18 March 2008 (UTC)[reply]
    Semi-protect if it gets really bad and even then only for about an hour or two. Full protection shouldn't be used against vandalism. James086Talk | Email 12:21, 18 March 2008 (UTC)[reply]
    As James says semi at worst, but generally the daily featured article is never protected. It's on enough peoples watchlists that vandalism will be reverted straight away. Pedro :  Chat  12:23, 18 March 2008 (UTC)[reply]

    Haplogroup I1a (Y-DNA)

    Aaronjhill (talk · contribs) is a newbie here, but knows a lot about the population genetics of Haplogroup I1a (Y-DNA). Over the last two days he's substantially upgraded the article, significantly for prose style, but also adding a lot more content.

    Without discussing it either on the article's talk page, or Aaron's own page, User:Olly150 executed a sweeping revert at 11:53 GMT, [139].

    Then, when Aaron quietly continued adding accurate technical details about the mutations which characterise the haplogroup, User:Steve Crossin slammed him with four reverts and vandalism warnings on his talk page, following which Aaron was blocked by User:Kralizec!.

    Not suprisingly, Aaron is considerably annoyed, and as of this moment isn't sure he wants anything more to do with Wikipedia.

    Can we get him a speedy unblock, please? Jheald (talk) 12:41, 18 March 2008 (UTC)[reply]

    While this edit doesn't seem particularly helpful, I'm seeing a lot of apparently good-faith additions to the article in question. Let me look into this. UltraExactZZ Claims ~ Evidence 12:48, 18 March 2008 (UTC)[reply]
    I've left a notice for each of the involved parties (Olly, Steve Crossin, and Kralizec!), notifying them of this thread. I am inclined to unblock, but will wait a tic in the absence of discussion with/from Kralizec!. UltraExactZZ Claims ~ Evidence 13:03, 18 March 2008 (UTC)[reply]
    No unblock is necessary, as the block expired 11 minutes before Jheald`s first message on my talk page. Despite the four levels of warnings given by Steve Crossin (talk · contribs) (and regardless of edits like this that clearly are vandalism), I was not entirely convinced as to the merit of Steve Crossin`s block request, so I only gave Aaronjhill (talk · contribs) a 15 minute block. --Kralizec! (talk) 13:08, 18 March 2008 (UTC)[reply]
    Aaron's annoyance is perhaps understandable, but Aaron's communication skills could evidently use some work. Perhaps this would have been avoided if he'd taken a minute to explain in response to the warnings what he was doing rather than choosing this route to respond. I think Aaron could do with a friendly pointer to WP:AGF and WP:CIVIL and a suggestion that he try engaging the individual next time instead of vandalizing his userpage. --Moonriddengirl (talk) 13:14, 18 March 2008 (UTC)[reply]
    Friendly pointer so delivered. I do commend those who've left friendly notes apologizing and/or explaining on the user's talk page. Nice anti-biting and showing of good faith, in spite of the user-space edit. :) I hope the new user won't be discouraged won't be discouraged from continuing, but will also respond more directly should there be an unfortunate next time. --Moonriddengirl (talk) 13:35, 18 March 2008 (UTC)[reply]

    Since then, I have apologised to the user in question, and striked out the warnings, this is something I am deeply sorry about, and I again offer my apologies. Steve Crossin (talk) 13:13, 18 March 2008 (UTC)[reply]

    I also struck the block message and apologized. --Kralizec! (talk) 13:22, 18 March 2008 (UTC)[reply]
    I have left my apology on Aarons page and an explanation on Jheald's page also. Same reason as Steve - on vandalism patrol, the page came up on Lupin's AV, notably Line 380 - :Forward 5′→ 3′: gcaacaatgagggtttttttg - immediate reaction was too revert. If I had seen the page come up again, I would have looked into the history. I come accross vandalism like that all the time. Olly150 13:27, 18 March 2008 (UTC)[reply]
    Good on both Steve and Olly for responding so quickly, and on Kralizec! for striking the block template. Is there any un-reverting that needs to be done at the DNA article? UltraExactZZ Claims ~ Evidence 13:43, 18 March 2008 (UTC)[reply]
    Looks like Jheald reverted [140] the article immediately after his initial post here, and Aaronjhill has made over a dozen new edits [141] to the article. --Kralizec! (talk) 15:02, 18 March 2008 (UTC)[reply]
    I am tempted to say something smarmy about anyone who thinks that gcaacaatgagggtttttttg in an article about DNA is vandalism. Let me say instead that automated tools that alert one to potential vandalism are merely tools, and the edits need to be viewed in context. Acting on the advice of a script or bot without checking is irresponsible. Thatcher 16:55, 18 March 2008 (UTC)[reply]

    Underreporting deaths in Tibet on the Main Page

    I am upset that the Main Page is saying that "at least 10" people have been killed in the unrest in Tibet, when the official Chinese government figure (which I do not believe anyone should trust) is already at 13, and the figure from the Tibetan government-in-exile is up to 99. There have been complaints about this at WP:ERRORS#Tibet Story for three days now with no action.

    The Dalai Lama specifically states that he will resign if the violence continues, and that he is opposed to an Olympic boycott. Shouldn't that be included? All of the other "In the news" items are lengthier, so why not? SBPrakash (talk) 13:04, 18 March 2008 (UTC)[reply]

    I am moving your question to Template talk:In the news, which is the appropriate page here. Thanks. -- lucasbfr talk 13:13, 18 March 2008 (UTC)[reply]
    It says at the top of that page where you moved it, "To report errors that are currently on In the news, please post them on WP:ERRORS." The complaint, as I said, has been there at WP:ERRORS for three days without action. I am inclined to remove the archive notice here, but will ask someone else to because I'm scared of doing something against protocol that I don't know about. SBPrakash (talk) 13:17, 18 March 2008 (UTC)[reply]
    You are right, my mistake. Sorry! I commented at WP:ERROR. -- lucasbfr talk 13:40, 18 March 2008 (UTC)[reply]

    The Comparison_of_CECB_units article is uneditable

    There is a small group of persons "policing" that article. They refuse to allow other persons (like myself) to edit the article. Everytime someone tries, they immediately revert the change. Is that behavior appropriate or not? ---- Theaveng (talk) 13:21, 18 March 2008 (UTC)[reply]

    Maybe they have problems with the specific changes you're making, rather than with an outside person changing it as you seem to imply. —Random832 14:12, 18 March 2008 (UTC)[reply]
    Yup, you can't be in the majority all the time, I see no reason to suspect foul play here. -- lucasbfr talk 15:34, 18 March 2008 (UTC)[reply]
    You might get better results, Theaveng, if you do these things, some of which you may be doing already: (these are suggestions) you can talk more politely, for example avoiding saying things like "worthless" about some aspect of the article which no doubt someone else has expended work on; you can avoid using a lot of bold type, which may make you look angry; you can try to appear calm; you can apologize for your previous tone; you can present calm, logical arguments in favour of your changes rather than complaining that the article is uneditable; you can listen to others' point of view and say things that demonstrate that you understand it; you can present your suggested changes on the talk page before editing and discuss them and only implement them if they seem to have consensus. The others are not required to allow changes that they disagree with, but they should provide explanations for the reasons they oppose those changes. --Coppertwig (talk) 17:25, 18 March 2008 (UTC)[reply]
    I've notified Wikiproject Telecommunications in an attempt to bring more eyes, in any case. —Random832 19:46, 18 March 2008 (UTC)[reply]

    Single-purpose spamming account

    Resolved
     – User blocked indef. by Orange Mike. UltraExactZZ Claims ~ Evidence 14:30, 18 March 2008 (UTC)[reply]

    User:Thesnodgrass continues to add linkspam to various UK articles, despite warnings. I think a block is needed here. --RFBailey (talk) 14:04, 18 March 2008 (UTC)[reply]

    Unfair removal and block

    History: I'm an occasional but positive contributor to Wikipedia, after some problems with fair use images and the difficulty in trying to resolve them I created a userbox User:Bleveret/Userbox/BCBruin to state an opinion which was deleted. Consensus for this delete was dubious however I toned down the content of my opinion inline with the discussion to a new version User:Bleveret/Userbox/ruin. The new version is a soft opinion which is no different from many other userbox-stated opinions on the fair-use topic.

    Situation: Users User:Nyttend and User:Doc glasgow have deleted the new version of the userbox without consensus or discussion and further to that User:Doc glasgow has attacked me personally of being a troll. I'm sticking up for my right to express a non-offensive opinion but I'm certainly not a troll (I had to look up what one was). Apart for the actioning admins in this case other users/admins are supportive to me.

    Please can the new version of my userbox be re-instated so we can all get back to improving Wikipedia? --Bleveret (talk) 14:31, 18 March 2008 (UTC)[reply]

    I don't see much reason to delete that. However I see no reason to worry about it, either. How does this little irrelevant box relate in any way to your ability to improve Wikipedia? The only obstacle I see to your doing that, is that you're more concerned about your box than about editing, apparently. Heck, even the first version is something you ought to be allowed to say. Users are allowed to editorialize about Wikipedia in user space. Have you tried putting it on your user page instead of in a separate page? It might not get noticed that way. Friday (talk) 14:37, 18 March 2008 (UTC)[reply]
    I agree. State it on your user page, rather than in a userbox. Should be fine then. For the record, I think language divisive to a collaborative editing environment should be avoided. I'm waiting for a response from another user about a similar (but opposite) situation. It's in my contribs if anyone is desperate to see what I'm talking about, but please wait until I get a reply before commenting here or there. Carcharoth (talk) 14:52, 18 March 2008 (UTC)[reply]
    I think there were three things done wrong here: 1)The repeated deletion of his userbox, which was different than the one involved in an MfD. 2)The unwarranted block. 3)The fact that User:Remember the dot posted the MfD for DR, and User:Nick immediately closed it. Enigma msg! 15:45, 18 March 2008 (UTC)[reply]
    I should mention that User:Nick, the administrator who shut down the DRV request almost immediately, was the same one that deleted the userboxes in the first place. In any case, the new userbox is different enough from the original that the MfD discussion does not apply. If others still want to delete it then we can discuss it at MfD like civilized people. —Remember the dot (talk) 16:50, 18 March 2008 (UTC)[reply]
    • The root of the problem was the initial problematic actions taken. Whether RTD did it, or asked someone else to do it, they had to be rectified. As far as I'm concerned, Bleveret should've been unblocked immediately by whichever admin saw it first. Enigma msg! 17:38, 18 March 2008 (UTC)[reply]
    • But you have been wheel warring. For the record, I don't think the userbox should have been deleted. The first one (the one subject to the MfD), yes. The second, no. I also don't think Bleveret should have been blocked. That was clearly out of line. But so was unblocking him by a directly involved administrator, and so was restoring the userbox by that same administrator. There's 1500+ other admins. SOMEbody would have undeleted it. --Hammersoft (talk) 17:52, 18 March 2008 (UTC)[reply]
    • Can we just be happy that the misapplication of speedy deletion criteria and the blocking tool was quickly reversed, and that we are now in a position to discuss the issue like civilized people? —Remember the dot (talk) 18:02, 18 March 2008 (UTC)[reply]
    • I'm not looking for action against you. I am cautioning you that acting in the way you have has resulted in other administrators being forcibly de-adminned. Please use more caution in the future. When in doubt, see action/advice from an uninvolved administrator. --Hammersoft (talk) 19:30, 18 March 2008 (UTC)[reply]

    Norman Bettison

    Third vandalism this month to Norman Bettison: [142][143][144] Gordonofcartoon (talk) 14:35, 18 March 2008 (UTC)[reply]

    Not worrisome enough to warrant a block at this time, IMHO. If the problem persists, don't hesitate to poke me on my talk page. -- lucasbfr talk 15:37, 18 March 2008 (UTC)[reply]
    Agreed; there's a few admins watching the page, so if the IP gets more enthusiastic about it and edits more rapidly, someone will surely catch it. Right now, with a frequency of one edit every few days, it's not really block-worthy yet. Tony Fox (arf!) 15:51, 18 March 2008 (UTC)[reply]

    Request

    I would like to ask administrators intervention as I currently being harassed by particular contributor, who yesterday launch shameful campaign on my talk page (initially targeted and wrong person [145]) --- [146][147] [148][149] [150]. He/she was warned about personal attacks [151] but not stopping. May I ask sysop to additionally inform this particular person to stop this campaign and please protect my user talk page. Thank you, M.K. (talk) 14:36, 18 March 2008 (UTC)[reply]

    I have left the contributor a note regarding our guidelines on harassment, particularly user space harassment. I hope that the contributor will stop restoring the message. If not, a block to prevent further disruption is preferable to protecting your user talk page, which is an important avenue to allow other contributors to contact you. --Moonriddengirl (talk) 15:09, 18 March 2008 (UTC)[reply]
    Thank you for quick response, M.K. (talk) 15:10, 18 March 2008 (UTC)[reply]

    Repeated article blanking at Thought Adjuster and other articles

    Resolved

    I reported this to the vandalism noticeboard but was advised it should go here:

    User:ScienceApologist has repeatedly blanked a series of articles now despite being warned multiple times that WP:DELETE is being violated. The pages are a series of daughter articles related to a somewhat minor religion, which the editor personally doesn't seem to like. See the edit histories of articles like Thought Adjuster and Cosmology (The Urantia Book) (here and here). Both of which survived AfDs that the user has decided to override by page blanking. See also the discussion at Wikipedia:Fringe_theories/Noticeboard#Universe_reality_and_other_The_Urantia_Book_related_articles and the user's talk page, as well as my own. Wazronk (talk) 16:12, 18 March 2008 (UTC)[reply]

    Thought Adjuster could stand as a monument to unreferenced soapboxing pontification everywhere. Its continued existence shows that the WP:AFD process is badly broken. Raymond Arritt (talk) 17:35, 18 March 2008 (UTC)[reply]
    (ec)Both Thought Adjuster and Cosmology (The Urantia Book) should be redirects to The Urantia Book. They're completely unsupported by any independent secondary sources, and there's no reason they can't be covered in the parent article. The resulting walled garden is appropriately dealt with by redirecting them and merging relevant content - doing so is not "vandalism". Personally, I think the entire Urantia Book article ought to be evaluated at AfD as lacking in evidence of notability, but then I'm a mean deletionist. MastCell Talk 17:44, 18 March 2008 (UTC)[reply]
    Entirely not true, there are numerous secondary sources, and they have been added to the references section, since they were requested. There is a claim that there is some kind of "walled garden" when in fact repeatedly editors have been invited to discuss their concerns on the talk page, but they've instead chosen to blank articles. You haven't even tried to look up sources, engage in the matter with editors, or worked to improve the articles you want to somehow pretend are "walled" off. Wazronk (talk) 18:31, 18 March 2008 (UTC)[reply]
    User:Wazronk is invited to contribute to the main article The Urantia Book where some decent editing could be used. Forking guidelines are clear as to how one should fork articles, and the creation of the collection of a Urantia Book-related walled garden is inappropriate especially with single person accounts watching these articles so closely. I was responding, in point of fact, to a request on the fringe theory board which was properly filed and well-documented. Please direct further inquiries to Talk:The Urantia Book#Work on this article first.
    Also note that User:Mangojuice falsely claimed in an edit summary that there were secondary sources for Thought Adjuster when in fact there are not.
    ScienceApologist (talk) 17:45, 18 March 2008 (UTC)[reply]
    A number of administrators including User:Skomorokh and User:Mangojuice seem content to revert in the face of the above consensus and apparently not wishing to research the issue carefully. Please, administrators, do a little research before wielding a big stick in an misinformed way. It would be nice to see them actually comment before acting. ScienceApologist (talk) 17:58, 18 March 2008 (UTC)[reply]
    I did a "little research." This is a topic within the (admittedly strange and obscure) Urantia world view that is documented in quite a number of books. See [152]; particularly, note the Larson book which is, partly, an encyclopedia of religions. In any case, you do not simply edit war your way to a redirected article. You've put the article in a redirected state about 6 times in the past few days. Mangojuicetalk 18:14, 18 March 2008 (UTC)[reply]
    You seem to not be paying attention. Whether the topic is mentioned in certain books in relation to explaining Urantia beliefs is irrelevant: there is neither a connection to these books in the actual article content nor is there any indication that this topic is properly forked from the main topic. Please understand that you yourself are edit warring, and the fact is that there is consensus that these articles should be redirected to The Urantia Book means (irnoically) that it is you who are edit warring in oder to defy consensus at this point. That's some pretty bad precedent you are setting as an administrator. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)[reply]
    There has not been a consensus and blanking articles is a violation of policy at WP:DELETE. In fact there are extensive discussions in the past that led to the branching into daughter articles but you've been so intent on blanking and reverts that you haven't even stopped to discuss it with the editors who know the history of the articles in question. Wazronk (talk) 18:44, 18 March 2008 (UTC)[reply]
    The discussion between the two true-believers in The Urantia Book is meant to be binding here? No, we have the FTN discussion that shows clearly that these articles are inappropriately "branched". ScienceApologist (talk) 19:02, 18 March 2008 (UTC)[reply]
    If you, ScienceApologist, were to do a little research of your own, you might find that I am not, nor have I ever been an administrator. Regardless of the merits of your intentions, your methods are completely unacceptable; WP:FRINGE is no excuse to flout consensus. скоморохъ 18:27, 18 March 2008 (UTC)[reply]
    I guess it's okay when you are an administrator to throw out WP:AGF completely? I've done FAR MORE RESEARCH on this subject than you. My methods are no more "unacceptable" than your response in kind. Get over yourself: read the consensus that is achieved and add to the conversation or kindly stop acting as an obstructionist.
    I agree with your sentiment SA, and how you are carrying them out is akin to petty vandalism. I am not clear how redirecting though blanking the page isn't vandalism? Whether or not the articles deserve to stay, they are here now. Blanking and redirecting, without concensus is not the way. Nominate them for Afd, and I'll vote for a redirect. Hohohahaha (talk) 18:29, 18 March 2008 (UTC)[reply]
    Have I known you in a previous incarnation? ScienceApologist (talk) 18:59, 18 March 2008 (UTC)[reply]
    me too. --Fredrick day 18:31, 18 March 2008 (UTC)[reply]
    The point is that there is consensus demonstrated both here and at WP:FTN. ScienceApologist (talk) 18:32, 18 March 2008 (UTC)[reply]
    FTN is not the place to create consensus, and.... I don't see a consensus here. I suggest that instead of redirecting the talk pages of these articles, you actually use them. Hohohahaha (talk) 18:34, 18 March 2008 (UTC)[reply]
    What, in your humble estimation, the flip is FTN for if not to get consensus on issues related to fringe theories? 18:59, 18 March 2008 (UTC)
    There absolutely has not been consensus as is being pretended. Wazronk (talk) 18:38, 18 March 2008 (UTC)[reply]
    We know you own the content. Your ideas are weighted appropriately.ScienceApologist (talk) 18:59, 18 March 2008 (UTC)[reply]
    SA, can you point out the specific thread where consensus was obtained? Thanks, seicer | talk | contribs 18:40, 18 March 2008 (UTC)[reply]
    The FTN thread is fairly obvious. Anyway, it's a moot point. ScienceApologist (talk) 18:59, 18 March 2008 (UTC)[reply]

    ← Perhaps the most appropriate approach would be (as mentioned above) to nominate these via AfD and gauge consensus for deletion/redirect/fork articles that way. Even if a consensus exists on the fringe theories noticeboard, it would be a bit of a stretch to apply that without evidence of a similar discussion/consensus on the article talk pages. AfD is also a more "neutral" venue than the Fringe Theories board. MastCell Talk 18:44, 18 March 2008 (UTC)[reply]

    I have followed MastCell's advice thus making this report irrelevant. Please continue the discussion here: Wikipedia:Articles for deletion/The Urantia Book related articles.
    Please do note, though, that this kind of politicking is ridiculous. It's patently obvious that these articles are shitty excuses for content. Everyone who takes more than a passing glance at them (except the authors) agrees. Whatever. I'll let the administrators get back to their other power trips. ScienceApologist (talk) 18:56, 18 March 2008 (UTC)[reply]
    Resolved

    Obvious sock of long time blocked abuser User:Hornetman16. Like the latter, Hornetchild straight away introduces himself to WP:PW (Hornetman16 regulary edited WWE articles), see here. Also see his contribs. Indef-block please. D.M.N. (talk) 17:38, 18 March 2008 (UTC)[reply]

    Thanks East718 (talk · contribs) for blocking him indef. D.M.N. (talk) 18:06, 18 March 2008 (UTC)[reply]

    User:In the Stacks repeatedly re-inserting links against consensus

    User:In the Stacks has, over the course of the past six months, repeatedly added/restored a collection of links to the CrimethInc. article. I removed them, originally because they directly concerned sub-topics of the article, and later because I had integrated the reliable sources among them as references. Despite their presence as references, his reversion by three different editors, the opinion of three other editors on the talkpage that the inclusion of the links was not an improvement to the article, User:In the Stacks has continued to re-insert them. Attempts by myself and User:Murderbike to resolve the matter on the user's talkpage were unsuccessful. Neither of us want to continue reverting User:In the Stacks, so is there anything else that can be done? See the article's talk archive at Talk:CrimethInc./archive1 for a long history of the dispute. Thanks, скоморохъ 18:18, 18 March 2008 (UTC)[reply]

    I'd like to add that a total of six users have expressed the opinion that the external links section should not remain, while In the Stacks stands alone in the opinion that it should stay. Murderbike (talk) 18:33, 18 March 2008 (UTC)[reply]

    Context: CrimethInc. is an anarchist publisher, the disputed links were reviews of books published by CrimethInc. already present on the individual book articles (namely Recipes for Disaster). In The Stacks' contributions appear to be mostly edit-warring or discussion about edit wars. For disclosure, the three users who reverted User:In the Stacks are all members of the Anarchism task force). The CrimethInc. article was awarded GA status in the past few days, after which In The Stacks again added the links. скоморохъ 18:18, 18 March 2008 (UTC)[reply]

    I'm a bit worried that my assessment of the article as stable may have been premature, but if this is just one user acting against consensus, I don't think it's much of a problem. At any rate, have the rest of the steps in dispute resolution been tried? A request for comment on the article (maybe even on the user's conduct) may be in order. --clpo13(talk) 18:48, 18 March 2008 (UTC)[reply]
    I chose here rather than a request for comment because that seems like an overreaction; this dispute is rather silly, the editor is fighting a one-man battle trying to duplicate quoted references as external links. I was hoping if a posse of non-anarchism-related editors pointed out to the editor that he was acting against policy and ask him nicely to stop, we would not need to resort to formal mediation, topic blocks etc. I don't think your "stability" assessment is premature; as you allude to, a 1 vs 6 dispute about a fraction of the article's content is not a serious cause for concern. Thanks for weighing in, скоморохъ 18:58, 18 March 2008 (UTC)[reply]

    Harassment by Sethie

    I don't understand as why this particular user is after me, kindly have a look at his contribution's, [153] Since 11 March, he has used this account for single purpose which is to harass me, and has almost no contribution's on any article whatsoever, how can i prevent him from vandalizing my userpage or talk page ? --talk-to-me! (talk) 18:49, 18 March 2008 (UTC)[reply]

    Taking clue from what is stated below, is giving a person any name, violates wikipedia rules, as Sethie has done here, [154]. I am not aware of this person, or name, hence i simply ignored such wage imagination of Sethie, but his continual vandalizing my userpage, and giving warnings after warning on my talk page, forced me to report the matter here.--talk-to-me! (talk) 19:36, 18 March 2008 (UTC)[reply]


    Answered on your talk page. He has a point about your userpage though. You could settle this matter immediately if you simple removed your accusations. Theresa Knott | The otter sank 19:42, 18 March 2008 (UTC)[reply]
    Note also he was not asking you to reveal your real name only a previous wikipedia username. See [here] for why that account was banned. Theresa Knott | The otter sank 19:45, 18 March 2008 (UTC)[reply]


    User:Cult Free World/talk-to-me is using his user page for soapboxing and attacking various meditation groups. Please, please examine his contribs, he is not on Wiki to contribute meaningfully in any way, but to provocate and soapbox.

    As background, please note this user was blocked for one week here for making personal attacks.

    Upon return from his block, he continued the same vein of personal attacks, calling editors or admins cult-promoters and/or accusing them of being paid to post on Wiki (the following are just since his return from the block).

    1. Here he provocates by suggesting I am a paid member of a group. (a lie)
    2. Here he seeks an admin's help, and blatantly lies by saying "if you notice the time there was no edit from my side during that time frame" when he had numerous attack edits documented here, but they do not show now because the pages were deleted. This is an intentional ruse to mislead and manipulate an admin.
    3. Also, please note on the dif above that again he tells lies about several editors, saying we "are paid members from respective cults."

    A few editors have warned him on this, he has been given warnings on his user page, and he ignores all of these. It seems unlikely that his goal is to contribute meaningfully to Wikipedia. Renee (talk) 19:59, 18 March 2008 (UTC)[reply]

    Attempt to reveal the name of a pseudonymous editor

    The conflict of interstest page asserts that "Revealing the names of pseudonymous editors is in all cases against basic policy." And yet an editor named Boodlesthecat is attempting to do just that. See this diff. Putting aside my thoughts on his assumption, inductions, and logic -- which I strongly disagree with -- isn't his attempt to publicly guess and announce my my name a violation of policy? Thanks for you comments. Gni (talk) 19:15, 18 March 2008 (UTC)[reply]

    Based on the recent history, it certainly appears that you are merely hunting through EVERYTHING that Boodles has done and everything he does in the hopes of finding some sort of "impropriety" that you can make "stick". Look, stop trying to seek revenge against him because you consider him some sort of enemy. This is stalking and is wrong. Instead, return to editing articles, though I would avoid editing the CAMERA article, or any articles related to that one, as your edits there have gotten you into some trouble in the recent past. --Jayron32.talk.contribs 20:14, 18 March 2008 (UTC)[reply]